Supplementary Figure 1

Size: px
Start display at page:

Download "Supplementary Figure 1"

Transcription

1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular Proinflammatory ytokines, Growth factors MEK Intracellular MEK Supplementary Figure 1: Effect of obesity and insulin resistance on ERK phosphorylation. Western blotting of phosphorylated and relative to total and in () epididymal white adipose tissue (ewt), inguinal white adipose tissue (iwt), brown adipose tissues (T), and liver. () perk/erk levels in hypothalamus, kidney, muscle (quadriceps), spleen, and heart from age-matched 16 week old chow fed and HFD fed (8 weeks on HFD) mice. Mice were fasted for 4 hours prior to sacrifice. () Schematic depicting elevated ERK signaling attributed to obesityinduced pro-inflammatory cytokines in adipose tissue.

2 Relative Peptide Phosphorylation Relative Peptide Phosphorylation Relative Peptide Phosphorylation Supplementary Figure Hours of MEK inhibition Hours of MEK inhibition Hours of MEK inhibition Supplementary Figure 2: MEK inhibition in vivo decreases phosphorylation of ERK and PK substrates. (- ) Temporal clustering of quantitative mass spectrometry on WT phosphopeptides from diet induced obese mice following MEKi treatment for 0, 0.5, 1, 6, or 12 hours as in Figs 2-. Each line represents a unique peptide, and line color represents putative ERK phosphorylation motif (orange) or PK (black) phosphorylation motif.

3 pkt/kt Glucose (mg/dl) % Initial glucose Relative mrn Level Relative mrn Level Supplementary Figure 3 Heart Kidney Liver Lung KO KO KO KO ctin 1.5 dipocyte fraction KO In vitro differentiated adipocytes 1.5 KO 0.5 * 0.5 D ap2 /EPα PPRγ Glucose tolerance test KO n.d. E 120% 100% ap2 /EPα PPRγ Insulin tolerance test KO n.d % % % % Minutes 0% Minutes F G 5 4 * * * Liver ewt iwt ontrol ontrol KO Insulin Insulin KO Supplementary Figure 3: haracterization of KO mice. () Protein levels of and levels in heart, kidney, liver and lung from wild type () and KO (KO) mice. (-) Expression of and adipocyte marker genes (ap2, /EPα, PPRγ) from and KO (KO) mice in () primary floated adipocytes () in vitro differentiated adipocytes derived from SVF (n=3 per genotype). (D) lood glucose levels following IP-GTT on 13 to 15 weeks HFD-fed and KO (KO) mice (n=9 per genotype). (E) lood glucose levels following ITT (represented as % initial blood glucose levels) from 13 to 15 weeks HFD-fed and KO (KO) mice (n=9 per genotype). (F) Insulin Signaling in vivo. Western blotting for phospho-kt and total KT after 4-hr fast (ontrol) or 4-hr fast ending with a bolus of insulin (Insulin). Tissues examined were liver, ewt and iwt. n.d., not detected, Error bars represent SEM. *, p < 5, Student s t-test.

4 Supplementary Figure 4 HFD KO HFD D E F how KO how G H Supplementary Figure 4: Energy alance in KO mice on standard or HFD. (-D) Mice on HFD for 20 weeks were monitored for three days following acclimation. () Time plot of Energy Expenditure. () Overall 24-hr, dark and light photoperiod means are reported. () Time plot of food intake and (D) food intake overall and photoperiod means. n=9 male mice per genotype. (E-H) Mice on a standard chow diet for 16 weeks were monitored for two days following acclimation. (E-F) Energy Expenditure and (G-H) Food intake as above. n=8 male mice per genotype. ll experiments were conducted at 30. Error bars represent SEM. Statistical analysis with alr was used to perform NOV using lean body mass as a covariate.

5 Relative mrn Level Supplementary Figure ontrol 1nM 1 nmeki MEKi 10nM nm MEKi 100nM MEKi 1.2 ap2 /EPα PPRγ Supplementary Figure 5: MEKi treatment had no effect on adipocyte differentiation markers. Expression of adipocyte marker genes (ap2, /EPα, PPRγ) in fully differentiated 3T3-L1 adipocytes after overnight treatment with the indicated doses of MEKi.

