Supplementary Note Details of the patient populations studied Strengths and weakness of the study

Size: px
Start display at page:

Download "Supplementary Note Details of the patient populations studied Strengths and weakness of the study"

Transcription

1 Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined as a reduction of more than 50% in the intralumenal diameter) of all three major coronary arteries (left anterior descending, circumflex and right coronary arteries). The symptoms of angina had been stable for at least one month and no patient had suffered a myocardial infarction in the preceding three months. Patients were recruited to the NCA (normal coronary artery) group who had chest pain and a positive exercise electrocardiogram (the Bruce protocol was used, where the presence of at least 1 mm of horizontal or downward sloping ST segment depression at 80 ms after the J point is considered positive), but normal coronary angiograms (judged by two independent observers). NCA patients with hypertension, diabetes mellitus and valvular heart disease or left ventricular hypertrophy were excluded. Consecutive patients presenting at Papworth Hospital (Cambridgeshire, UK) who met the above criteria for either the TVD or NCA group were recruited to the study. The clinical data for these patient groups are shown in Table 1. After generation of the NMR spectra, two samples were identified as substantial outliers: the 1 H-NMR spectra from these subjects were found to be atypical by visual inspection and were removed before subsequent data analysis. Severity study. For the study of extent of coronary heart disease (CHD), patients were recruited according to the same criteria, except that patients with more than 50% stenosis of one, two or all three coronary arteries (assessed by two independent observers) were recruited and females were excluded. The clinical data for these patient groups are shown in Table 2. Blood samples from these patients were drawn into Diatube H tubes, and platelet-poor plasma was prepared as previously described. Aliquots of plasma were stored at 80 ºC until assayed. After generation of the NMR spectra, no samples were excluded from the data analysis. Strengths and weakness of the study It is important to note that consecutive patients arriving at Papworth Hospital were recruited to our cohort, selected only on the basis of coronary artery disease status. The cohort therefore represents the age, sex and racial background bias of heart disease sufferers within the regional population served by this hospital. We have shown that, particularly after application of orthogonal signal correction (OSC) to remove orthogonal variation, it is possible to diagnose coronary artery disease status in the presence of this background variation. If we had used highly selected populations, matched for as many parameters as possible (such as sex, age, blood pressure and so forth) this would have emphasized the differences due to artery status by removing other major sources of variation. To find utility in the clinic, a diagnostic technique must be shown to have sensitivity and specificity when applied to an unselected population. One strength of our study design, therefore, is that it does not overemphasize the diagnostic power of the test by studying highly selected populations. We have also shown that metabonomic analysis can distinguish individuals with CHD of differing severity. Using the crude parameter of number of major coronary vessels with

2 >50% stenosis, we demonstrated that both principal components analysis (PCA) and partial least squares-discriminate analysis (PLS-DA) were capable of categorizing CHD patients on the basis of severity. The failure to achieve complete separation of the classes is as likely to reflect the crude nature of our severity designations based solely on coronary angiography as on any lack of power in the metabonomic analysis to discriminate individuals. Nevertheless, none of the conventional risk factors measured in these subjects (including age, blood pressure, lipoprotein levels or clotting parameters) differed between the severity classes, even in a cross-sectional analysis, and hence we were completely unable to distinguish individuals within the population on the basis of CHD severity. This demonstrates the extent to which metabonomics improves upon conventional risk factor analysis, and emphasizes the importance of the information content of the NMR spectrum: similar diagnostic power would unlikely be achieved by applying pattern recognition methodology to existing risk factor data sets. The use of multiparametric analysis of high information density data sets has increased dramatically in recent years. NMR spectroscopy is not the only technique that can be used for such analysis: genomics, proteomics and other chemical analysis methods, such as mass spectrometry, have also been used 1,2. Application of pattern recognition technology to proteomic data sets has recently been shown to provide useful diagnostic information about prostate cancer 3. Compared to techniques such as proteomics, NMR spectroscopy does offer the advantage of extremely high reproducibility (with coefficients of variation below 1% for spectra of replicate samples generated on two different days). Such reproducibility is not yet routinely available for proteomics or gene expression profiling. Nevertheless, it seems likely that even more refined diagnostic information could be gathered by integrating metabolic, protein and genetic profiles, albeit with more difficult sample preparation and at greater cost than for a simple analysis of the proton-nmr spectrum of serum. Further studies will be required to determine to what extent the genetic and metabolic datasets contain independent diagnostic power, or whether much of the information content is overlapping. Furthermore, it is presently unclear whether the methodology used in the present study represents the optimal compromise between accuracy and simplicity: for example, other workers have described NMR spectroscopic methods for analyzing lipoprotein composition 4,5 that may also be useful for the diagnosis of cardiovascular disease, although they are unlikely to improve on the >90% sensitivity and specificity of the method reported here. There are numerous parameters affecting both the acquisition of the data (for example, the NMR pulse sequence, diffusion editing, selection of resolution and simple 1D-NMR spectra, bin widths and so forth) and the subsequent pattern analysis (application of a single round of OSC, selection of PLS-DA for classification and so forth). Further studies will be required to compare different methodological approaches for their relative diagnostic sensitivity and specificity in various clinical applications. One weakness of our study design is the small number of subjects studied, although the diagnostic sensitivity and specificity of the technology will only increase with larger numbers of subjects used to build the diagnostic model. However, widespread application of this technology will depend on the demonstration of clinical utility among large groups of subjects in a multi-center prospective trial. Such studies are already underway. The aim of the present study, however, is to investigate the science that underpins the technology, rather than to provide clinical trial data to support its use. This study (with about 150 individuals analyzed) is small as a clinical trial, but relatively large as a scientific study. It is certainly large enough: the statistical analysis makes it clear that the

