THE PHENOTYPE OF the ob/ob mouse is characterized by

Size: px
Start display at page:

Download "THE PHENOTYPE OF the ob/ob mouse is characterized by"

Transcription

1 /01/$03.00/0 Endocrinology 142(8): Printed in U.S.A. Copyright 2001 by The Endocrine Society Leptin-Deficient Mice Backcrossed to the BALB/cJ Genetic Background Have Reduced Adiposity, Enhanced Fertility, Normal Body Temperature, and Severe Diabetes J. QIU, S. OGUS, K. MOUNZIH, A. EWART-TOLAND, AND F. F. CHEHAB Department of Laboratory Medicine, University of California, San Francisco, California A deficiency of leptin synthesis in mice results in a complex phenotype characterized by morbid obesity, diabetes, sterility, and defective thermogenesis. To determine whether the genetic background could alter the pleiotropic effects of leptin deficiency, we backcrossed the ob mutation for 10 generations from the C57BL/6J to the BALB/cJ genetic background. Compared with C57BL/6J ob/ob mice, BALB/cJ ob/ob mice showed at 27 wk of age a 35 40% reduction in body weight attributed to a 60% decrease in white adipose tissue mass. Food intake was not significantly different between the two obese strains, suggesting distinct utilization of energy intake. In the fed state, BALB/cJ ob/ob mice had elevated insulin and THE PHENOTYPE OF the ob/ob mouse is characterized by a morbid obesity, hyperphagia, transient hyperglycemia with late-onset diabetes, and life-long sterility (1). Despite intense investigations over half a decade aimed at uncovering its underlying physiological defect, it was only when positional cloning strategies came of age that a nonsense mutation (R105X) in a new gene was unveiled. The protein encoded by this gene was found to be a secreted protein named leptin (2). Administration of the recombinant hormone leptin to ob/ob mice rescues their metabolic and reproductive abnormalities (3 7) establishing an important role for this hormone in body weight homeostasis and reproductive biology. The search for leptin gene mutations among obese individuals led to the uncovering of rare homozygous cases that exhibited phenotypes similar to that of ob/ob mice (8) and responded well to recombinant leptin therapy, as evidenced by a decrease in food intake, reduction in body weight, and onset of normal reproductive function (9). Most of the experiments carried out on ob/ob mice were largely on mutant mice maintained on an inbred C57BL/6J genetic background. Hybrid vigor and genetic heterogeneity have long been known to confer a selective advantage to an organism, due mainly to the overall effects of modifier genes. Although the ob mutation has been mostly studied on the C57BL/6J background, a congenic line of ob/ob mice on the C57BL/Ks background was also generated. C57BL/Ks ob/ob mice exhibit initially an obese phenotype, but then start to lose weight progressively before dying prematurely of severe diabetes resulting from exhaustion and death of the islets of Langerhans (10). We recently described the phenotypes of F 2 ob/ob mice bred on a mixed C57BL/6J/BALB/cJ triglycerides levels, demonstrating a worsening effect on diabetes. At the reproductive level and in contrast to sterile C57BL/6J ob/ob mice, male and female BALB/cJ ob/ob mice were capable of reproducing after a mating period of 16 and 32 wk, respectively. At thermoneutrality, the body temperature of BALB/cJ ob/ob mice was 2.9 C higher than that of C57BL/6J ob/ob mice, whereas exposure of both groups to 4 C demonstrated a prolonged cold tolerance of BALB/cJ ob/ob mice. These studies show that the abnormalities caused by leptin deficiency can be genetically dissected and separated from each other, suggesting discrete pathways controlled by leptin modifier genes. (Endocrinology 142: , 2001) genetic background (11) and demonstrated that modifier genes on the BALB/c genome ameliorate the reproductive defect of ob/ob males and significantly contribute to an alleviation of their obese phenotype. In this communication we describe the characteristics of a new congenic line of ob/ob mice backcrossed for 10 generations on the BALB/cJ genetic background. BALB/cJ mice were previously found to be resistant to streptozotocin-induced diabetes (12) and have not been reported to exhibit a susceptibility to obesity. We found in this study that interaction of the BALB/cJ genome with homozygosity for the ob mutation results in a drastic decrease in fat accumulation, increased insulin resistance without a life-threatening condition, normal thermogenesis, and improved fecundity of the obese mice. Materials and Methods Derivation of the congenic line Inbred mice on the BALB/cJ background and ob/ob mice on the C57BL/6J background were purchased from The Jackson Laboratory (Bar Harbor, ME) and maintained at the University of California-San Francisco mouse facility under a standard regimen of alternating 12-h light and dark periods. All procedures were approved by the University of California-San Francisco committee on animal research. All mice were fed ad libitum a basic chow diet (FormuLab 5008, Ralston Purina Co., St. Louis, MO) with unrestricted access to water. Obligate heterozygous ob mice were generated by treating C57BL/6J ob/ob males with recombinant leptin as previously described (7), followed by mating with normal BALB/cJ females. F 1 ob/ males were then backcrossed to pure / BALB/cJ females to yield a 1:1 ratio of homozygous normal / and ob/ heterozygous mice in the F 2 generation. Heterozygous ob / mice were identified by PCR genotyping of the R105X mutation using a PCR assay (6). The process of backcrossing the ob / males to inbred BALB/cJ females was repeated for 10 generations to yield a congenic line of ob/ob mice on the BALB/cJ genetic background. During this process, 3421

