Body Mass Index Chart = overweight; = obese; >40= extreme obesity

Size: px
Start display at page:

Download "Body Mass Index Chart = overweight; = obese; >40= extreme obesity"

Transcription

1 Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 26 February 2007 Body Mass Index Chart = overweight; = obese; >40= extreme obesity 5'0" 5'2" 5'4" Weight (lbs) Height 5'6" 5'8" 5'10" 6'0" 6'2" 6'4" 1

2 Prevalence of Obesity and Diagnosed Diabetes Among US Adults, 1991 and 2001 Mokdad, A. H. et al. JAMA 2003;289:76-79 Relative Risk of Type 2 Diabetes in US Women According to BMI Relative risk (age-adjusted) Bars represent 95% confidence intervals < BMI (kg/m 2 ) Data derived from Colditz et al. Ann Intern Med. 1995;122:

3 Plasma Glucose and Insulin Profiles After Oral Glucose Challenge Reaven GM et al. Diabetologia. 1977;13:

4 4

5 5

6 Clinical definition of diabetes Plasma glucose > 200 mg/dl at any time or Fasting (post-absorptive) plasma glucose > 125 mg/dl or 2 hour post-75gm oral glucose load plasma glucose > 200 mg/dl Diab. Care; 23:381, 2000 Clinical Definition Impaired Glucose Tolerance Fasting (post-absorptive) plasma glucose: mg/dl or 2 hr (OGTT) plasma glucose: mg/dl Diab. Care; 23:381, 2000 & update

7 Predisposing Genes Predisposing Genes Predisposing Environment Obesity Type 2 Diabetes 80% diabetic are obese 50 % obese are diabetic Figure 1 7

8 Insulin action Insulin Insulin Receptor shc Cap RAS SOS GRB2 IRS Cbl Crk II Glucose Uptake RAF MAPKK PI 3-K PKC Glycogen Synthesis MAPK GSK3 SGK AKT p70s6k BAD Foxo Gene Expression PDE3b Protein Synthesis Anti-lipolysis Cell survival 8

9 In the absence of insulin, GLUT4 is localized to an intracellular compartment GLUT1 GLUT1 Membrane GLUT4 Nucleus In the presence of insulin, GLUT4 translocates to the plasma membrane GLUT1 GLUT4 IRS Membrane PI 3-K AKT? PKC GLUT4 Translocation Nucleus 9

10 10

11 Obici et al. Nature Medicine. 8:1396, 2002 Potential rate-controlling steps in insulin-mediated muscle glycogen synthesis 11

12 Mechanisms FFA-induced insulin resistance in skeletal muscle Randle Shulman Adipose tissue is an endocrine organ. Lean adipose tissue acrp30 Muscle acrp30 Obese adipose tissue TNF Liver TNF IL-6 leptin Brain IL-6 leptin 12

13 In obese mice, adipose tissue macrophages have an unusual morphology: lipid vacuoles, multinucleated. Lean 16- week BL6 female, omental fat ob/ob 16- week BL6 female, omental fat Weisberg et al., JCI, Dec 2003 Adipose tissue macrophages Perigonadal: r 2 = 0.7, P < 10 4 Perirenal: r 2 = 0.7, P < 10 4 Mesenteric: r 2 = 0.9, P < 10 4 Subcutaneous: r 2 = 0.39, P < 0.01 Weisberg et al., JCI, Dec

14 Improved insulin sensitivity in Ccr2 -/- mice Insulin tolerance test Glucose tolerance test = Ccr2 +/+ with dietary obesity; 44% body fat = Ccr2 -/- with dietary obesity; 45% body fat 14

15 Prospective Analysis 8 Year Cumulative Incidence (%) of Type 2 Diabetes in Pima Indians 317 NGT/62 Diabetics (%) Low Mid High AIR Low Mid High M 15

16 Diabetes Prevalence (%) in Offspring by Mother s Diabetes at Pregnancy Nondiabetic Prediabetic Diabetic Age (years) 16

