Body Mass Index Chart = overweight; = obese; >40= extreme obesity
|
|
- Kenneth Barker
- 5 years ago
- Views:
Transcription
1 Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 26 February 2007 Body Mass Index Chart = overweight; = obese; >40= extreme obesity 5'0" 5'2" 5'4" Weight (lbs) Height 5'6" 5'8" 5'10" 6'0" 6'2" 6'4" 1
2 Prevalence of Obesity and Diagnosed Diabetes Among US Adults, 1991 and 2001 Mokdad, A. H. et al. JAMA 2003;289:76-79 Relative Risk of Type 2 Diabetes in US Women According to BMI Relative risk (age-adjusted) Bars represent 95% confidence intervals < BMI (kg/m 2 ) Data derived from Colditz et al. Ann Intern Med. 1995;122:
3 Plasma Glucose and Insulin Profiles After Oral Glucose Challenge Reaven GM et al. Diabetologia. 1977;13:
4 4
5 5
6 Clinical definition of diabetes Plasma glucose > 200 mg/dl at any time or Fasting (post-absorptive) plasma glucose > 125 mg/dl or 2 hour post-75gm oral glucose load plasma glucose > 200 mg/dl Diab. Care; 23:381, 2000 Clinical Definition Impaired Glucose Tolerance Fasting (post-absorptive) plasma glucose: mg/dl or 2 hr (OGTT) plasma glucose: mg/dl Diab. Care; 23:381, 2000 & update
7 Predisposing Genes Predisposing Genes Predisposing Environment Obesity Type 2 Diabetes 80% diabetic are obese 50 % obese are diabetic Figure 1 7
8 Insulin action Insulin Insulin Receptor shc Cap RAS SOS GRB2 IRS Cbl Crk II Glucose Uptake RAF MAPKK PI 3-K PKC Glycogen Synthesis MAPK GSK3 SGK AKT p70s6k BAD Foxo Gene Expression PDE3b Protein Synthesis Anti-lipolysis Cell survival 8
9 In the absence of insulin, GLUT4 is localized to an intracellular compartment GLUT1 GLUT1 Membrane GLUT4 Nucleus In the presence of insulin, GLUT4 translocates to the plasma membrane GLUT1 GLUT4 IRS Membrane PI 3-K AKT? PKC GLUT4 Translocation Nucleus 9
10 10
11 Obici et al. Nature Medicine. 8:1396, 2002 Potential rate-controlling steps in insulin-mediated muscle glycogen synthesis 11
12 Mechanisms FFA-induced insulin resistance in skeletal muscle Randle Shulman Adipose tissue is an endocrine organ. Lean adipose tissue acrp30 Muscle acrp30 Obese adipose tissue TNF Liver TNF IL-6 leptin Brain IL-6 leptin 12
13 In obese mice, adipose tissue macrophages have an unusual morphology: lipid vacuoles, multinucleated. Lean 16- week BL6 female, omental fat ob/ob 16- week BL6 female, omental fat Weisberg et al., JCI, Dec 2003 Adipose tissue macrophages Perigonadal: r 2 = 0.7, P < 10 4 Perirenal: r 2 = 0.7, P < 10 4 Mesenteric: r 2 = 0.9, P < 10 4 Subcutaneous: r 2 = 0.39, P < 0.01 Weisberg et al., JCI, Dec
14 Improved insulin sensitivity in Ccr2 -/- mice Insulin tolerance test Glucose tolerance test = Ccr2 +/+ with dietary obesity; 44% body fat = Ccr2 -/- with dietary obesity; 45% body fat 14
15 Prospective Analysis 8 Year Cumulative Incidence (%) of Type 2 Diabetes in Pima Indians 317 NGT/62 Diabetics (%) Low Mid High AIR Low Mid High M 15
16 Diabetes Prevalence (%) in Offspring by Mother s Diabetes at Pregnancy Nondiabetic Prediabetic Diabetic Age (years) 16
17 Longitudinal Study of the Transition from NGT to Type 2 Diabetes Early Insulin Response vs Insulin Action 400 AIR (uu/ml) IGT DIA NGT N=17 NGT N=3 NGT 1 NGT M-low (mg/kg-embs/min) Adapted from Weyer et al,
18 DPPT 18
19 19
20 20
21 Genome-wide linkage studies for T2DM in humans GLUT1 Leptin receptor 2p24 2p21 HK2 3p24 Wolframin 1q q42 Lamin A/C IRS1 2q37 CAPN10 NeuroD1 5q13 PPARg 4q34 p85a GLUT2 FABP ADRB2b 3q27 5q31 PC-1 GCK PP1G 7q21 LEP 3-adrenergic rec 8p21 9p24 Frataxin 9q21 10p14 10q25 Insulin 11p13 KIR6.2 Sulf. receptor 12q15 HNF1a 12q24 IPF1 IRS2 14q31 16p12 Rad 17p12 HNF1b SERCA3 Glucagon receptor 18q11 Insulin receptor GIP receptor Glycogen synthase 20p12 HNF4a 20q12-13 Xq23 A3243G LOD LOD<3.6 21