2 3422 Endocrinology, August 2001, 142(8): Qiu et al. Genetic Separations of Abnormalities Caused by Leptin Deficiency 1 round of backcrossing involving a female ob / with a / BALB/cJ male was carried out to ensure transfer of the BALB/cJ Y chromosome to the new congenic line. Body weights, food intake, and adiposity Body weights of ob/ob males and females on the BALB/cJ and C57BL/6J backgrounds were determined regularly until 27 wk of age. Food intake was monitored daily for 18 d in C57BL/6J ob/ob (n 5) and BALB/cJ ob/ob (n 5) females housed in individual cages. Obese mice from each sex and group were killed at wk of age, and the liver, white and brown adipose depots, and remaining carcasses devoid of any organs were weighed on an analytical balance. Metabolic assays Blood was collected by retroorbital sinus bleeding from five ob/ob males from each genetic background at wk of age. Plasma glucose, cholesterol, triglycerides, and insulin levels in 24-h fasted and ad libitumfed mice were determined, respectively, on a Hitachi 747 Clinical Chemistry Analyzer (Hialeah, FL) and by a rat insulin RIA (Linco Research, Inc., St. Charles, MO). Cold challenge C57BL/6J ob/ob (n 3) and BALB/cJ ob/ob (n 7) females were housed individually and placed at 4 C. Rectal temperature recordings were determined before and hourly after exposure to cold with a precision thermometer (YSI, Inc., Yellow Springs, OH) equipped with a 0.2-mm probe (YSI, Inc., model 451). Fertility of BALB/cJ ob/ob mice To investigate the fertility of this new ob/ob line, 6- to 12-wk-old BALB/cJ ob/ob males (n 10) and BALB/cJ ob/ob females (n 4) were housed with proven wild-type breeding littermates over a period of 16 wk for the obese males and 32 wk for the obese females. As we regularly monitored the body weights of the obese mice and their mates, it was possible to retroactively determine their body weights at mating, considering a gestation period of 19 d. Statistics All values are reported as the mean sem. Significance levels were determined by unpaired t test for independent groups using the Statistica 4.1 software package (Statsoft, Tulsa, OK) for the Macintosh computer. Results Body weights, adiposity, and food intake The foremost striking difference between BALB/cJ ob/ob and C57BL/6J ob/ob mice was a reduction in body weight in the former group. At 5 wk of age, the body weights of C57BL/6J and BALB/cJ ob/ob mice were, respectively, vs g for males (n 11 each group; P ) and vs g for females (n 10 each group; P 0.009). Differences in body weight between the two obese strains were highly significant throughout the monitoring period (Fig. 1), such that at 27 wk of age, the body weights of male and female BALB/cJ ob/ob mice were 27 and 31.5 g less than those of their C57BL/6J ob/ob counterparts. Figure 2 shows a photograph of two age-matched ob/ob females on the BALB/cJ and C57BL/6J backgrounds, depicting the impressive reduction of body weight in BALB/cJ ob/ob mice. To determine whether this reduction in body weight was due to a decrease in adiposity, we weighed the white and brown adipose tissue masses, liver, and carcasses of ob/ob mice from both strains at wk of age (Fig. 3). Compared with their C57BL/6J ob/ob counterparts, BALB/cJ ob/ob mice had their white and brown adipose tissue masses reduced, respectively, by 2.5-fold (P ) and 1.5-fold (P 0.05) in males and by 2.2-fold (P ) and 1.3-fold (P 0.06) in females. Furthermore, the liver was 1.6-fold (P 0.004) and 1.2-fold (P 0.05) smaller in male and female BALB/cJ ob/ob mice, respectively, vs. that in age- and sexmatched C57BL/6J ob/ob mice. Weights of the carcasses, which included muscle, bone, and brain, remained significant in both males (P 0.002) and females (P ), suggesting additional effects of the BALB/cJ genetic background. Food consumption by ob/ob mice on both genetic backgrounds was measured during an 8-d period to determine whether the decrease in food intake contributed to the noted differences in adiposity. We found that the cumulative food consumption of ob/ob mice from both strains was nearly identical and was not statistically significant (Fig. 4), demonstrating that food intake is not a contributing factor to the alleviation of the obese phenotype in BALB/cJ ob/ob mice. Thermogenesis At the initiation of this experiment, the body weights of the C57BL/6J ob/ob and BALB/cJ ob/ob females were and g, respectively (P 0.001). The ambient body temperatures of the C57BL/6J ob/ob and BALB/cJ ob/ob females were determined with a rectal probe and were and C, respectively (P 10 6 ). At 4 C, the temperature of C57BL/6J ob/ob and BALB/cJ ob/ob mice fell, respectively, to and C(P 0.01) after 1 h and to and C(P 0.001) after 2 h FIG. 1. Body weights of ob/ob males and females on the C57BL/6J or BALB/cJ genetic background from 4 27 wk of age.

3 Qiu et al. Genetic Separations of Abnormalities Caused by Leptin Deficiency Endocrinology, August 2001, 142(8): FIG. 2. Typical photograph of two ob/ob females on the C57BL/6J or BALB/cJ genetic background depicting the reduced adiposity on the BALB/cJ background. FIG. 3. Adiposity and liver and carcass weights of BALB/cJ ob/ob ( ) and C57BL/6J ob/ob (f) males (M) and females (F) at wk of age. *, P 0.05; **, P 0.002; ***, P Serum chemistries Plasma levels of glucose, insulin, triglycerides, and cholesterol were determined in the fasted and fed states in ob/ob males from both strains at wk of age (Fig. 6). In the fasted state there was no significant difference in any measurement between groups except for glucose (P 0.04). However, in the fed state, triglycerides and insulin levels were, respectively, 3-fold (P ) and 2.5-fold (P 10 7 ) more elevated in obese BALB/cJ than in obese C57BL/6J mice. Glucose and cholesterol levels were not significantly different between the two groups. FIG. 4. Cumulative and daily food consumption of ob/ob males on the C57BL/6J (n 5; f) and BALB/cJ (n 5; ) genetic backgrounds. (Fig. 5) In compliance with an animal care regulation that prohibits animal death as the end point of an experiment, the C57BL/6J ob/ob mice had to be removed from the cold room after 1 h when their body temperature reached critically low levels, whereas the BALB/cJ ob/ob mice withstood the cold for up to 3 4 h but eventually succumbed to it. Fertility Six of 10 ob/ob males and all 4 females on the BALB/cJ genetic background were fertile, as determined by the 1 3 pregnancies induced by the obese fathers and the 1 2 pregnancies of the obese mothers (Table 1). The body weight range around the time of mating was g for ob/ob males and g for ob/ob females. There were no correlations between the number of pregnancies and the initial or at mating body weights of BALB/cJ ob/ob mice. Discussion The genetic makeup of an organism often accounts for the variation in penetrance associated with the phenotype of a particular mutation. To determine this effect in the context of an obese phenotype, we previously generated an F 2 inter-

