Unclear ALT Yes Monthly for first 3 months, then every 3 months EFV: 6 weeks. count, chemistry Full blood count, Creatinine, ALT, AST

Size: px
Start display at page:

Download "Unclear ALT Yes Monthly for first 3 months, then every 3 months EFV: 6 weeks. count, chemistry Full blood count, Creatinine, ALT, AST"

Transcription

1 Supplementary Table S1: Monitoring strategies Study Time to toxic event Type of AE monitoring Frequency of AE monitoring Symptom* Laboratory Baseline Routine Boulle, 2008 Change NVP: 8 weeks Unclear ALT Monthly for first 3, then every 3 EFV: 6 weeks Bruck, 2008 Liver enzyme AST, ALT Every 8 weeks elevation EFV 20 weeks NVP: 16 weeks Castlenuovo, t stated Full blood count, AST, t stated Every 6 Creatinine, serum lactate Elzi, 2010 t stated t stated t stated t stated t stated Ferradini, 2006 t stated Full blood Forna, 2007 t stated (Medical officer or self-referral) count, chemistry Full blood count, Creatinine, ALT, AST Gaytan, 2004 t stated Every 4 weeks George, 2009 t stated t stated t stated t stated t stated Haddow, 2007 t stated t stated t stated t stated t stated Ibadova, 2010 t stated t stated t stated t stated t stated Jena, 2009 t stated Hb, TLC, platelets, CD4, ALT, AST hemogram, liver function test, renal function test, lipidogram, ECG, and chest x-ray Kampire NS NS NS Kalyesubula, t stated Full blood count, ALT Complete blood count and ALT 2,6,14 and 24 weeks 2, 6, 10 and 14 weeks only ALT Khalili, 2009 t stated Full and differential blood counts, ALT, AST, Alk.P, TBR, Creatinine, BUN, triglycerides, total cholesterol, LDL, HDL, blood fasting sugar, lactate, CPK Kumarasamy, 2008a Kumarasamy, 2008b t stated Hb, liver, and renal function tests t stated Hb, Creatinine, ALT, AST t stated t stated Monthly: blood counts 3, 6, 12 : lipids, fasting blood sugar, liver and renal function, lactate, CPK 2, 4, 8, and 12 weeks if on NVP: liver function Every 3 or as clinically indicated t stated Manfredi, 2006 NVP: 4.2±1.8 EFV: 7.8±2.6 Mankhatitham, t stated Messou, 2010 NVP: 4.8 EFV: 12.8 t stated ALT, AST t stated Full blood count, blood chemistries and AST, ALT, TBR Liver function tests only Creatinine, ALT, AST Creatinine, ALT, AST 6, 12 and 24 weeks Every 6 Modayil, 2010 t stated t stated t stated t stated Monthly for newly registered pts; spontaneous reporting for longer term pts

2 Nunez, 2002 t stated Full blood count, liver (AST, ALT) and kidney function tests, amylase and lipid profile (including cholesterol, triglycerides) Obiako, 2012 t stated Blood chemistry and hematology Every 3 Every 12 weeks; visits for complaints Patel, 2006 t stated ALT t stated Monthly then 3 monthly Ritchie, 2006 t stated t stated ALT, AST (frequency stated) Sanne, 2005 HT: 28 days ALT, AST Monthly Sivadasan, 2009 Rash: 2 weeks ALT, AST 2 weeks, 1 month, then every 3 Srirangaraj, 2010 NVP: 77 days Full blood count, AST, 3 monthly EFV: 118 days ALT, TBR, creatinine (Hb, ALT, TBR, creatinine) Sulkowski, 2002 NVP: 137 days Full blood count, ALT, 4 weeks, then 3 monthly Swaminathan, EFV: 100 days t stated (monthly) AST, TBR Full blood count, liver function (tests stated) [0]Hematologic al analysis, blood glucose levels, and liver and renal function tests 2 weeks for 8 weeks, then 3 monthly Tukei, 2012 t stated Full blood count, ALT, AST Monthly van den Berg- t stated ALT, AST t stated 1 month, then 4 monthly Wolf, 2008 Van Leth, 2004 t stated ALT, AST, TBR 2, 4, 8, 12, 24, 36 and 48 weeks Wester, 2010 Treatment lipodystrophy Chemistry, full blood Monthly for 6 then 2 modifying (every 6 count, lipid chemistry monthly for 6, then 4 toxicity ), monthly NVP: c. 14 days peripheral EFV: c. 40 days neuropathy (every 2 ) Zhou, 2006 t stated t stated t stated t stated t stated * [0]Defined as necessary for the laboratory test to be performed (i.e. routine) AlkP Alkaline Phosphatase ALT Alanine transaminase AST Aspartate amiransferase BUN Blood Urea Nitrogen CPK Creatinine phosphokinase Hb Haemaglobin LDL and HDL Low-density and High-density lipoprotein cholesterol TBR Total Bilirubin TLC Total leucocyte count