3 diagnostic power we have demonstrated is very unlikely to be due to chance. Our cohort, though small, has been extensively investigated: we have data on almost 100 clinical parameters (from mean corpuscular hemoglobin concentration to plasminogen activator inhibitor (PAI-1) levels). Such extensive data would never be collected in a large multicenter validating study, yet this extensive clinical data is essential for our conclusions: using it, we can show that the significantly improved diagnostic capability of our test compared with known risk factor analysis derives mostly from the information in the proton-nmr spectra rather than from the power of the pattern recognition methodology. Table 1 Clinical parameters for the NCA and TVD patients NCA TVD Age (years) 57.2 ± ± 7.2 Sex: Male (n) Female (n) Previous myocardial infarction 1 19 Blood pressure: systolic (mmhg) 141 ± ± 23 Diastolic (mmhg) 78 ± ± 12 Current smokers (n) 2 1 Urea (mm) 5.0 ± ± 1.6 Creatinine (µm) 93 ± ± 18 Glucose (mm) 5.2 ± ± 0.9 Total cholesterol (mm) 5.9 ± ± 0.8 HDL-cholesterol (mm) 1.1 ± ± 0.2 LDL-cholesterol (mm) 4.3 ± ± 0.7 Total cholesterol:hdl-c ratio 5.8 ± ± 1.9 Triglycerides (mm) 1.5 ± ± 1.1 PAI-1 (ng ml -1 ) 37.9 ± ± 16.6 Total protein (g.l -1 ) 70.4 ± ± 4.0 Albumin (g.l -1 ) 38.6 ± ± 2.6

4 Globulin (%) 45 ± 5 46 ± 4 Values are mean ± s.d., except for triglyceride, which is median ± interquartile range. n, Number of patients; NCA, normal coronary artery; TVD, triple vessel disease; HDL, high-density lipoprotein; LDL, low-density lipoprotein; PAI-1, plasminogen activator inhibitor. Table 2 Clinical parameters for subjects with stenosis of one, two or three coronary vessels 1 Vessel disease 2 Vessel disease 3 Vessel disease Height (m) 1.76 ± ± ± 0.06 Weight (kg) 83.5 ± ± ± 9.6 BMI (kg.m 2 ) ± ± ± 2.22 Erythrocyte count 4.64 ± ± ± 0.25 Hemoglobin (g.dl 1 ) 13.9 ± ± ± 0.95 Hematocrit ± ± ± MCV (fl) 90.2 ± ± ± 5.3 MCHC (g.dl 1 ) 30.1 ± ± ± 2.0 Platelets (10 9 /l) 210 ± ± ± 57 White blood cell count 6.30 ± ± ± 1.50 Neutrophils (10 9 /l) 3.63 ± ± ± 1.14 Lymphocytes (10 9 /l) 1.88 ± ± ± 0.44 Monocytes (10 9 /l) 0.53 ± ± ± 0.14 Eosinophils (10 9 /l) 0.21 ± ± ± 0.10 Basophils (10 9 /l) 0.02 ± ± ± 0.01 Fibrinogen (g/l 1 ) 3.52 ± ± ± 0.84 Clotting time: PT test (s) 13.6 ± ± ± 0.8 APTT test (s) 29.0 ± ± ± 3.1