22 Diabetes-susceptibility QTLs Chr1 Chr2 Chr5 Chr8 Chr14 Chr17 22
23 Islets in D/D animals are hypoplastic compared to islets in B/B animals B/B: D/D: 10x 4x Do beta cells in D/D animals replicate as well as beta cells in B/B animals? B/B: D/D: 60x 20x 23
24 Ll Ll In situ-stained zebrafish embryos Endoderm (foxa3-gfp) Control (buffer injected) 48 hpf (hours post fertilization) 12/12 single cluster cells Beta cells ( -insulin) Ll splice-site morpholino #1 48 hpf: Ll splice-site morpholino #2 48 hpf: 14/15 scattered cells 10/12 scattered cells Morpholino-mediated knock-down of mouse Ll ortholog in zebrafish results in a beta cell-specific defect 24
25 rat D1S1679 Cen to D1S UK French D1S2681D1S2658 D1S D1S398 Amish D1S APOA2? 1q21.3 Obq9 (obesity QTL): NZO x SM cross D1S2858 Utah? CRP D1S196 APOA2 Pima <45y D1S303? D1Mit145 Columbia (D1Mit270) (D1Mit401) GK ARNT NTRK1 DUSP12 GPA33 (D1Mit370) PBX q Framingham D1S1677 mouse Chinese D1S Pima <25y D1S2127 Region within GANESH (Genome Annotation Network for Expressed Sequence Hits) Comprative mouse-human-rat map for human chr 1q23 indicating populations and locations of peak LOD scores in linkage scans for type 2 diabetes. D1S human Scale: UCSC human browser (Nov02) (Mb) END 25
Body Mass Index Chart = overweight; = obese; >40= extreme obesity
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 25 February 2008 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" Weight (lbs)
More informationR. Leibel Naomi Berrie Diabetes Center 19 March 2010
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 19 March 2010 Body Mass Index Chart 25-29.9 29.9 = overweight; 30-39.9= 39.9 obese; >40= extreme obesity 5'0" 5'2" 52
More informationLipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein
Lipids Carbohydrate Protein Fatty Acids Glycerol Mono/di-saccarides Fat Liver Muscle Aminoacids Triglycerides Glycogen Protein Microvascular Macrovascular Diabetes-specific Diabetes-enhanced HbA1c 5.7(6.0)
More informationRole of fatty acids in the development of insulin resistance and type 2 diabetes mellitus
Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationGlucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
More informationInflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More informationBARIATRIC SURGERY AND TYPE 2 DIABETES MELLITUS
BARIATRIC SURGERY AND TYPE 2 DIABETES MELLITUS George Vl Valsamakis European Scope Fellow Obesity Visiting iti Associate Prof Warwick Medical School Diabetes is an increasing healthcare epidemic throughout
More informationDiabetes: Definition Pathophysiology Treatment Goals. By Scott Magee, MD, FACE
Diabetes: Definition Pathophysiology Treatment Goals By Scott Magee, MD, FACE Disclosures No disclosures to report Definition of Diabetes Mellitus Diabetes Mellitus comprises a group of disorders characterized
More informationLessons from conducting research in an American Indian community: The Pima Indians of Arizona
Lessons from conducting research in an American Indian community: The Pima Indians of Arizona Peter H. Bennett, M.B., F.R.C.P. Scientist Emeritus National Institute of Diabetes and Digestive and Kidney
More informationThe enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose
More informationCordoba 01/02/2008. Slides Professor Pierre LEFEBVRE
Cordoba 01/02/2008 Slides Professor Pierre LEFEBVRE Clinical Research in Type 2 Diabetes : Current Status and Future Approaches Pierre Lefèbvre* University of Liège Belgium Granada, Spain, February 2008