17 Longitudinal Study of the Transition from NGT to Type 2 Diabetes Early Insulin Response vs Insulin Action 400 AIR (uu/ml) IGT DIA NGT N=17 NGT N=3 NGT 1 NGT M-low (mg/kg-embs/min) Adapted from Weyer et al,

18 DPPT 18

19 19

20 20

21 Genome-wide linkage studies for T2DM in humans GLUT1 Leptin receptor 2p24 2p21 HK2 3p24 Wolframin 1q q42 Lamin A/C IRS1 2q37 CAPN10 NeuroD1 5q13 PPARg 4q34 p85a GLUT2 FABP ADRB2b 3q27 5q31 PC-1 GCK PP1G 7q21 LEP 3-adrenergic rec 8p21 9p24 Frataxin 9q21 10p14 10q25 Insulin 11p13 KIR6.2 Sulf. receptor 12q15 HNF1a 12q24 IPF1 IRS2 14q31 16p12 Rad 17p12 HNF1b SERCA3 Glucagon receptor 18q11 Insulin receptor GIP receptor Glycogen synthase 20p12 HNF4a 20q12-13 Xq23 A3243G LOD LOD<3.6 21

22 Diabetes-susceptibility QTLs Chr1 Chr2 Chr5 Chr8 Chr14 Chr17 22

23 Islets in D/D animals are hypoplastic compared to islets in B/B animals B/B: D/D: 10x 4x Do beta cells in D/D animals replicate as well as beta cells in B/B animals? B/B: D/D: 60x 20x 23

24 Ll Ll In situ-stained zebrafish embryos Endoderm (foxa3-gfp) Control (buffer injected) 48 hpf (hours post fertilization) 12/12 single cluster cells Beta cells ( -insulin) Ll splice-site morpholino #1 48 hpf: Ll splice-site morpholino #2 48 hpf: 14/15 scattered cells 10/12 scattered cells Morpholino-mediated knock-down of mouse Ll ortholog in zebrafish results in a beta cell-specific defect 24

25 rat D1S1679 Cen to D1S UK French D1S2681D1S2658 D1S D1S398 Amish D1S APOA2? 1q21.3 Obq9 (obesity QTL): NZO x SM cross D1S2858 Utah? CRP D1S196 APOA2 Pima <45y D1S303? D1Mit145 Columbia (D1Mit270) (D1Mit401) GK ARNT NTRK1 DUSP12 GPA33 (D1Mit370) PBX q Framingham D1S1677 mouse Chinese D1S Pima <25y D1S2127 Region within GANESH (Genome Annotation Network for Expressed Sequence Hits) Comprative mouse-human-rat map for human chr 1q23 indicating populations and locations of peak LOD scores in linkage scans for type 2 diabetes. D1S human Scale: UCSC human browser (Nov02) (Mb) END 25

Body Mass Index Chart = overweight; = obese; >40= extreme obesity

Body Mass Index Chart = overweight; = obese; >40= extreme obesity Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 25 February 2008 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" Weight (lbs)

More information

R. Leibel Naomi Berrie Diabetes Center 19 March 2010

R. Leibel Naomi Berrie Diabetes Center 19 March 2010 Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 19 March 2010 Body Mass Index Chart 25-29.9 29.9 = overweight; 30-39.9= 39.9 obese; >40= extreme obesity 5'0" 5'2" 52

More information

Lipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein

Lipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein Lipids Carbohydrate Protein Fatty Acids Glycerol Mono/di-saccarides Fat Liver Muscle Aminoacids Triglycerides Glycogen Protein Microvascular Macrovascular Diabetes-specific Diabetes-enhanced HbA1c 5.7(6.0)

More information

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating

More information

Pathogenesis of Diabetes Mellitus

Pathogenesis of Diabetes Mellitus Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia

More information

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the

More information

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic

More information

BARIATRIC SURGERY AND TYPE 2 DIABETES MELLITUS

BARIATRIC SURGERY AND TYPE 2 DIABETES MELLITUS BARIATRIC SURGERY AND TYPE 2 DIABETES MELLITUS George Vl Valsamakis European Scope Fellow Obesity Visiting iti Associate Prof Warwick Medical School Diabetes is an increasing healthcare epidemic throughout

More information

Diabetes: Definition Pathophysiology Treatment Goals. By Scott Magee, MD, FACE

Diabetes: Definition Pathophysiology Treatment Goals. By Scott Magee, MD, FACE Diabetes: Definition Pathophysiology Treatment Goals By Scott Magee, MD, FACE Disclosures No disclosures to report Definition of Diabetes Mellitus Diabetes Mellitus comprises a group of disorders characterized

More information

Lessons from conducting research in an American Indian community: The Pima Indians of Arizona

Lessons from conducting research in an American Indian community: The Pima Indians of Arizona Lessons from conducting research in an American Indian community: The Pima Indians of Arizona Peter H. Bennett, M.B., F.R.C.P. Scientist Emeritus National Institute of Diabetes and Digestive and Kidney

More information

The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans

The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose

More information

Cordoba 01/02/2008. Slides Professor Pierre LEFEBVRE

Cordoba 01/02/2008. Slides Professor Pierre LEFEBVRE Cordoba 01/02/2008 Slides Professor Pierre LEFEBVRE Clinical Research in Type 2 Diabetes : Current Status and Future Approaches Pierre Lefèbvre* University of Liège Belgium Granada, Spain, February 2008

More information

NAFLD AND TYPE 2 DIABETES

NAFLD AND TYPE 2 DIABETES NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213

More information

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H. U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,

More information

Obesity in aging: Hormonal contribution

Obesity in aging: Hormonal contribution Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes

More information

Metabolic Syndrome in Asians

Metabolic Syndrome in Asians Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

Hormonal Regulations Of Glucose Metabolism & DM

Hormonal Regulations Of Glucose Metabolism & DM Hormonal Regulations Of Glucose Metabolism & DM What Hormones Regulate Metabolism? What Hormones Regulate Metabolism? Insulin Glucagon Thyroid hormones Cortisol Epinephrine Most regulation occurs in order

More information

Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine

Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1

More information

METABOLIC SYNDROME AND HCV: FROM HCV

METABOLIC SYNDROME AND HCV: FROM HCV METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,

More information

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Impact of Exercise on Patients with Diabetes Mellitus

Impact of Exercise on Patients with Diabetes Mellitus Impact of Exercise on Patients with Diabetes Mellitus Bret Goodpaster, Ph.D. Exercise Physiologist Assistant Professor of Medicine University of Pittsburgh Division of Endocrinology and Metabolism Learning

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Glucose Regulation in the Body: New Understandings for Management

Glucose Regulation in the Body: New Understandings for Management Glucose Regulation in the Body: New Understandings for Management Curtis Triplitt, PharmD, CDE Texas Diabetes Institute Assistant Professor, Medicine/Diabetes University of Texas Health Science Center

More information

la prise en charge du diabète de

la prise en charge du diabète de N21 XIII Congrès National de Diabétologie, 29 mai 2011, Alger Intérêt et place des Anti DPP4 dans la prise en charge du diabète de type 2 Nicolas PAQUOT, MD, PhD CHU Sart-Tilman, Université de Liège Belgique

More information

Ischemic Heart and Cerebrovascular Disease. Harold E. Lebovitz, MD, FACE Kathmandu November 2010

Ischemic Heart and Cerebrovascular Disease. Harold E. Lebovitz, MD, FACE Kathmandu November 2010 Ischemic Heart and Cerebrovascular Disease Harold E. Lebovitz, MD, FACE Kathmandu November 2010 Relationships Between Diabetes and Ischemic Heart Disease Risk of Cardiovascular Disease in Different Categories

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Week 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD

Week 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD Week 3, Lecture 5a Pathophysiology of Diabetes Simin Liu, MD, ScD General Model of Peptide Hormone Action Hormone Plasma Membrane Activated Nucleus Cellular Trafficking Enzymes Inhibited Receptor Effector