5 Sodium (mm) 140 ± ± ± 2 Potassium (mm) 4.1 ± ± ± 0.3 Urea (mm) 6.1 ± ± ± 1.3 Creatinine (µm) 104 ± ± ± 11 Total protein (g.l 1 ) 72 ± 4 72 ± 6 72 ± 3 Albumin (g.l 1 ) 42 ± 3 41 ± 4 42 ± 3 Immunoglogulins (g.l 1 ) 31 ± 4 30 ± 5 30 ± 3 Bilirubin (µm) 9 ± 4 11 ± 4 10 ± 4 ALT (units per l) 19 ± 6 23 ± ± 8 ALP (units per l) 183 ± ± ± 41 γgt (units per l) 12.1 ± ± ± 7.5 Glucose (mm) 5.8 ± ± ± 2.3 HbA1c 5.6 ± ± ± 0.6 Total cholesterol (mm) 5.3 ± ± ± 0.9 LDL-cholesterol (mm) 3.3 ± ± ± 0.9 HDL-cholesterol (mm) 1.01 ± ± ± 0.34 Triglycerides (mm) 2.0 ± ± ± 0.8 For each parameter, the values are mean ± s.d., except for triglyceride, which is reported as median ± interquartile range. BMI, body mass index; MCV, mean corpuscular volume; MCHC, mean corpuscular hemoglobin concentration; PT, prothrombin time; APTT, partial thromboplastin time; ALT, alanine aminotransferase; ALP, alkaline phosphatase; γgt, γ-glutamyl transferase; HbA1c, glycated hemoglobin. Table 3 Summary of spectral regions influencing separation of NCA samples from TVD samples Bucket region (δ) Assignment Chemical shift (δ) and multiplicity NMR spectral intensity in TVD versus NCA 1.30 Lipid, mainly VLDL (CH 2 ) n 1.29 (m) Increased

6 1.22 Lipid CH 3 CH 2 CH (m) Decreased 1.26 Lipid, mainly LDL CH 3 CH 2 (CH 2 ) n 1.26 (m) 1.25 (m) Increased 1.34 Lipid CH 2 CH 2 CH 2 CO 1.32 (m) Increased 3.22 Choline N(CH 3 ) (s) Decreased 0.86 Lipid: LDL CH 3 (CH 2 ) n VLDL CH 3 CH 2 CH 2 C= 0.84 (t) 0.87 (t) Increased 0.9 Cholesterol C (d) Increased 0.82 Lipid CH 3 Cholesterol C26 and C (t) 0.84 (d,d) Decreased 2.02 Lipid CH 2 C=C 2.00 (m) Increased 1.58 Lipid, mainly VLDL CH 2 CH 2 CO 1.57 (m) Increased 2.22 Lipid CH 2 CO 2.23 (m) Increased 1.98 Lipid CH 2 C=C 1.97 (m) Decreased Supplementary References 1. Shaw, A. et al. Adv. Biochem. Eng. Biotechnol. 66, (2000). 2. Jungblut, P. et al. Electrophoresis 20, (1999). 3. Petricoin, E. 3 rd et al. J. Natl. Cancer Inst. 94, (2002). 4. Otvos, J., Jeyerajah, E., Bennett, D. & Krauss, R. Clin. Chem. 38, (1992). 5. Serrai, H. et al. NMR Biomed. 11, (1998).