6 Relative mrn Level Supplementary Figure 6 drb3ko T3-L1 drb3ko+β3r- drb3ko+gfp drb3ko+β3r-s L1 GFP drb3ko β3r β3r S β3r N.S. ctin ap2 /EPα PPRγ Supplementary Figure 6: onfirmation of β3r deletion and overexpression in 3T3-L1 adipocytes. () Sequencing results of genomic DN from wild type 3T3-L1 () and β3r knockout 3T3-L1 (drb3ko) confirmed a deletion of 112 base pairs (the fragment between the red box and the purple box) in β3r knockout 3T3-L1 cell line, which contains part of exon 1 and intron 1 of the drb3 gene. () Expression of adipocyte marker genes (ap2, /EPα, PPRγ) in wild type 3T3-L1 adipocytes (3T3-L1) and β3r null cells with overexpression of green fluorescent protein (drb3ko+gfp), wild type β3r (drb3ko+β3r-) or β3r with Ser247-la mutation (drb3ko+β3r-s). () Endogenous and exogenous expression of β3r in wild type 3T3-L1 adipocytes (L1) and drb3ko null cells with overexpression of green fluorescent protein (GFP), wild type β3r (β3r-), or β3r with Ser247-la mutation (β3r-s).

7 Supplementary Figure 7 atecholamines DR3 ERK substrate S247 GRK2 TP PDE4 cmp Free fatty acids Glycerol Pro-inflammatory cytokines Insulin, growth factors Supplementary Figure 7: Putative ERK substrates which may impact lipolysis. Schematic of proteins which may impact lipolysis due to ERK phosphorylation. ERK is activated by multiple signaling pathways in obese adipose tissue. The proteins listed have decreased phosphorylation levels following MEK inhibition at a possible ERK phosphorylation motif. Proteins are also known to affect cmp levels or adrenergic signaling. Potential ERK target proteins include the DY6, DR3, GRK2/DRK1, and PDE4/PDE4D. DY6 and PDE4 control levels of cmp necessary for PK activation. GRK2 may phosphorylate adrenergic receptors.

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly, 1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,

More information

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse

More information

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

perk/erk STAT5B

perk/erk STAT5B pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Effect of BI-1 on insulin resistance through regulation of CYP2E1 Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

Supplementary Information

Supplementary Information Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu

More information

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU) Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Expanded View Figures

Expanded View Figures Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Nature Immunology: doi: /ni.3631

Nature Immunology: doi: /ni.3631 Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above

More information

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Fawaz G. Haj Associate Professor Diagnosed Obesity and Diabetes for Adults aged 20 years in United States

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation ORIGINAL ARTICLE STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation Anca D. Dobrian, 1 Elena V. Galkina, 2 Qian Ma, 1 Margaret Hatcher, 1 Sabai Myo Aye, 1 Mathew

More information

Imtiyaz et al., Fig. S1

Imtiyaz et al., Fig. S1 . Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control

Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Jan Trost Prof. Gudrun A. Brockmann Humboldt Universität zu Berlin Department of Crop and Animal Sciences Breeding Biology and Molecular

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)

More information

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent

More information

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol ell Metabolism, Volume 7 Supplemental Information The Hormone Stimulates Water Drinking in Response to Ketogenic Diet and lcohol Parkyong Song, hristoph Zechner, Genaro Hernandez, José ánovas, Yang Xie,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 + F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.

Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15. Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage

More information

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first? 7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland

More information

Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary

Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary Published in "" which should be cited to refer to this work. Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas http://doc.rero.ch Laboratory of Metabolic Stress Biology, Division

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International

More information

scientific report A functional role for the p62 ERK1 axis in the control of energy homeostasis and adipogenesis scientificreport

scientific report A functional role for the p62 ERK1 axis in the control of energy homeostasis and adipogenesis scientificreport scientificreport functional role for the p6 ERK axis in the control of energy homeostasis and adipogenesis Sang Jun Lee,PaulT.Pfluger, Ji Young Kim, Ruben Nogueiras,ngelesDuran,GillesPagès, Jacques Pouysségur,MatthiasH.Tschöp,

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table. Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body

More information

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p

More information

a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *

a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * * Supplemental Figure 1 Metabolic flux with [U- C]Lactate - [ 12 C]Glutamine in primary hepatocytes a b c d e [ C 3 ]Pyruvate [ C 3 ]Malate [ C 3 ]Aspartate [ C 3 ]Citrate [ C 2 ] -Ketoglutarate f g h [

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information