4 3424 Endocrinology, August 2001, 142(8): Qiu et al. Genetic Separations of Abnormalities Caused by Leptin Deficiency FIG. 5. Body weights and core temperature of ob/ob females on the C57BL/6J and BALB/cJ genetic backgrounds duringa4ccold challenge. *, P 0.01; ***, P TABLE 1. Fertility of ob/ob males (n 10) and ob/ob females (n 4) on the BALB/cJ genetic background BW (g) Age (wk) Pregnancies Age at mating(s) (wk) BW at mating (g) Males , 22, , 48.7, , , , , , , 45.2 Females , , , , The body weight (BW) and age of each mouse at the beginning of the mating period and near each mating time are shown. FIG. 6. Glucose, insulin, triglycerides, and cholesterol levels of C57BL/6J (f) and BALB/cJ ( ) ob/ob males at wk of age. *, P 0.04; ***, P cross segregating the ob mutation on the mixed C57BL/6J and BALB/cJ genetic backgrounds (11). The resulting F 2 ob/ob mice showed variability in the expression of obesity, diabetes, and fertility, which was attributed to modifier genes from both genetic backgrounds. In this study we followed up on these experiments by backcrossing the ob mutation for 10 generations on the BALB/cJ genetic background. Intercrossing of the N10 ob heterozygotes resulted in a new congenic line of ob/ob mice on the BALB/cJ genetic background. Except for a differential C57BL/6J chromosomal segment of approximately 20 cm, which is retained from selection of the ob mutation at each round of backcrossing (13), the contribution of modifier genes from the BALB/cJ genetic background onto the ob/ob phenotype can now be assessed independently of the C57BL/6J genome. One of the major findings in BALB/cJ ob/ob mice was their decreased adiposity, which could not be attributed to decreased hyperphagia, because food intake was similar in both strains. Most likely, mechanisms that increase energy expenditure will be the first candidates to investigate the basis of their reduced adiposity. As C57BL/6J ob/ob mice have de-

5 Qiu et al. Genetic Separations of Abnormalities Caused by Leptin Deficiency Endocrinology, August 2001, 142(8): fective thermogenesis and low body temperature (14), the finding that BALB/cJ ob/ob mice have normal ambient body temperature and are more tolerant to the cold challenge than C57BL/6J ob/ob mice suggests that cold-stimulated sympathetic outflow to brown fat in the absence of leptin can be corrected with the appropriate modifier genes. This observation further suggests that increased sympathetic activity of BALB/cJ ob/ob mice may be a contributing factor to their reduced obese phenotype. Although not yet determined, the general activity of BALB/cJ ob/ob mice appears to be increased compared with the well known passive nature of C57BL/6J ob/ob mice. The elevated serum insulin levels of fed BALB/cJ ob/ob mice demonstrate an insulin resistance state that is more severe than that of ob/ob mice on the C57BL/6J background and is quite distinct from that of the ob/ob strain bred on the C57BL/Ks background, which succumbs to the diabetic state as a result of pancreatic islet exhaustion (10). Thus, when coupled to an obese phenotype, the BALB/cJ background expresses modifier genes that are deleterious to glucose homeostasis. The elevated triglycerides levels of fed BALB/cJ ob/ob, but not C57BL/6J ob/ob, mice may be explained by decreased activity of endothelium-bound lipoprotein lipase, which normally is stimulated by insulin (15, 16). However, an insulin resistance environment such as that in obese mice, may explain at least in part the reduced synthesis and release of lipoprotein lipase leading to impaired triglycerides breakdown and accumulation in the circulation. Genetically, these hypotheses would imply that the modifier genes brought into the ob/ob phenotype by the BALB/cJ background greatly influence these pathways and that the uncovering of such factors, for example, by analysis of differentially expressed genes or microarray hybridization panels, will undoubtedly lead to the manipulation and understanding of these pathways. The sterility of ob/ob mice can be rescued with leptin treatment (6, 7) or through modifier genes brought into the ob phenotype by the mixed C57BL6J/BALB/cJ genetic background (11). In the present study the BALB/cJ ob/ob males exhibited a similar fertility as the F 2 C57BL6J/BALB/cJ ob/ob males. However, previously (11) we had found that the mixed C57BL/6J-BALB/cJ genetic background rescued the reproductive defect of only ob/ob males. In this study only 60% of BALB/cJ ob/ob males were fertile, suggesting that the mixed genetic background is more beneficial to male reproduction than the BALB/cJ inbred background alone. These differences may be attributed to the interaction of both genomes on reproductive function. Furthermore, the fertility of BALB/cJ ob/ob females, but not of C57BL/6J-BALB/cJ ob/ob females, demonstrates a stimulatory effect of BALB/cJ modifier genes on the female reproductive system of ob/ob mice. On the other hand, the idea that the obese state imposes a physical hindrance that might interfere with fecundity is not founded by our studies. For example, the body weights at mating of the BALB/cJ ob/ob mice ranged from g. At these body weights, the C57BL/6J ob/ob mice remain sterile and fail to reproduce. Thus, adiposity is not a major physical factor for the failure of ob/ob mice to reproduce. Instead, BALB/cJ modifier genes, which remain to be unveiled, control the firing of the reproductive system and must play a critical role in reproductive pathways associated with obesity. Overall, the novel BALB/cJ ob/ob phenotype demonstrates the existence of modifier genes that can rescue a defective leptin pathway without leptin. The elucidation of the factors encoded by these modifier genes will not be an easy task and will require complex genetic and genomic approaches in central and peripheral tissues, but it will ultimately reveal whether these genes are part of the leptin pathway or of other dominant pathways. In either case, they will lead to an increased understanding of the mechanisms that govern body weight homeostasis, energy expenditure, and the reproductive system. Acknowledgments Received February 27, Accepted April 11, Address all correspondence and requests for reprints to: Dr. Farid F. Chehab, 505 Parnassus Avenue, Department of Laboratory Medicine, University of California, San Francisco, California chehabf@labmed2.ucsf.edu. This work was supported by NIH Grant HD References 1. Ingalls AM, Dickie MM, Snell GD 1950 Obese, a new mutation in the house mouse. J Hered 41: Zhang Y, Proenca R, Maffei. M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372: Pelleymounter MA, Cullen MJ, Baker MB, et al Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269: Halaas JL, Gajiwala KS, Maffei M, et al Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269: Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P 1995 Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269: Chehab FF, Lim ME, Lu R 1996 Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat Genet 12: Mounzih KM, Lu R, Chehab FF 1997 Leptin treatment rescues the sterility of genetically obese ob/ob males. Endocrinology 138: Montague CT, Farooqi IS, Whitehead JP, et al Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387: Farooqi IS, Jebb SA, Langmack G, et al Effects of recombinant leptin therapy in a child with congenital leptin deficiency. N Engl J Med 341: Coleman DL, Hummel KP 1973 The influence of the genetic background on the expression of the obese gene (ob) in the mouse. Diabetologia 9: Ewart-Toland A, Mounzih K, Qiu J, Chehab FF 1999 Effect of the genetic background on the reproduction of leptin-deficient obese mice. Endocrinology 140: Leiter EH, Le PH, Prochazka M, Worthen SM, Huppi K 1988 Genetic and environmental control of diabetes induction by multi-dose streptozotocin in two BALB/c substrains. Diabetes Res 9: Silver, L 1995 Mouse genetics. Oxford: Oxford University Press; Trayhurn P, James WP 1978 Thermoregulation and non-shivering thermogenesis in the genetically obese (ob/ob) mouse. Pflugers Arch 73: Kern PA, Marshall S, Eckel RH 1985 Regulation of lipoprotein lipase in primary cultures of isolated human adipocytes. J Clin Invest 75: Fried SK, Russell CD, Grauso NL, Brolin RE 1993 Lipoprotein lipase regulation by insulin and glucocorticoid in subcutaneous and omental adipose tissues of obese women and men. J Clin Invest 92:

Effect of Immune Challenge on Different Genotypes: How Sick Do They Get?

Effect of Immune Challenge on Different Genotypes: How Sick Do They Get? Introduction Effect of Immune Challenge on Different Genotypes: How Sick Do They Get? M.T. Leininger, C.P. Portocarrero, C.A. Bidwell, M.E. Spurlock, J.N. Nielsen, and K.L. Houseknecht Department of Animal

More information

Leptin and Reproduction Farid F. Chehab, Ph.D., Jun Qiu, Ph.D., Khalid Mounzih, Ph.D., Amanda Ewart-Toland, Ph.D., and Scott Ogus, B.S.

Leptin and Reproduction Farid F. Chehab, Ph.D., Jun Qiu, Ph.D., Khalid Mounzih, Ph.D., Amanda Ewart-Toland, Ph.D., and Scott Ogus, B.S. October 2002: (II)S39 S46 Leptin and Reproduction Farid F. Chehab, Ph.D., Jun Qiu, Ph.D., Khalid Mounzih, Ph.D., Amanda Ewart-Toland, Ph.D., and Scott Ogus, B.S. Leptin, a hormone secreted from adipose

More information

Yiying Zhang, PhD Research Scientist. Research Summary:

Yiying Zhang, PhD Research Scientist. Research Summary: Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,

More information

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER

More information

Leptin and energy expenditure Chris J. Hukshorn and Wim H.M. Saris

Leptin and energy expenditure Chris J. Hukshorn and Wim H.M. Saris Leptin and energy expenditure Chris J Hukshorn and Wim HM Saris Purpose of review A fundamental advance in our understanding of endocrine control of energy balance and body weight came with the discovery

More information

Figure 1: The leptin/melanocortin pathway Neuronal populations propagate the signaling of various molecules (leptin, insulin, ghrelin) to control

Figure 1: The leptin/melanocortin pathway Neuronal populations propagate the signaling of various molecules (leptin, insulin, ghrelin) to control Leptin Deficiency Introduction The leptin/melanocortin pathway plays a key role in the hypothalamic control of food intake. It is activated following the systemic release of the adipokine leptin (LEP)

More information

Leptin effect in ob/ob mice under thermoneutral conditions depends not necessarily on central satiation

Leptin effect in ob/ob mice under thermoneutral conditions depends not necessarily on central satiation Am. J. Physiol. Regulatory Integrative Comp. Physiol. 278: R790 R795, 2000 rapid communication Leptin effect in ob/ob mice under thermoneutral conditions depends not necessarily on central satiation JOHANNES

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Positioning and Re-purposing of Drugs: Case Studies from BMS s Experience

Positioning and Re-purposing of Drugs: Case Studies from BMS s Experience Positioning and Re-purposing of Drugs: Case Studies from BMS s Experience Simeon Taylor, MD, PhD Vice President, Research & Scientific Affairs Bristol-Myers Squibb June 24, 2013 1 Translating scientific