More informationNAFLD AND TYPE 2 DIABETES
NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationObesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
More informationMetabolic Syndrome in Asians
Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationHormonal Regulations Of Glucose Metabolism & DM
Hormonal Regulations Of Glucose Metabolism & DM What Hormones Regulate Metabolism? What Hormones Regulate Metabolism? Insulin Glucagon Thyroid hormones Cortisol Epinephrine Most regulation occurs in order
More informationMetabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine
Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1
More informationMETABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
More informationFinal Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours
Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationImpact of Exercise on Patients with Diabetes Mellitus
Impact of Exercise on Patients with Diabetes Mellitus Bret Goodpaster, Ph.D. Exercise Physiologist Assistant Professor of Medicine University of Pittsburgh Division of Endocrinology and Metabolism Learning
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationGlucose Regulation in the Body: New Understandings for Management
Glucose Regulation in the Body: New Understandings for Management Curtis Triplitt, PharmD, CDE Texas Diabetes Institute Assistant Professor, Medicine/Diabetes University of Texas Health Science Center
More informationla prise en charge du diabète de
N21 XIII Congrès National de Diabétologie, 29 mai 2011, Alger Intérêt et place des Anti DPP4 dans la prise en charge du diabète de type 2 Nicolas PAQUOT, MD, PhD CHU Sart-Tilman, Université de Liège Belgique
More informationIschemic Heart and Cerebrovascular Disease. Harold E. Lebovitz, MD, FACE Kathmandu November 2010
Ischemic Heart and Cerebrovascular Disease Harold E. Lebovitz, MD, FACE Kathmandu November 2010 Relationships Between Diabetes and Ischemic Heart Disease Risk of Cardiovascular Disease in Different Categories
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationWeek 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD
Week 3, Lecture 5a Pathophysiology of Diabetes Simin Liu, MD, ScD General Model of Peptide Hormone Action Hormone Plasma Membrane Activated Nucleus Cellular Trafficking Enzymes Inhibited Receptor Effector
More informationGene expression in insulin resistance
Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m
More informationGestational Diabetes: Long Term Metabolic Consequences. Outline 5/27/2014
Gestational Diabetes: Long Term Metabolic Consequences Gladys (Sandy) Ramos, MD Associate Clinical Professor Maternal Fetal Medicine Outline Population rates of obesity and T2DM Obesity and metabolic syndrome
More informationRoadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total
Diabetes and the Metabolic Syndrome in the Asian Population Alka Kanaya, MD Associate Professor of Medicine, UCSF Feb 26, 2010 Roadmap 1. Diabetes in Asian Americans Prevalence in the U.S. Risk factors
More informationFigure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationThe Endocrine Pancreas (Chapter 10) *
OpenStax-CNX module: m62118 1 The Endocrine Pancreas (Chapter 10) * Ildar Yakhin Based on The Endocrine Pancreas by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
More informationWhat would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
More informationImproving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D.