3 Supplementary Table S2: Risk of bias Study Baseline characteri stics balanced (details) Unbiased reporting of outcomes Loss to follow up <2 Allocation concealment reported (for RCTs) Minimal follow up time (may exclude early discontinuations) Differential follow up by drug Overall risk of bias Boulle, 2008 N/A Low Bruck, N/A Low Castlenuovo, N/A Moderate Elzi, N/A Low/moderate Ferradini, N/A Low/moderate Forna, N/A Low Gaytan, Low/moderate George, N/A Low/moderate Haddow, N/A Low/moderate Ibadova, High Jena, N/A Low Kalyesubula, -- N/A Low/moderate Khalili, N/A Low/moderate Kampiire, N/A Moderate Kumarasamy, 2008a -- N/A Low/moderate Kumarasamy, 2008b N/A -- Low/moderate Manfredi, N/A Low/moderate Mankhatitham, Low/moderate Modayil, N/A Low/moderate Nunez, 2002 Low/moderate Obiako, N/A Low/moderate Patel, 2006 N/A Low Richie, N/A Low/moderate Sanne, 2006 Low Sivadasan, N/A Low/moderate Srirangaraj, N/A Low/moderate Sulkowski, N/A Moderate/high Swaminathan, -- Low/moderate Tukei, N/A -- Low/moderate van den Berg-Wolf, 2008 Low/moderate Van Leth, 2004 Low Wester, 2010 Low/moderate Zhou, N/A Low/moderate 1. Imbalanced for sex, CD4, and viral load 2. Imbalanced for disease stage 3. Imbalanced for HCV co-infection N/A, applicable

4 Supplementary Table S3: GRADE review - Adults Quality assessment of patients Effect Quality Importance of Design Risk of bias Inconsistency Indirectness Imprecision Treatment discontinuation 18 randomised trials and risk of serious 3 cohort Hepatotoxicity - overall (assessed with: symptom and laboratory monitoring) 23 randomised trials and risk of very serious 4 cohort Hepatotoxicity - severe (assessed with: symptom and laboratory monitoring) 16 randomised trials and risk of serious 5 cohort Skin - any (assessed with: symptom and laboratory monitoring) 19 randomised trials and risk of serious 6 cohort Skin - severe (assessed with: symptom and laboratory monitoring) 15 randomised trials and risk of very serious 7 cohort Severe hypersensitivity reaction (assessed with: symptom and laboratory monitoring) 9 randomised trials and cohort risk of 8 CNS - overall (assessed with: symptom monitoring) 13 randomised trials and cohort risk of CNS - severe (assessed with: symptom monitoring) 11 randomised trials and cohort risk of Neurology (assessed with: symptom monitoring) 10 randomised trials and risk of serious cohort Lipid changes (assessed with: symptom and laboratory monitoring) 7 randomised trials and cohort Other Relative Nevirapine Efavirenz considerations (95% CI) ne 613/ /6291 OR 2.18 (1.86 to 2.56) 535/ /4706 OR 2.51 (2.04 to 3.1) 249/ /9221 OR 3.25 (2.54 to 4.17) 707/ /3886 OR 1.80 (1.51 to 2.17) 217/ /2714 OR 3.68 (2.50 to 5.39) 272/ /2220 OR 2.18 (1.63 to 2.90) 285/ /2269 OR 0.31 (0.26 to 0.38) 22/ /1619 OR 0.29 (0.18 to 0.46) serious 9 196/ /1592 OR 0.88 (0.66 to 1.17) risk of serious 10 serious 11 serious / /1693 OR 0.85 (0.59 to 1.23) Absolute 53 more per 1000 (from 39 more to 69 more) 72 more per 1000 (from 51 more to 97 more) 23 more per 1000 (from 16 more to 32 more) 32 more per 1000 (from 19 more to 46 more) 30 more per 1000 (from 16 more to 47 more) 36 more per 1000 (from 19 more to 56 more) 115 fewer per 1000 (from 102 fewer to 125 fewer) 27 fewer per 1000 (from 20 fewer to 31 fewer) 6 fewer per 1000 (from 17 fewer to 8 more) 4 fewer per 1000 (from 11 fewer to 6 more)