More information

Original Research Article

Original Research Article IUBMB Life, 48: 109±113, 1999 Copyright c 1999 IUBMB 1521-6543/99 $12.00 +.00 Original Research Article Effects of Genetic and Diet-Induced Obesity on Lipid Metabolism Roksan Libinaki, Mark Heffernan,

More information

Homeostasis and Mechanisms of Weight Regulation

Homeostasis and Mechanisms of Weight Regulation Homeostasis and Mechanisms of Weight Regulation Purpose In this activity students will investigate how negative feedback mechanisms function to maintain homeostatic balance using a recently discovered

More information

Connection with broader issues of physiology

Connection with broader issues of physiology Joanne Kelleher jkk@mit.edu Connection with broader issues of physiology Bioinformatics: The process and methods applied to the upgrade of the information content of biological measurements This includes

More information

Metabolic responses to leptin in obese db/db mice are strain dependent

Metabolic responses to leptin in obese db/db mice are strain dependent Am J Physiol Regulatory Integrative Comp Physiol 281: R115 R132, 2001. Metabolic responses to leptin in obese db/db mice are strain dependent RUTH B. S. HARRIS, TIFFANY D. MITCHELL, XIAOLANG YAN, JACOB

More information

LEPTIN, A HORMONE secreted from adipose tissue (1),

LEPTIN, A HORMONE secreted from adipose tissue (1), 0013-7227/01/$03.00/0 Vol. 142, No. 1 Endocrinology Printed in U.S.A. Copyright 2001 by The Endocrine Society Transgenic Mice Overexpressing Leptin Accumulate Adipose Mass at an Older, But Not Younger,

More information

Abnormal regulation of the leptin gene in the pathogenesis of obesity

Abnormal regulation of the leptin gene in the pathogenesis of obesity Proc. Natl. Acad. Sci. USA Vol. 95, pp. 11852 11857, September 1998 Medical Sciences Abnormal regulation of the leptin gene in the pathogenesis of obesity ELLA IOFFE*, BYOUNG MOON, EILEEN CONNOLLY, AND

More information

Obesity in aging: Hormonal contribution

Obesity in aging: Hormonal contribution Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes

More information

Leptin levels and menstrual function in HIV-infected women in rural India

Leptin levels and menstrual function in HIV-infected women in rural India Leptin levels and menstrual function in HIV-infected women in rural India Annie Phoebe. K¹, Mini Jacob.S¹, Hemalatha.R², Sivakumar M.R¹ ¹Department of Experimental Medicine, The Tamil Nadu Dr. MGR Medical

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Decreased food intake does not completely account for adiposity

Decreased food intake does not completely account for adiposity Proc. Natl. Acad. Sci. USA Vol. 93, pp. 1726-173, February 1996 Physiology Decreased food intake does not completely account for adiposity reduction after ob protein infusion NANCY LEVIN*t, CHRIS NELSONt,

More information

Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr.

Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr. Metabolic responses to leptin in obesedb/db mice are strain dependent Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr. Am J Physiol Regul Integr Comp Physiol

More information

Experiment 1. The aim here is to understand the pattern of

Experiment 1. The aim here is to understand the pattern of H A Ranganath and M T Tanuja Drosophila Stock Centre Department of Studies in Zoology University of Mysore Manasagangotri Mysore 570006, India. E-mail:drosrang@bgl.vsnl.net.in hranganath@hotmail.com Part

More information

The Influence of Genetic Background on the Expression of the Obese (Oh) Gene in the Mouse*

The Influence of Genetic Background on the Expression of the Obese (Oh) Gene in the Mouse* Diabetologia 9, 287--293 (1973) 9 by Springer-Verlag 1973 The Influence of Genetic Background on the Expression of the Obese (Oh) Gene in the Mouse* D.L. Coleman and K.P. Hummel The Jackson Ls.boratory**

More information

outbred colonies are stocks inbred colonies are strains 3/22/2012 Mouse strains 2.500

outbred colonies are stocks inbred colonies are strains 3/22/2012 Mouse strains 2.500 Nomenclature for rodents Stock vs strain outbred colonies are stocks Kai Õkva inbred colonies are strains Outbred nomenclature First three letters reveal place where stock is maintained (Kuo) Followed

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

Insights from Rare Obesity Disorders

Insights from Rare Obesity Disorders Insights from Rare Obesity Disorders Ashley Shoemaker, MD, MSCI Ian M. Burr Division of Pediatric Endocrinology and Diabetes Disclosures Research funding: Zafgen, AstraZeneca, Rhythm Member, Zafgen Hypothalamic

More information

1. PATHOPHYSIOLOGY OF DIABETES MELLITUS

1. PATHOPHYSIOLOGY OF DIABETES MELLITUS 1. PATHOPHYSIOLOGY OF DIABETES MELLITUS Prof. Vladimir Palicka, M.D., Ph.D. Institute for Clinical Biochemistry and Diagnostics, University Hospital Hradec Kralove, Czech Republic Diabetes mellitus is

More information

Physiological and Behavioral Effects of High Fat Diet Removal and Wheel Running in C57BL/6J Mice

Physiological and Behavioral Effects of High Fat Diet Removal and Wheel Running in C57BL/6J Mice Bridgewater State University Virtual Commons - Bridgewater State University Honors Program Theses and Projects Undergraduate Honors Program 5-10-2016 Physiological and Behavioral Effects of High Fat Diet

More information

Leptin for type 1 diabetes: coming onto stage to be (or not?)

Leptin for type 1 diabetes: coming onto stage to be (or not?) Pediatric Diabetes 2012: 13: 68 73 doi: 10.1111/j.1399-5448.2011.00797.x All rights reserved 2011 John Wiley & Sons A/S Pediatric Diabetes Point/Counterpoint Debate Leptin for type 1 diabetes: coming onto

More information

C) Show the chromosomes, including the alleles on each, in the F1 hybrid progeny at metaphase of Meiosis 1 and mitosis.