More information

Gene expression in insulin resistance

Gene expression in insulin resistance Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m

More information

Gestational Diabetes: Long Term Metabolic Consequences. Outline 5/27/2014

Gestational Diabetes: Long Term Metabolic Consequences. Outline 5/27/2014 Gestational Diabetes: Long Term Metabolic Consequences Gladys (Sandy) Ramos, MD Associate Clinical Professor Maternal Fetal Medicine Outline Population rates of obesity and T2DM Obesity and metabolic syndrome

More information

Roadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total

Roadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total Diabetes and the Metabolic Syndrome in the Asian Population Alka Kanaya, MD Associate Professor of Medicine, UCSF Feb 26, 2010 Roadmap 1. Diabetes in Asian Americans Prevalence in the U.S. Risk factors

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

In The Name Of God. In The Name Of. EMRI Modeling Group

In The Name Of God. In The Name Of. EMRI Modeling Group In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement

More information

The Endocrine Pancreas (Chapter 10) *

The Endocrine Pancreas (Chapter 10) * OpenStax-CNX module: m62118 1 The Endocrine Pancreas (Chapter 10) * Ildar Yakhin Based on The Endocrine Pancreas by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons

More information

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.

More information

Improving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D.

Improving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. Improving Diabetes Research: Moving Beyond Animal Models Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. July 19, 2014 From Bench-to-Bedside Sulfonylurea Biguanide Dipeptidyl peptidase-4 inhibitor Glucagon-like

More information

28/04/51. Introduction. Insulin signaling effects on memory and mood. Is accelerated brain aging a consequence of diabetes? chronic hyperglycemia

28/04/51. Introduction. Insulin signaling effects on memory and mood. Is accelerated brain aging a consequence of diabetes? chronic hyperglycemia Introduction Insulin signaling effects on memory and mood (Review) Diabetes mellitus is a chronic disease resulting from defects in insulin secretion, insulin action, or both Long-term diabetes Lawrence

More information

Maximizing the Role of WIC Nutritionists in Prevention of DM2 among High Risk Clients ESTHER G. SCHUSTER, MS,RD,CDE

Maximizing the Role of WIC Nutritionists in Prevention of DM2 among High Risk Clients ESTHER G. SCHUSTER, MS,RD,CDE Maximizing the Role of WIC Nutritionists in Prevention of DM2 among High Risk Clients ESTHER G. SCHUSTER, MS,RD,CDE Heavy Numbers Surgeon General report: 68% of adults in U. S. are overweight or obese

More information

Insulin resistance and pancreatic b cell failure

Insulin resistance and pancreatic b cell failure Review series introduction Insulin resistance and pancreatic b cell failure Masato Kasuga Department of Clinical Molecular Medicine, Kobe University Graduate School of Medicine, Kobe, Japan. It is now

More information

A thesis submitted to the. Graduate School of the University of Cincinnati. in partial fulfillment of the requirements for the degree of

A thesis submitted to the. Graduate School of the University of Cincinnati. in partial fulfillment of the requirements for the degree of The association between erythrocyte docosahexaenoic acid (EDHA) status and insulin sensitivity in overweight/obese pregnant women of different racial/ethnic groups A thesis submitted to the Graduate School

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Chapter 12. Ingestive Behavior

Chapter 12. Ingestive Behavior Chapter 12 Ingestive Behavior Drinking a. fluid compartments b. osmometric thirst c. volumetric thirst Eating a. energy sources b. starting a meal c. stopping a meal d. eating disordersd Drinking a. fluid

More information

For more information about how to cite these materials visit

For more information about how to cite these materials visit Author(s): Arno Kumagai, M.D., 2009 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Noncommercial Share Alike 3.0 License: http://creativecommons.org/licenses/by-nc-sa/3.0/