5 1 Only 1 RCT reported allocation concealment 2 Baseline prognostic factors balanced; non-differential loss to follow up. 3 4 reported odds ratios in the opposite direction to the estimate, but only 1 of these was statistically significant. However, a further 5 reported odds ratios with confidence intervals consistent with either an increase or a decrease in the risk of adverse events, and several had non-overlapping confidence intervals. 4 7 of 23 reported odds ratios in the opposite direction to the estimate; however, of these were statistically significant. A further 3 reported odds ratios with confidence intervals consistent with either an increase or a decrease in the risk of adverse events. 5 4 of 16 reported odds ratios in the other direction to the estimate; however, of these were statistically significant. 6 1 study (138 patients) reported increased skin toxicity associated with EFV use; however, 8 reported odds ratios with confidence intervals consistent with either an increase or a decrease in the risk of adverse events. 7 3 reported odds ratios in the other direction to the estimate; only one of these was statistically significant. However, a further 6 included odds ratios for which the confidence intervals were consistent with either an increase or a decrease in the risk of adverse events. 8 1 study suggested a greater tendency towards HSR with EFV, but this was based on a single event. All other indicated either a statistically significant association or a strong tendency towards a statistically significant association between NVP use and a greater likelihood of severe hypersensitivity reaction. 9 Rated down because lower bound is consistent with a 44% reduction in neurological complications. 10 n-overlapping confidence intervals for several. 11 Different markers of lipid abnormalities were used by different. 12 Result consistent with a 41% decrease or a 23% increase in risk of adverse events. Supplementary Table S4: GRADE review - Children Quality assessment of patients Effect Quality Importance of Hepatotoxicity (assessed with: Laboratory) 3 observational Skin toxicity 2 observational CNS 1 observational Design Risk of bias Inconsistency Indirectness Imprecision Lipid abnormalities 1 observational Discontinuation 1 observational very serious 1 very serious 2 very serious 2 Other considerations Nevirapine Efavirenz Relative (95% CI) 12/393 (3.1%) 24/262 (9.2%) 13/171 (7.6%) very serious 2 11/171 (6.4%) 10/259 (3.9%) 4/260 (1.5%) 10/234 (4.2%) 25/177 (14.1%) 0/177 () 17/3031 (0.6%) Absolute

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

43rd Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) A Cutrell, J Hernandez, M Edwards, J Fleming, W Powell, T Scott

43rd Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) A Cutrell, J Hernandez, M Edwards, J Fleming, W Powell, T Scott 43rd Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) Poster H-2013 Clinical Risk Factors for Hypersensitivity Reactions to Abacavir: Retrospective Analysis of Over 8,000 Subjects

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

What Does My Blood Test Mean

What Does My Blood Test Mean What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

DEPARTMENT: Regulatory Compliance Support

DEPARTMENT: Regulatory Compliance Support PAGE: 1 of 5 REPLACES POLICY DATED: 1/16/98, 3/1/99, SCOPE: All Company-affiliated hospitals performing and/or billing laboratory services. Specifically, the following departments: Business Office Admitting/Registration

More information

SITA 100 mg (n = 378)

SITA 100 mg (n = 378) Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)

More information

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that

More information

(For National Authority Use Only) Name of Study Drug: to Part of Dossier:

(For National Authority Use Only) Name of Study Drug: to Part of Dossier: 2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: ABT-335 Name of Active Ingredient: Page: ABT-335, A-7770335.115

More information

Kynamro. Kynamro (mipomersen) Description

Kynamro. Kynamro (mipomersen) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: December 2, 2016 Kynamro Description Kynamro (mipomersen)

More information

The results of the ARTEN study. Vicente Soriano Hospital Carlos III, Madrid, Spain