C) Show the chromosomes, including the alleles on each, in the F1 hybrid progeny at metaphase of Meiosis 1 and mitosis. On my honor, this is my work GENETICS 310 EXAM I all, 2017 I. Australian daises have 4 chromosomes (2 pairs). A gene on chromosome 1 affects petal color where M M is magenta, M M is pink and MM flowers

More information

A new obesity-prone, glucose intolerant rat strain (F.DIO)

A new obesity-prone, glucose intolerant rat strain (F.DIO) A new obesity-prone, glucose intolerant rat strain (F.DIO) Barry E. Levin 1,2, Ambrose A. Dunn-Meynell 1,2, Julie E. McMinn 3, Michael Alperovich 3, Amy Cunningham-Bussel 3, Streamson C. Chua, Jr. 3 Neurology

More information

Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur

Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Module - 02 Lecture - 06 Let us test your understanding of Pedigree

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

YK052 Mouse Leptin ELISA

YK052 Mouse Leptin ELISA YK052 Mouse Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA-SHI SHIZUOKA, JAPAN 418-0011 Contents Ⅰ. Introduction 2 Ⅱ. Characteristics 3 Ⅲ. Composition 4 Ⅳ. Method

More information

THE GENETICS OF SOUND INDUCED SEIZURE IN INBRED MICE'

THE GENETICS OF SOUND INDUCED SEIZURE IN INBRED MICE' THE GENETICS OF SOUND INDUCED SEIZURE IN INBRED MICE' K. SCHLESINGER, R. C. ELSTON AND W. BOGGAN Departments of Psychology and Biostatistics, and the Genetics Curriculum, Uniuersity of North Carolina,

More information

Genetics PPT Part 1 Biology-Mrs. Flannery

Genetics PPT Part 1 Biology-Mrs. Flannery Genetics PPT Part Biology-Mrs. Flannery In an Abbey Garden Mendel studied garden peas because they were easy to grow, came in many readily distinguishable varieties, had easily visible traits are easily

More information

Regulation of serum leptin levels by gonadal function in rats

Regulation of serum leptin levels by gonadal function in rats European Journal of Endocrinology (1999) 140 468 473 ISSN 0804-4643 Regulation of serum leptin levels by gonadal function in rats L Pinilla 1, L M Seoane 2, L Gonzalez 1, E Carro 2, E Aguilar 1, F F Casanueva

More information

Chronic Stimulation of Leptin on Food Intake and Body Weight after Microinjection into the Ventromedial Hypothalamus of Conscious Rats

Chronic Stimulation of Leptin on Food Intake and Body Weight after Microinjection into the Ventromedial Hypothalamus of Conscious Rats TAJ December 2006; Volume 19 Number 2 ISSN 1019-8555 The Journal of Teachers Association RMC, Rajshahi Original Article Chronic Stimulation of Leptin on Food Intake and Body Weight after Micro into the

More information

Diabetologia. Obese and Diabetes: Two Mutant Genes Causing Diabetes-Obesity Syndromes in Mice* Review Articles. Diabetologia 14, (1978)

Diabetologia. Obese and Diabetes: Two Mutant Genes Causing Diabetes-Obesity Syndromes in Mice* Review Articles. Diabetologia 14, (1978) Diabetologia 14, 141-148 (1978) Diabetologia 9 by Springer-Verlag 1978 Review Articles Obese and Diabetes: Two Mutant Genes Causing Diabetes-Obesity Syndromes in Mice* D. L. Coleman The Jackson Laboratory,

More information

MBB317. Dr D MANGNALL OBESITY. Lecture 2

MBB317. Dr D MANGNALL OBESITY. Lecture 2 MBB317 Dr D MANGNALL OBESITY Lecture 2 When the structure of the insulin receptor was first discovered it was assumed that the active beta subunit tyrosine kinase would phosphorylate some intracellular

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Genetics & The Work of Mendel

Genetics & The Work of Mendel Genetics & The Work of Mendel 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method

More information

Pedigree Construction Notes

Pedigree Construction Notes Name Date Pedigree Construction Notes GO TO à Mendelian Inheritance (http://www.uic.edu/classes/bms/bms655/lesson3.html) When human geneticists first began to publish family studies, they used a variety

More information

Genetics & The Work of Mendel

Genetics & The Work of Mendel Genetics & The Work of Mendel 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method

More information

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption

More information

Copyright : 2002, Blackwell Science Ltd

Copyright : 2002, Blackwell Science Ltd Deakin Research Online Deakin University s institutional research repository DDeakin Research Online Research Online This is the author s final peer reviewed version of the item published as: Sanigorski,

More information

Rat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN

Rat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN YK050 Rat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418-0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes

More information

GENETICS - NOTES-

GENETICS - NOTES- GENETICS - NOTES- Warm Up Exercise Using your previous knowledge of genetics, determine what maternal genotype would most likely yield offspring with such characteristics. Use the genotype that you came

More information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

More information

BIO 202 : GENETICS AND EVOLUTION

BIO 202 : GENETICS AND EVOLUTION BIO 202 : GENETICS AND EVOLUTION INTRODUCTION Genetics is the study of hereditary and expression of such traits or heredity. Genetics is the branch of biology that deals with heredity and expression of

More information

Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men

Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men ISPUB.COM The Internet Journal of Gastroenterology Volume 7 Number 2 Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men M Pizon, P Tomasic, K Sztefko, Z Szafran

More information

6.6 HORMONES & REPRODUCTION

6.6 HORMONES & REPRODUCTION 6.6 HORMONES & REPRODUCTION Endocrine system Produces and releases hormones Hormones travel in the blood to target tissues Long distance communication between cells Endocrine Glands Blood stream Hormone

More information

Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are

More information

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.