Improving Diabetes Research: Moving Beyond Animal Models Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. July 19, 2014 From Bench-to-Bedside Sulfonylurea Biguanide Dipeptidyl peptidase-4 inhibitor Glucagon-like
More information28/04/51. Introduction. Insulin signaling effects on memory and mood. Is accelerated brain aging a consequence of diabetes? chronic hyperglycemia
Introduction Insulin signaling effects on memory and mood (Review) Diabetes mellitus is a chronic disease resulting from defects in insulin secretion, insulin action, or both Long-term diabetes Lawrence
More informationMaximizing the Role of WIC Nutritionists in Prevention of DM2 among High Risk Clients ESTHER G. SCHUSTER, MS,RD,CDE
Maximizing the Role of WIC Nutritionists in Prevention of DM2 among High Risk Clients ESTHER G. SCHUSTER, MS,RD,CDE Heavy Numbers Surgeon General report: 68% of adults in U. S. are overweight or obese
More informationInsulin resistance and pancreatic b cell failure
Review series introduction Insulin resistance and pancreatic b cell failure Masato Kasuga Department of Clinical Molecular Medicine, Kobe University Graduate School of Medicine, Kobe, Japan. It is now
More informationA thesis submitted to the. Graduate School of the University of Cincinnati. in partial fulfillment of the requirements for the degree of
The association between erythrocyte docosahexaenoic acid (EDHA) status and insulin sensitivity in overweight/obese pregnant women of different racial/ethnic groups A thesis submitted to the Graduate School
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationChapter 12. Ingestive Behavior
Chapter 12 Ingestive Behavior Drinking a. fluid compartments b. osmometric thirst c. volumetric thirst Eating a. energy sources b. starting a meal c. stopping a meal d. eating disordersd Drinking a. fluid
More informationFor more information about how to cite these materials visit
Author(s): Arno Kumagai, M.D., 2009 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Noncommercial Share Alike 3.0 License: http://creativecommons.org/licenses/by-nc-sa/3.0/
More informationDiabetes Management and Considerations for the Indian Culture
Diabetes Management and Considerations for the Indian Culture Ramachandra G. Naik, MD Senior Medical Director Worldwide Clinical Affairs Johnson & Johnson Diabetes Solutions Companies September 24, 2015
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationDOES INSULIN RESISTANCE CAUSE HYPERANDROGENEMIA OR HYPERANDROGENEMIA CAUSES INSULIN RESISTANCE IN PCOS
DOES INSULIN RESISTANCE CAUSE HYPERANDROGENEMIA OR HYPERANDROGENEMIA CAUSES INSULIN RESISTANCE IN PCOS D R. G A N A P A T H I. B D E P T. O F E N D O C R I N O L O G Y S T. J O H N S M E D I C A L C O
More informationWeek 3 The Pancreas: Pancreatic ph buffering:
Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions
More informationEnergy Balance Equation
Energy Balance Equation Intake Expenditure Hunger Satiety Nutrient Absorption Metabolic Rate Thermogenesis Activity Eat to Live! Live to Eat! EAT TO LIVE Intake = Expenditure Weight Stable LIVE TO EAT
More informationThe epidemic continues
Epidemiology!and!Pathophysiology of!type!2!diabetes!and!obesity!! Israel!A.!Hartman,!MD,!FACE Clinical!Instructor!of!Internal!Medicine UT!Southwestern Medical!Center Dallas,!Texas Diabetes in the USA >26
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More informationEAT TO LIVE: THE ROLE OF THE PANCREAS. Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008
EAT TO LIVE: THE ROLE OF THE PANCREAS Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008 THE ROLE OF THE PANCREAS Exocrine pancreas Endocrine pancreas THE ROLE OF THE PANCREAS EXOCRINE
More informationEffects of Exercise and Physical Activity on Diabetes Mellitus and Obesity
1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism
More informationCase- history. Lab results
Neda Rasouli, M.D. Associate Professor of Medicine Division of Endocrinology, UC Denver VA_ Eastern Colorado Health Care System Case- history 46 y/o AA male with BMI 37 presented in Oct 2001 with polyuria,
More informationDiabetes: Across the Lifespan Friday, October 17, Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children.