The results of the ARTEN study. Vicente Soriano Hospital Carlos III, Madrid, Spain The results of the ARTEN study Vicente Soriano Hospital Carlos III, Madrid, Spain Nevirapine: a well-defined efficacy and tolerability profile High efficacy levels 1 3 Well-defined safety profile 4 Favourable

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Chen CL, Lin GA, Bardach NS, et al. Preoperative medical testing

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Kynamro. Kynamro (mipomersen) Description

Kynamro. Kynamro (mipomersen) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro

More information

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

DIABETES AND LABORATORY TESTS. Author: Josephine Davis DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following

More information

Annex 2: GRADE evidence profiles

Annex 2: GRADE evidence profiles Annex 2: GRADE evidence profiles GRADE table 1: Does the use of a particular method of hormonal contraception directly increase the risk of HIV acquisition in women? Outcome ( participants) Injectable

More information

Juxtapid. Juxtapid (lomitapide) Description

Juxtapid. Juxtapid (lomitapide) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. Public Disclosure Synopsis Protocol 316A4-223 (B18717) 11 October 216 Final PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved

More information

VITROS MicroSlide Assay Summary

VITROS MicroSlide Assay Summary ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product: SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating

More information

CML TREATMENT GUIDELINES

CML TREATMENT GUIDELINES CML TREATMENT GUIDELINES INITIAL INVESTIGATION Propose enrolment in the CML Registry of the CML-MPN Quebec Research Group. Medical history : Question for cardio-respiratory disorders, diabetes, pancreatitis,

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

LNA-mediated silencing of microrna-122 in African green monkeys

LNA-mediated silencing of microrna-122 in African green monkeys LNA-mediated silencing of microrna-122 in African green monkeys Supplementary information for Elmen and Lindow et al. February 25, 2008 This document contains details about the clinical parameters measured

More information

Dosage and Administration

Dosage and Administration SIRTURO product information for healthcare providers 2 WARNINGS: An increased risk of death was seen in the SIRTURO (bedaquiline) treatment group (9/79, 11.4%) compared to the placebo treatment group (2/81,

More information

(For National Authority Use Only) Name of Study Drug: to Part of Dossier:

(For National Authority Use Only) Name of Study Drug: to Part of Dossier: 2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: Niaspan Name of Active Ingredient: Page: Niacin extended-release

More information

Docetaxel + Nintedanib

Docetaxel + Nintedanib Docetaxel + Nintedanib Available for Routine Use in Burton in-patient Derby in-patient Burton day-case Derby day-case Burton community Derby community Burton out-patient Derby out-patient Indication Second

More information

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

ROUTINE LAB STUDIES. Routine Clinic Lab Studies ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not

More information

CLINICAL CHEMISTRY REAGENTS. Product Profile

CLINICAL CHEMISTRY REAGENTS. Product Profile Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting

More information

Cycle 1-6 (28 Days) Days 15&16 1&2 8. (±2 Days) (±2 Days) (±7 Days) (+7 days) X X X X X X X

Cycle 1-6 (28 Days) Days 15&16 1&2 8. (±2 Days) (±2 Days) (±7 Days) (+7 days) X X X X X X X Table 5 Schedule of Assessments A Cycles A-D and Cycles 1-6 (AZD4573 Monotherapy) Assessment Screen a Intra-subject Dose Escalation/ramp -up (Cycles a-d Cycle=14 days) z Days 1, 2, 15 & 16 Visits 1&2 8

More information

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT

More information

Learning Objectives. Disclosures. Self Assessment Questions. Background

Learning Objectives. Disclosures. Self Assessment Questions. Background Association of Hyperuricemia with Liver Dysfunction amongst Adults with Metabolic Disorders in the United States: A Cross Sectional Study Disclosures Dr. Prashant Sakharkar and Dr. Subrata Deb declare(s)

More information

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment P.C.G. Gontard 1, L.I. Stankevich 1, B.G. Gorodetsky 1 SUMMARY Clinical laboratories across the globe operate in

More information

BIOO LIFE SCIENCE PRODUCTS

BIOO LIFE SCIENCE PRODUCTS BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

4. resisted training ** OR resistance training * OR resisted exercise ** OR resistance exercise ** OR strength training ** OR strength exercise **