More information

Diabetes Management and Considerations for the Indian Culture

Diabetes Management and Considerations for the Indian Culture Diabetes Management and Considerations for the Indian Culture Ramachandra G. Naik, MD Senior Medical Director Worldwide Clinical Affairs Johnson & Johnson Diabetes Solutions Companies September 24, 2015

More information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S2. b-galactosidase staining of SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

More information

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health

More information

DOES INSULIN RESISTANCE CAUSE HYPERANDROGENEMIA OR HYPERANDROGENEMIA CAUSES INSULIN RESISTANCE IN PCOS

DOES INSULIN RESISTANCE CAUSE HYPERANDROGENEMIA OR HYPERANDROGENEMIA CAUSES INSULIN RESISTANCE IN PCOS DOES INSULIN RESISTANCE CAUSE HYPERANDROGENEMIA OR HYPERANDROGENEMIA CAUSES INSULIN RESISTANCE IN PCOS D R. G A N A P A T H I. B D E P T. O F E N D O C R I N O L O G Y S T. J O H N S M E D I C A L C O

More information

Week 3 The Pancreas: Pancreatic ph buffering:

Week 3 The Pancreas: Pancreatic ph buffering: Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions

More information

Energy Balance Equation

Energy Balance Equation Energy Balance Equation Intake Expenditure Hunger Satiety Nutrient Absorption Metabolic Rate Thermogenesis Activity Eat to Live! Live to Eat! EAT TO LIVE Intake = Expenditure Weight Stable LIVE TO EAT

More information

The epidemic continues

The epidemic continues Epidemiology!and!Pathophysiology of!type!2!diabetes!and!obesity!! Israel!A.!Hartman,!MD,!FACE Clinical!Instructor!of!Internal!Medicine UT!Southwestern Medical!Center Dallas,!Texas Diabetes in the USA >26

More information

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia

More information

EAT TO LIVE: THE ROLE OF THE PANCREAS. Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008

EAT TO LIVE: THE ROLE OF THE PANCREAS. Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008 EAT TO LIVE: THE ROLE OF THE PANCREAS Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008 THE ROLE OF THE PANCREAS Exocrine pancreas Endocrine pancreas THE ROLE OF THE PANCREAS EXOCRINE

More information

Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity

Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity 1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism

More information

Case- history. Lab results

Case- history. Lab results Neda Rasouli, M.D. Associate Professor of Medicine Division of Endocrinology, UC Denver VA_ Eastern Colorado Health Care System Case- history 46 y/o AA male with BMI 37 presented in Oct 2001 with polyuria,

More information

Diabetes: Across the Lifespan Friday, October 17, Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children.

Diabetes: Across the Lifespan Friday, October 17, Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children. Diabetes: Across the Lifespan Friday, October 17, 2014 Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children. Don P. Wilson, M.D., FNLA Diplomate, Am Brd of Clinical Lipidology

More information

Diabetes and Cardiovascular Risks in the Polycystic Ovary Syndrome

Diabetes and Cardiovascular Risks in the Polycystic Ovary Syndrome Diabetes and Cardiovascular Risks in the Polycystic Ovary Syndrome John E. Nestler, M.D. William Branch Porter Professor of Medicine Chair, Department of Internal Medicine Virginia Commonwealth University

More information

Expanded View Figures

Expanded View Figures Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

More information

Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are

More information

Diabetes Mellitus in the Pediatric Patient

Diabetes Mellitus in the Pediatric Patient Diabetes Mellitus in the Pediatric Patient William Bryant, M.D. Chief of Section Pediatric Endocrinology Children s Hospital at Scott & White Texas A&M University Temple, Texas Disclosures None Definitions

More information

Cardiovascular Disease After Spinal Cord Injury: Achieving Best Practice. Suzanne Groah, MD, MSPH Walter Reed Army Medical Center February 12, 2010

Cardiovascular Disease After Spinal Cord Injury: Achieving Best Practice. Suzanne Groah, MD, MSPH Walter Reed Army Medical Center February 12, 2010 Cardiovascular Disease After Spinal Cord Injury: Achieving Best Practice Suzanne Groah, MD, MSPH Walter Reed Army Medical Center February 12, 2010 CAVEAT LECTOR 2 CVD-related Mortality in Aging SCI GU