Diabetes: Across the Lifespan Friday, October 17, 2014 Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children. Don P. Wilson, M.D., FNLA Diplomate, Am Brd of Clinical Lipidology
More informationDiabetes and Cardiovascular Risks in the Polycystic Ovary Syndrome
Diabetes and Cardiovascular Risks in the Polycystic Ovary Syndrome John E. Nestler, M.D. William Branch Porter Professor of Medicine Chair, Department of Internal Medicine Virginia Commonwealth University
More informationExpanded View Figures
Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old
More informationMetabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
More informationDiabetes Mellitus in the Pediatric Patient
Diabetes Mellitus in the Pediatric Patient William Bryant, M.D. Chief of Section Pediatric Endocrinology Children s Hospital at Scott & White Texas A&M University Temple, Texas Disclosures None Definitions
More informationCardiovascular Disease After Spinal Cord Injury: Achieving Best Practice. Suzanne Groah, MD, MSPH Walter Reed Army Medical Center February 12, 2010
Cardiovascular Disease After Spinal Cord Injury: Achieving Best Practice Suzanne Groah, MD, MSPH Walter Reed Army Medical Center February 12, 2010 CAVEAT LECTOR 2 CVD-related Mortality in Aging SCI GU
More informationNormal Fuel Metabolism Five phases of fuel homeostasis have been described A. Phase I is the fed state (0 to 3.9 hours after meal/food consumption),
Normal Fuel Metabolism Five phases of fuel homeostasis have been described A. Phase I is the fed state (0 to 3.9 hours after meal/food consumption), in which blood glucose predominantly originates from
More informationΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ
ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )
More informationTargeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
More informationThe Mediterranean Diet: HOW and WHY It Works So Well for T2DM
The Mediterranean Diet: HOW and WHY It Works So Well for T2DM Susan L. Barlow, RD, CDE. Objectives 1. Discuss the effects of meal size on GLP-1 concentrations. 2. Compare and contrast the specific effects
More informationInitiating Insulin in Primary Care for Type 2 Diabetes Mellitus. Dr Manish Khanolkar, Diabetologist, Auckland Diabetes Centre
Initiating Insulin in Primary Care for Type 2 Diabetes Mellitus Dr Manish Khanolkar, Diabetologist, Auckland Diabetes Centre Outline How big is the problem? Natural progression of type 2 diabetes What
More informationSecular Trends in Birth Weight, BMI, and Diabetes in the Offspring of Diabetic Mothers
Epidemiology/Health Services/Psychosocial Research O R I G I N A L A R T I C L E Secular Trends in Birth Weight, BMI, and Diabetes in the Offspring of Diabetic Mothers ROBERT S. LINDSAY, MB, PHD ROBERT
More informationHuman Physiology 6.6- Hormones, Homeostasis, and Reproduction
Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Essential idea: Hormones are used when signals need to be widely distributed. Application: William Harvey s investigation of sexual reproduction
More informationAGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine
AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION Kitt Falk Petersen, M.D. Yale University School of Medicine % of Population Prevalence of Diabetes and Glucose Intolerance 45 40 35 30 25 20 15 10 5
More informationPrevention of diabetes in the modern era of affluent society and economic constraints
Prevention of diabetes in the modern era of affluent society and economic constraints KONSTANTINOS MAKRILAKIS, MD, MPH, PhD ASSOCIATE PROFESSOR IN INTERNAL MEDICINE NATIONAL AND KAPODISTRIAN UNIVERSITY
More informationProf C.S. Yajnik MD,FRCP KEM HOSPITAL, PUNE, INDIA
Trans-generational impact of the double burden of malnutrition A case study from India Prof C.S. Yajnik MD,FRCP KEM HOSPITAL, PUNE, INDIA www.kemdiabetes.org Life can only be understood backwards - Soren
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationUnderstanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes. October 2015; SAGLB.DIA
Understanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes October 2015; SAGLB.DIA.15.10.0821 Acknowledgement The content of this slide deck summarizes the key points
More informationWEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State
More informationChild born in year /3 will die before parents in US (diabetes)
Child born in year 2000-1/3 will die before parents in US (diabetes) ATP III identified 6 components of the metabolic syndrome that relate to CVD 1. Abdominal obesity 2. Atherogenic dyslipidemia (elevated
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationKEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION
Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called
More informationImpacts of prenatal malnutrition and an early obesogenic diet on adipose tissue morphology and gene expression in adult sheep
Impacts of prenatal malnutrition and an early obesogenic diet on adipose tissue morphology and gene expression in adult sheep Sharmila Ahmad 1, Lise K. Lyngman 1, Rajan Dhakal 1, Morteza Mansouryar 1,
More informationMATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS
Note: for non-commercial purposes only MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS Olaf Uhl 2 1, 1 0, Log10(p-value) 0-0, -1-1, -2-2, LPC160 PC160-160 PC160-181 PC160-203 PC160-226 PC180-181
More informationGlucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon
Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of
More informationNovel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases. Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute
Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute Primarily I asked questions on biological issues on
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationDiabetes in Older Adults
Diabetes in Older Adults NICOLAS MUSI, MD Barshop Institute for Longevity and Aging Studies San Antonio GRECC University of Texas Health Science Center San Antonio, TX Metabolic Alterations in Aging Sarcopenia
More informationMETABOLISMO E VITAMINA D
CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster
More informationPCOS & Diet Therapy. Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015
PCOS & Diet Therapy Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015 Questions to be discussed: 1) Why dietary modification is considered as first line of treatment? 2) What
More informationLeptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
More informationHormonal regulation of. Physiology Department Medical School, University of Sumatera Utara
Hormonal regulation of nutrient metabolism Physiology Department Medical School, University of Sumatera Utara Homeostasis & Controls Successful compensation Homeostasis reestablished Failure to compensate
More informationDiabetes mellitus. Diabetes mellitus - 1. Diabetes mellitus Lecture from pathological physiology
Diabetes mellitus Lecture from pathological physiology Oliver Rácz, 2007-2018 Šafárik University, Košice, Slovakia In cooperation with F. Ništiar, (immunology) A. Chmelárová, (biochemistry) D. Kuzmová,
More informationSignal transduction of insulin
Signal transduction of insulin Diabetes mellitus is a severe chronic disease, affecting 6-11 percent of the populations aged 30-64 and about 20 percent of those older than age 65 throughout the world.
More informationSkeletal muscle lipid deposition and insulin resistance: effect of dietary fatty acids and exercise 1 3
Skeletal muscle lipid deposition and insulin resistance: effect of dietary fatty acids and exercise 1 3 Michael P Corcoran, Stefania Lamon-Fava, and Roger A Fielding ABSTRACT Mounting evidence indicates
More informationSupplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationYiying Zhang, PhD Research Scientist. Research Summary:
Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationIntracellular signalling pathways activated by leptin by Gema FRUHBECK. Presentation by Amnesiacs Anonymous
Intracellular signalling pathways activated by leptin by Gema FRUHBECK Presentation by Amnesiacs Anonymous Introduction to Leptin By Ahrial Young Why is Leptin important? Pleiotropic = it controls the
More informationType 2 Diabetes in Adolescents
Type 2 Diabetes in Adolescents Disclosures Paid consultant, Eli Lilly, Inc, Pediatric Type 2 Diabetes Clinical Trials Outline The burden of diabetes Treatment and Prevention Youth Diabetes Prevention Clinic
More information