4. resisted training ** OR resistance training * OR resisted exercise ** OR resistance exercise ** OR strength training ** OR strength exercise ** Supplementary Table 1. Search strategy (up to January 10 th 2015). MEDLINE Result: 253 studies 1. clinical trial ** OR controlled trial ** OR randomized controlled trial * OR randomised controlled trial

More information

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

Supplementary Note Details of the patient populations studied Strengths and weakness of the study Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined

More information

Form 8: Post Transplant Annual Followup

Form 8: Post Transplant Annual Followup Page 1 of 7 Show trials/registries Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Print this Form t Started 1

More information

ACTEMRA Risk Mitigation Strategy Presenter Name, Degree

ACTEMRA Risk Mitigation Strategy Presenter Name, Degree ACTEMRA Risk Mitigation Strategy Presenter Name, Degree Medical Science Liaison Genentech, Inc. 1 Indications and Dosage Rheumatoid Arthritis (RA) (1 of 2) Indication in RA ACTEMRA (tocilizumab) is indicated

More information

The volunteers were divided into three parts to study the effect of BESEB.

The volunteers were divided into three parts to study the effect of BESEB. Brahmi is an important drug known for its memory enhancing property. In Ayurveda this drug is described as a Rasayana drug. The Rasayana therapy (rejuvenating therapy) aims specially at the promotion of

More information

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3 (ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

THE SOUTH AFRICAN ANTIRETROVIRAL TREATMENT GUIDELINES 2010

THE SOUTH AFRICAN ANTIRETROVIRAL TREATMENT GUIDELINES 2010 THE SOUTH AFRICAN ANTIRETROVIRAL TREATMENT GUIDELINES 2010 The South African Antiretroviral Treatment Guidelines 2010 Goals of the programme Achieve best health outcomes in the most cost-efficient manner

More information

Lab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure.

Lab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure. Patient Education Lab Values Explained Common Tests to Help Diagnose Kidney Disease Lab work, urine samples and other tests may be given as you undergo diagnosis and treatment for renal failure. The test

More information

Applied Health Economics and Health Policy

Applied Health Economics and Health Policy Applied Health Economics and Health Policy Cost-Effectiveness Analysis of Boceprevir for the Treatment of Chronic Hepatitis C Virus Genotype 1 Infection in Portugal Elamin H. Elbasha, Jagpreet Chhatwal,

More information

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300 Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Form 8: Post Transplant Annual Followup

Form 8: Post Transplant Annual Followup Page 1 of 8 Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Toggle Question Year/Info Print this Form t Started

More information

GSK , 2.0, 18, 2014, DAIDS

GSK , 2.0, 18, 2014, DAIDS Letter of Amendment # 1 to: HPTN 077: A Phase IIa Study to Evaluate the, Tolerability and Pharmacokinetics of the Investigational Injectable HIV Integrase Inhibitor, GSK1265744, in HIV-uninfected Men and

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

2.0 Synopsis. Choline fenofibrate capsules (ABT-335) M Clinical Study Report R&D/06/772. (For National Authority Use Only) Name of Study Drug:

2.0 Synopsis. Choline fenofibrate capsules (ABT-335) M Clinical Study Report R&D/06/772. (For National Authority Use Only) Name of Study Drug: 2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: Choline Fenofibrate (335) Name of Active Ingredient:

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information

The next generation of ART regimens

The next generation of ART regimens The next generation of ART regimens By Gary Maartens Presented by Dirk Hagemeister Division of Clinical Pharmacology UNIVERSITY OF CAPE TOWN IYUNIVESITHI YASEKAPA UNIVERSITEIT VAN KAAPSTAD Current state

More information

QUALITY HEALTHCARE MEN'S PHYSICAL CHECK-UP ELIGIBLE TO EARN ASIA MILES

QUALITY HEALTHCARE MEN'S PHYSICAL CHECK-UP ELIGIBLE TO EARN ASIA MILES Detailed Medical History Physical Examination Visual Acuity Body Mass Index & Waist Circumference Package name: PLATINUM EXECUTIVE PREMIUM ELITE CS Code CN72 CN70 CN68 CN66 Screening Purpose Package Price

More information

Sutter Health Plus Effective for Calendar Year 2015

Sutter Health Plus Effective for Calendar Year 2015 Sutter Health Plus Effective for Calendar Year 2015 CPTs CPT Descriptions 2015 Cost Under Deducible (Single Unit) Doctor's Office Visit for a New Patient (Also Urgent Care) 99201 Low Level Visit $99.00

More information

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800) ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain

More information

General Chemistry Scheme Guide

General Chemistry Scheme Guide General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....