More information

Normal Fuel Metabolism Five phases of fuel homeostasis have been described A. Phase I is the fed state (0 to 3.9 hours after meal/food consumption),

Normal Fuel Metabolism Five phases of fuel homeostasis have been described A. Phase I is the fed state (0 to 3.9 hours after meal/food consumption), Normal Fuel Metabolism Five phases of fuel homeostasis have been described A. Phase I is the fed state (0 to 3.9 hours after meal/food consumption), in which blood glucose predominantly originates from

More information

ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ

ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

The Mediterranean Diet: HOW and WHY It Works So Well for T2DM

The Mediterranean Diet: HOW and WHY It Works So Well for T2DM The Mediterranean Diet: HOW and WHY It Works So Well for T2DM Susan L. Barlow, RD, CDE. Objectives 1. Discuss the effects of meal size on GLP-1 concentrations. 2. Compare and contrast the specific effects

More information

Initiating Insulin in Primary Care for Type 2 Diabetes Mellitus. Dr Manish Khanolkar, Diabetologist, Auckland Diabetes Centre

Initiating Insulin in Primary Care for Type 2 Diabetes Mellitus. Dr Manish Khanolkar, Diabetologist, Auckland Diabetes Centre Initiating Insulin in Primary Care for Type 2 Diabetes Mellitus Dr Manish Khanolkar, Diabetologist, Auckland Diabetes Centre Outline How big is the problem? Natural progression of type 2 diabetes What

More information

Secular Trends in Birth Weight, BMI, and Diabetes in the Offspring of Diabetic Mothers

Secular Trends in Birth Weight, BMI, and Diabetes in the Offspring of Diabetic Mothers Epidemiology/Health Services/Psychosocial Research O R I G I N A L A R T I C L E Secular Trends in Birth Weight, BMI, and Diabetes in the Offspring of Diabetic Mothers ROBERT S. LINDSAY, MB, PHD ROBERT

More information

Human Physiology 6.6- Hormones, Homeostasis, and Reproduction

Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Essential idea: Hormones are used when signals need to be widely distributed. Application: William Harvey s investigation of sexual reproduction

More information

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION Kitt Falk Petersen, M.D. Yale University School of Medicine % of Population Prevalence of Diabetes and Glucose Intolerance 45 40 35 30 25 20 15 10 5

More information

Prevention of diabetes in the modern era of affluent society and economic constraints

Prevention of diabetes in the modern era of affluent society and economic constraints Prevention of diabetes in the modern era of affluent society and economic constraints KONSTANTINOS MAKRILAKIS, MD, MPH, PhD ASSOCIATE PROFESSOR IN INTERNAL MEDICINE NATIONAL AND KAPODISTRIAN UNIVERSITY

More information

Prof C.S. Yajnik MD,FRCP KEM HOSPITAL, PUNE, INDIA

Prof C.S. Yajnik MD,FRCP KEM HOSPITAL, PUNE, INDIA Trans-generational impact of the double burden of malnutrition A case study from India Prof C.S. Yajnik MD,FRCP KEM HOSPITAL, PUNE, INDIA www.kemdiabetes.org Life can only be understood backwards - Soren

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Understanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes. October 2015; SAGLB.DIA

Understanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes. October 2015; SAGLB.DIA Understanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes October 2015; SAGLB.DIA.15.10.0821 Acknowledgement The content of this slide deck summarizes the key points

More information

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State

More information

Child born in year /3 will die before parents in US (diabetes)

Child born in year /3 will die before parents in US (diabetes) Child born in year 2000-1/3 will die before parents in US (diabetes) ATP III identified 6 components of the metabolic syndrome that relate to CVD 1. Abdominal obesity 2. Atherogenic dyslipidemia (elevated

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called

More information

Impacts of prenatal malnutrition and an early obesogenic diet on adipose tissue morphology and gene expression in adult sheep