More information

What we mean more precisely is that this gene controls the difference in seed form between the round and wrinkled strains that Mendel worked with

What we mean more precisely is that this gene controls the difference in seed form between the round and wrinkled strains that Mendel worked with 9/23/05 Mendel Revisited In typical genetical parlance the hereditary factor that determines the round/wrinkled seed difference as referred to as the gene for round or wrinkled seeds What we mean more

More information

Hormonal Regulations Of Glucose Metabolism & DM

Hormonal Regulations Of Glucose Metabolism & DM Hormonal Regulations Of Glucose Metabolism & DM What Hormones Regulate Metabolism? What Hormones Regulate Metabolism? Insulin Glucagon Thyroid hormones Cortisol Epinephrine Most regulation occurs in order

More information

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes

More information

Body Mass Index Chart = overweight; = obese; >40= extreme obesity

Body Mass Index Chart = overweight; = obese; >40= extreme obesity Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 25 February 2008 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" Weight (lbs)

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Brief Report EFFECTS OF RECOMBINANT LEPTIN THERAPY IN A CHILD WITH CONGENITAL LEPTIN DEFICIENCY

Brief Report EFFECTS OF RECOMBINANT LEPTIN THERAPY IN A CHILD WITH CONGENITAL LEPTIN DEFICIENCY BRIEF REPORT Brief Report EFFECTS OF RECOMBINANT LEPTIN THERAPY IN A CHILD WITH CONGENITAL LEPTIN DEFICIENCY I. SADAF FAROOQI, M.D., SUSAN A. JEBB, PH.D., GILL LANGMACK, B.SC., ELIZABETH LAWRENCE, PH.D.,

More information

Mice lacking the syndecan-3 gene are resistant to diet-induced obesity

Mice lacking the syndecan-3 gene are resistant to diet-induced obesity Research article Mice lacking the syndecan-3 gene are resistant to diet-induced obesity April D. Strader, 1 Ofer Reizes, 2 Stephen C. Woods, 1 Stephen C. Benoit, 1 and Randy J. Seeley 1 1 Department of

More information

Insulin Resistance. Biol 405 Molecular Medicine

Insulin Resistance. Biol 405 Molecular Medicine Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent

More information

Critical role for peptide YY in protein-mediated satiation and bodyweight

Critical role for peptide YY in protein-mediated satiation and bodyweight Cell Metabolism, Volume 4 Supplemental data Critical role for peptide YY in protein-mediated satiation and bodyweight regulation Rachel L. Batterham, Helen Heffron, Saloni Kapoor, Joanna E. Chivers, Keval

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

8.1 Genes Are Particulate and Are Inherited According to Mendel s Laws 8.2 Alleles and Genes Interact to Produce Phenotypes 8.3 Genes Are Carried on

8.1 Genes Are Particulate and Are Inherited According to Mendel s Laws 8.2 Alleles and Genes Interact to Produce Phenotypes 8.3 Genes Are Carried on Chapter 8 8.1 Genes Are Particulate and Are Inherited According to Mendel s Laws 8.2 Alleles and Genes Interact to Produce Phenotypes 8.3 Genes Are Carried on Chromosomes 8.4 Prokaryotes Can Exchange Genetic

More information

Genetics & The Work of Mendel. AP Biology

Genetics & The Work of Mendel. AP Biology Genetics & The Work of Mendel Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas u used experimental method u used

More information

Patterns of Inheritance

Patterns of Inheritance 1 Patterns of Inheritance Bio 103 Lecture Dr. Largen 2 Topics Mendel s Principles Variations on Mendel s Principles Chromosomal Basis of Inheritance Sex Chromosomes and Sex-Linked Genes 3 Experimental

More information

CHANGES IN SERUM LEPTIN LEVELS DURING FASTING AND FOOD LIMITATION IN STELLER SEA LIONS

CHANGES IN SERUM LEPTIN LEVELS DURING FASTING AND FOOD LIMITATION IN STELLER SEA LIONS CHANGES IN SERUM LEPTIN LEVELS DURING FASTING AND FOOD LIMITATION IN STELLER SEA LIONS (EUMETOPIAS JUBATUS). Lorrie D. Rea * 1 Tim R. Nagy 2 1 Department of Biology, University of Central Florida, Orlando,

More information

BIOL212- Biochemistry of Disease. Metabolic Disorders: Diabetes

BIOL212- Biochemistry of Disease. Metabolic Disorders: Diabetes BIOL212- Biochemistry of Disease Metabolic Disorders: Diabetes Diabetes mellitus is, after heart disease and cancer, the third leading cause of death in the west. Insulin is either not secreted in sufficient

More information

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D. The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C

More information

Biology. Chapter 13. Observing Patterns in Inherited Traits. Concepts and Applications 9e Starr Evers Starr. Cengage Learning 2015

Biology. Chapter 13. Observing Patterns in Inherited Traits. Concepts and Applications 9e Starr Evers Starr. Cengage Learning 2015 Biology Concepts and Applications 9e Starr Evers Starr Chapter 13 Observing Patterns in Inherited Traits Cengage Learning 2015 Cengage Learning 2015 After completing today s activities, students should

More information

HEREDITY. Heredity is the transmission of particular characteristics from parent to offspring.