More information

(HANG1, HANG2, HANG3, HANG4, HANG5)

(HANG1, HANG2, HANG3, HANG4, HANG5) HANG1, HANG2, HANG3, HANG4, HANG5 2018 12 31 HANG1 4,390 1,600 HANG1 X Rh HK$4,390 HK$1,600 MKT-355 2016.01 HANG2 5,970 2,400 HANG2 X Rh HK$5,970 : HK$2,400 MKT-355 2016.01 HANG3 9,715 3,980 HANG3 X Rh

More information

PDF of Trial CTRI Website URL -

PDF of Trial CTRI Website URL - Clinical Trial Details (PDF Generation Date :- Fri, 08 Mar 2019 04:26:40 GMT) CTRI Number Last Modified On 14/02/2013 Post Graduate Thesis Type of Trial Type of Study Study Design Public Title of Study

More information

The Lipid-Lowering Efficacy of Switching Within Non-Nucleoside Reverse Transcriptase Inhibitors in HIV-Infected Patients

The Lipid-Lowering Efficacy of Switching Within Non-Nucleoside Reverse Transcriptase Inhibitors in HIV-Infected Patients American Journal of Infectious Diseases 4 (2): 147-151, 2008 ISSN 1553-6203 2008 Science Publications The Lipid-Lowering Efficacy of Switching Within Non-Nucleoside Reverse Transcriptase Inhibitors in

More information

ABNORMAL LIVER FUNCTION TESTS. Dr Uthayanan Chelvaratnam Hepatology Consultant North Bristol NHS Trust

ABNORMAL LIVER FUNCTION TESTS. Dr Uthayanan Chelvaratnam Hepatology Consultant North Bristol NHS Trust ABNORMAL LIVER FUNCTION TESTS Dr Uthayanan Chelvaratnam Hepatology Consultant North Bristol NHS Trust INTRODUCTION Liver function tests Cases Non invasive fibrosis measurement Questions UK MORTALITY RATE

More information

TABLE OF CONTENTS GENERAL INFORMATION... 1

TABLE OF CONTENTS GENERAL INFORMATION... 1 BIOO RESEARCH PRODUCTS Glucose Assay Kit Manual Catalog #: 5611-01 BIOO Scientific Corp. 2011 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 1 Required Materials

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

ADPedKD: detailed description of data which will be collected in this registry

ADPedKD: detailed description of data which will be collected in this registry ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Goadsby PJ, Reuter U, Hallström Y, et al. A controlled trial

More information

Individual Study Table Referring to the Dossier SYNOPSIS. Final Clinical Study Report for Study AI424138

Individual Study Table Referring to the Dossier SYNOPSIS. Final Clinical Study Report for Study AI424138 Name of Sponsor/Company: Bristol-Myers Squibb Name of Finished Product: Reyataz Name of Active Ingredient: Atazanavir () Individual Study Table Referring to the Dossier (For National Authority Use Only)

More information

Community health day. General Robert H. Reed Recreation Center 800 Gabreski Lane, Myrtle Beach Friday, May 11 7:30-10:30 a.m.

Community health day. General Robert H. Reed Recreation Center 800 Gabreski Lane, Myrtle Beach Friday, May 11 7:30-10:30 a.m. Community health day General Robert H. Reed Recreation Center 800 Gabreski Lane, Myrtle Beach Friday, May 11 7:30-10:30 a.m. Health screenings to be offered include: Chemistry profile...$20 TSH (thyroid

More information

Hop on The Right Track

Hop on The Right Track Hop on The Right Track Know yourself - for once we know ourselves, we may learn how to care for ourselves. Socrates HealthConnexion, a new health screening and preventive medicine initiative offers customised

More information

Welcome to Wellivo Global

Welcome to Wellivo Global Welcome to Wellivo Global Wellivo Global is established with the noble vision of financial freedom for the masses. We have clear cognizance of this goal from its very inception. Our aim is to provide a