Impacts of prenatal malnutrition and an early obesogenic diet on adipose tissue morphology and gene expression in adult sheep Impacts of prenatal malnutrition and an early obesogenic diet on adipose tissue morphology and gene expression in adult sheep Sharmila Ahmad 1, Lise K. Lyngman 1, Rajan Dhakal 1, Morteza Mansouryar 1,

More information

MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS

MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS Note: for non-commercial purposes only MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS Olaf Uhl 2 1, 1 0, Log10(p-value) 0-0, -1-1, -2-2, LPC160 PC160-160 PC160-181 PC160-203 PC160-226 PC180-181

More information

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of

More information

Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases. Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute

Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases. Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute Primarily I asked questions on biological issues on

More information

Growth and Differentiation Phosphorylation Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit

More information

Diabetes in Older Adults

Diabetes in Older Adults Diabetes in Older Adults NICOLAS MUSI, MD Barshop Institute for Longevity and Aging Studies San Antonio GRECC University of Texas Health Science Center San Antonio, TX Metabolic Alterations in Aging Sarcopenia

More information

METABOLISMO E VITAMINA D

METABOLISMO E VITAMINA D CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster

More information

PCOS & Diet Therapy. Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015

PCOS & Diet Therapy. Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015 PCOS & Diet Therapy Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015 Questions to be discussed: 1) Why dietary modification is considered as first line of treatment? 2) What

More information

Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph

Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings

More information

Hormonal regulation of. Physiology Department Medical School, University of Sumatera Utara

Hormonal regulation of. Physiology Department Medical School, University of Sumatera Utara Hormonal regulation of nutrient metabolism Physiology Department Medical School, University of Sumatera Utara Homeostasis & Controls Successful compensation Homeostasis reestablished Failure to compensate

More information

Diabetes mellitus. Diabetes mellitus - 1. Diabetes mellitus Lecture from pathological physiology

Diabetes mellitus. Diabetes mellitus - 1. Diabetes mellitus Lecture from pathological physiology Diabetes mellitus Lecture from pathological physiology Oliver Rácz, 2007-2018 Šafárik University, Košice, Slovakia In cooperation with F. Ništiar, (immunology) A. Chmelárová, (biochemistry) D. Kuzmová,

More information

Signal transduction of insulin

Signal transduction of insulin Signal transduction of insulin Diabetes mellitus is a severe chronic disease, affecting 6-11 percent of the populations aged 30-64 and about 20 percent of those older than age 65 throughout the world.

More information

Skeletal muscle lipid deposition and insulin resistance: effect of dietary fatty acids and exercise 1 3

Skeletal muscle lipid deposition and insulin resistance: effect of dietary fatty acids and exercise 1 3 Skeletal muscle lipid deposition and insulin resistance: effect of dietary fatty acids and exercise 1 3 Michael P Corcoran, Stefania Lamon-Fava, and Roger A Fielding ABSTRACT Mounting evidence indicates

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

Yiying Zhang, PhD Research Scientist. Research Summary:

Yiying Zhang, PhD Research Scientist. Research Summary: Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,

More information

Insulin Resistance. Biol 405 Molecular Medicine

Insulin Resistance. Biol 405 Molecular Medicine Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent

More information

Intracellular signalling pathways activated by leptin by Gema FRUHBECK. Presentation by Amnesiacs Anonymous

Intracellular signalling pathways activated by leptin by Gema FRUHBECK. Presentation by Amnesiacs Anonymous Intracellular signalling pathways activated by leptin by Gema FRUHBECK Presentation by Amnesiacs Anonymous Introduction to Leptin By Ahrial Young Why is Leptin important? Pleiotropic = it controls the

More information

Type 2 Diabetes in Adolescents

Type 2 Diabetes in Adolescents Type 2 Diabetes in Adolescents Disclosures Paid consultant, Eli Lilly, Inc, Pediatric Type 2 Diabetes Clinical Trials Outline The burden of diabetes Treatment and Prevention Youth Diabetes Prevention Clinic

More information