HEREDITY. Heredity is the transmission of particular characteristics from parent to offspring. INHERITANCE IN LIFE HEREDITY Heredity is the transmission of particular characteristics from parent to offspring. Mendel presented completely new theory of inheritance in the journal Transactions of the

More information

I. Introduction. II. Characteristics

I. Introduction. II. Characteristics YK050 Rat Leptin ELISA I. Introduction Leptin, which is a product of ob gene, is a protein consisting of 167 amino acids and it is secreted from white adipose tissue. It is known that leptin acts on hypothalamus

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Codominance. P: H R H R (Red) x H W H W (White) H W H R H W H R H W. F1: All Roan (H R H W x H R H W ) Name: Date: Class:

Codominance. P: H R H R (Red) x H W H W (White) H W H R H W H R H W. F1: All Roan (H R H W x H R H W ) Name: Date: Class: Name: Date: Class: (Exceptions to Mendelian Genetics Continued) Codominance Firstly, it is important to understand that the meaning of the prefix "co is "together" (i.e. cooperate = work together, coexist

More information

Single Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions

Single Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions Single Gene (Monogenic) Disorders Mendelian Inheritance: Definitions A genetic locus is a specific position or location on a chromosome. Frequently, locus is used to refer to a specific gene. Alleles are

More information

Ch 8 Practice Questions

Ch 8 Practice Questions Ch 8 Practice Questions Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What fraction of offspring of the cross Aa Aa is homozygous for the dominant allele?

More information

Mendelian Genetics. Ch. 2

Mendelian Genetics. Ch. 2 Mendelian Genetics Ch. 2 1 The historical puzzle of inheritance! Artificial selection has been an important practice since before recorded history Selection of animals for domestication Selective breeding

More information

2017 Version. Key Question types NCEA Science 1.9 Genetic Variation AS 90948

2017 Version. Key Question types NCEA Science 1.9 Genetic Variation AS 90948 2017 Version Key Question types NCEA Science 1.9 Genetic Variation AS 90948 Linking DNA, Alleles and Chromosomes Chromosomes are made up of DNA. DNA is a large molecule that is coiled into a double helix

More information

LEPTIN, the obese (ob) gene product, is a 16-kDa peptide

LEPTIN, the obese (ob) gene product, is a 16-kDa peptide 0021-972X/97/$03.00/0 Vol. 82, No. 2 Journal of Clinical Endocrinology and Metabolism Printed in U.S.A. Copyright 1997 by The Endocrine Society Sexual Dimorphism in Plasma Leptin Concentration* MOHAMMED

More information

NUMBER: /2007

NUMBER: /2007 Purpose PAGE 1 OF 8 The purpose of this policy is to create clear guidelines and procedures regarding the use of diet control in behavioral studies so that they match USDA guidelines. This procedure is

More information

BIOMEDICAL SCIENCES GRADUATE PROGRAM SPRING 2017

BIOMEDICAL SCIENCES GRADUATE PROGRAM SPRING 2017 THE OHIO STATE UNIVERSITY BIOMEDICAL SCIENCES GRADUATE PROGRAM SPRING 2017 Stephen M Bergin PhD Candidate Activation of Hypothalamic BDNF Modulates Lymphocyte Immunity February 17 th, 2017 Room 105, Biomedical

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of

More information

Human Physiology 6.6- Hormones, Homeostasis, and Reproduction

Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Essential idea: Hormones are used when signals need to be widely distributed. Application: William Harvey s investigation of sexual reproduction

More information

Ch. 23 The Evolution of Populations

Ch. 23 The Evolution of Populations Ch. 23 The Evolution of Populations 1 Essential question: Do populations evolve? 2 Mutation and Sexual reproduction produce genetic variation that makes evolution possible What is the smallest unit of

More information

11-1: Introduction to Genetics

11-1: Introduction to Genetics 11-1: Introduction to Genetics The Work of Gregor Mendel Copyright Pearson Prentice Hall Genetics Vocabulary Genetics The study of heredity. Heredity The passing of physical characteristics from parents

More information

Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas of Genetics and Cytogenetics in Oncology and Haematology Atlas of Genetics and Cytogenetics in Oncology and Haematology Genetic Counseling I- Introduction II- Motives for genetic counseling requests II-1. Couple before reproduction II-2. Couple at risk III-

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

Metabolically functional brown adipose tissue can be pharmacologically stimulated

Metabolically functional brown adipose tissue can be pharmacologically stimulated J. Physiol. (1981), 314, pp. 85-89 85 With I text figure Printed in Great Britain THERMOGENESIS IN NORMAL RABBITS AND RATS: NO ROLE FOR BROWN ADIPOSE TISSUE? BY J. M. BROCKWAY AND G. E. LOBLEY From the

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State

More information

Genetics and Heredity Notes

Genetics and Heredity Notes Genetics and Heredity Notes I. Introduction A. It was known for 1000s of years that traits were inherited but scientists were unsure about the laws that governed this inheritance. B. Gregor Mendel (1822-1884)

More information

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic

More information

Chapter 02 Mendelian Inheritance

Chapter 02 Mendelian Inheritance Chapter 02 Mendelian Inheritance Multiple Choice Questions 1. The theory of pangenesis was first proposed by. A. Aristotle B. Galen C. Mendel D. Hippocrates E. None of these Learning Objective: Understand

More information

Endocrine System. Regulating Blood Sugar. Thursday, December 14, 17

Endocrine System. Regulating Blood Sugar. Thursday, December 14, 17 Endocrine System Regulating Blood Sugar Stress results in nervous and hormonal responses. The adrenal glands are located above each kidney. Involved in stress response. Stress Upsets Homeostasis Stress

More information

FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat

FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat Mary-Kate Perrone Capstone Seminar July 14, 2007 Draft #2 Fat Stats FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat According to the 2003-2004

More information

islet insulin production in diabetes model: spatial comparison of mouse strains

islet insulin production in diabetes model: spatial comparison of mouse strains islet insulin production in diabetes model: spatial comparison of mouse strains mentor: Brian S. Yandell, UW-Biostat Trainee www.stat.wisc.edu/~yandell scientist: Donnie Stapleton, Attie Biochem Lab dsstaple@biochem.wisc.edu

More information

For a long time, people have observed that offspring look like their parents.

For a long time, people have observed that offspring look like their parents. Chapter 10 For a long time, people have observed that offspring look like their parents. Even before we knew about genes, people were breeding livestock to get certain traits in the offspring. They knew

More information