More information

BHIVA Best of CROI Feedback Meetings. London Birmingham North West England Cardiff Gateshead Edinburgh

BHIVA Best of CROI Feedback Meetings. London Birmingham North West England Cardiff Gateshead Edinburgh BHIVA Best of CROI Feedback Meetings London Birmingham North West England Cardiff Gateshead Edinburgh BHIVA Best of CROI Feedback Meetings 2010 ANTIRETROVIRAL TREATMENT STRATEGIES AND NEW DRUGS A5202:

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Gaudet D, Brisson D, Tremblay K, et al. Targeting APOC3 in

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

RESEARCH ARTICLE. Mohammad Reza SALEHIOMRAN MD 1, Seyyed Esmaeil HOSSEINI KORDKHEILY MD 2

RESEARCH ARTICLE. Mohammad Reza SALEHIOMRAN MD 1, Seyyed Esmaeil HOSSEINI KORDKHEILY MD 2 RESEARCH ARTICLE THE EFFECT OF ANTICONVULSANT DRUGS (PHENOBARBITAL AND VALPROIC ACID) ON THE SERUM LEVEL OF CHOLESTEROL, TRIGLYCERIDE, LIPOPROTEIN AND LIVER ENZYMES IN CONVULSIVE CHILDREN Mohammad Reza

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

TEST LIST SAMPLE REQUIREMENT. 1 ml serum None

TEST LIST SAMPLE REQUIREMENT. 1 ml serum None ALBUMIN TEST NAME ALKALINE PHOSPHATASE ALLERGY PROFILE, FOOD 30 allergens ALLERGY PROFILE, INHALANT 30 Allergens ALT AMYLASE ANA ANTI- TG ANTI-GLIADIN IGG ANTI-GLIADIN IGA ANTI-HBS ANTI-HCV ANTI-TPO APOLIPOPROTEIN

More information

Action Item for 2019 Review of Tool. Maintain (add include oral cavity) Maintain. Archive. Archive. 12 creatinine)

Action Item for 2019 Review of Tool. Maintain (add include oral cavity) Maintain. Archive. Archive. 12 creatinine) NEWLY DIAGNOSED/ NEW TO CARE PROGRAM SITE: REVIEWER(S): REVIEW DATE: CORE SERVICES Outpatient/Ambulatory Health Services Tool - 2018 (OLD) SECTION 1: CHART REVIEW Review for newly diagnosed HIV patients

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Period of onset and lack of clinical manifestation of hepatotoxicity after commencing highly active antiretroviral therapy

Period of onset and lack of clinical manifestation of hepatotoxicity after commencing highly active antiretroviral therapy Original Article Period of onset and lack of clinical manifestation of hepatotoxicity after commencing highly active antiretroviral therapy RA Ugiagbe, EE Ugiagbe Departments of Medicine, Gastroenterology

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Synopsis. Adalimumab M Clinical Study Report R&D/09/060. (For National Authority Use Only) to Part of Dossier: Name of Study Drug:

Synopsis. Adalimumab M Clinical Study Report R&D/09/060. (For National Authority Use Only) to Part of Dossier: Name of Study Drug: Synopsis Abbott Laboratories Name of Study Drug: Individual Study Table Referring to Part of Dossier: Volume: (For National Authority Use Only) Name of Active Ingredient: Page: Title of Study: A Multi-Center,

More information

Clinical cases: HIV/HCV coinfection

Clinical cases: HIV/HCV coinfection Clinical cases: HIV/HCV coinfection José Vicente Fernández-Montero Hospital Carlos III, Madrid Case #1 General considerations about antiviral therapy CASE # 1 43 year-old, male patient Former IDU No prior

More information

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China Xi Yuan Hospital of China Academy of Traditional Chinese Medicine Testing Report Sample processing

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada

More information

Aspirin Resistance in Patients with Chronic Renal Failure (P 5325)

Aspirin Resistance in Patients with Chronic Renal Failure (P 5325) Aspirin Resistance in Patients with Chronic Renal Failure (P 5325) Beste Ozben Sadic 1, Azra Tanrikulu 1, Mehmet Koc 2, Tomris Ozben 3, Oguz Caymaz 1 1 Marmara University, Faculty of Medicine, Department

More information