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

What Does My Blood Test Mean

What Does My Blood Test Mean What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

Table 1 Baseline characteristics of 60 hemodialysis patients with atrial fibrillation and warfarin use

Table 1 Baseline characteristics of 60 hemodialysis patients with atrial fibrillation and warfarin use Table 1 Baseline characteristics of 60 hemodialysis patients with atrial fibrillation and warfarin use Baseline characteristics Users (n = 28) Non-users (n = 32) P value Age (years) 67.8 (9.4) 68.4 (8.5)

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene

More information

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Total Cholesterol A Type of Fat. LDL Bad Cholesterol. HDL Good Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely

More information

(For National Authority Use Only) Name of Study Drug: to Part of Dossier:

(For National Authority Use Only) Name of Study Drug: to Part of Dossier: 2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: ABT-335 Name of Active Ingredient: Page: ABT-335, A-7770335.115

More information

Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic

Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Glossary of terms used in College examinations. The Royal College of Emergency Medicine

Glossary of terms used in College examinations. The Royal College of Emergency Medicine Glossary of terms used in College examinations The Royal College of Emergency Medicine The CEM uses several terms in examinations that may cause confusion. The following definitions are intended as a guide

More information

e-figure 1. The design of the study.

e-figure 1. The design of the study. e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and

More information

SITA 100 mg (n = 378)

SITA 100 mg (n = 378) Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)

More information

Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms

Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms QQ QR/RR n = 36 n = 80 Men (%) 20 (55) 54 (67) 0.216 Age (years) 57 ± 10 56 ±

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Table S1. Characteristics associated with frequency of nut consumption (full entire sample; Nn=4,416).

Table S1. Characteristics associated with frequency of nut consumption (full entire sample; Nn=4,416). Table S1. Characteristics associated with frequency of nut (full entire sample; Nn=4,416). Daily nut Nn= 212 Weekly nut Nn= 487 Monthly nut Nn= 1,276 Infrequent or never nut Nn= 2,441 Sex; n (%) men 52

More information

SCIENTIFIC STUDY REPORT

SCIENTIFIC STUDY REPORT PAGE 1 18-NOV-2016 SCIENTIFIC STUDY REPORT Study Title: Real-Life Effectiveness and Care Patterns of Diabetes Management The RECAP-DM Study 1 EXECUTIVE SUMMARY Introduction: Despite the well-established

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Glossary of terms used in IEEM. Hong Kong College of Emergency Medicine March 2013

Glossary of terms used in IEEM. Hong Kong College of Emergency Medicine March 2013 Glossary of terms used in IEEM Hong Kong College of Emergency Medicine March 2013 The Hong Kong College of Emergency Medicine IEEM uses several terms in examinations that may cause confusion. The following

More information

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

Urinary metabolic profiling in inflammatory bowel disease. Dr Horace Williams Clinical Research Fellow Imperial College London

Urinary metabolic profiling in inflammatory bowel disease. Dr Horace Williams Clinical Research Fellow Imperial College London Urinary metabolic profiling in inflammatory bowel disease Dr Horace Williams Clinical Research Fellow Imperial College London Background: Metabolic profiling Metabolic profiling or metabonomics describes

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Table S1: Number and percentage of patients by age category Distribution of age Age

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of

More information

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of

More information

NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE General practice Indicators for the NICE menu

NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE General practice Indicators for the NICE menu NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE General practice Indicators for the NICE menu Indicator area: Pulse rhythm assessment for AF Indicator: NM146 Date: June 2017 Introduction There is evidence

More information

Senior Executive Wellness Profile

Senior Executive Wellness Profile Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,

More information

What if you could help your team realise their health goals?

What if you could help your team realise their health goals? What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make

More information

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

During the past two decades,

During the past two decades, Prospectively validated prediction of physiologic variables and organ failure in septic patients: The Systemic Mediator Associated Response Test (SMART) Gus J. Slotman, MD Objective: Conventional outcomes

More information

Know Your Number Aggregate Report Single Analysis Compared to National Averages

Know Your Number Aggregate Report Single Analysis Compared to National Averages Know Your Number Aggregate Report Single Analysis Compared to National s Client: Study Population: 2242 Population: 3,000 Date Range: 04/20/07-08/08/07 Version of Report: V6.2 Page 2 Study Population Demographics

More information

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150. Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,

More information

Reeju Manandhar, Chaofeng Sun. Original article

Reeju Manandhar, Chaofeng Sun. Original article Original article Association of different blood parameters with the early patency of Infarct related artery in ST elevation Myocardial Infarction, a comparative analysis. Reeju Manandhar, Chaofeng Sun

More information

Plaque sample Saliva sample Treatment recommended

Plaque sample Saliva sample Treatment recommended ผศ.ทพ.ส พจน ตามสายลม ภาคว ชาปร ท นตว ทยา คณะท นตแพทยศาสตร จ ฬาลงกรณ มหาว ทยาล ย Oral health and Systemic health connection Several epidemiological and clinical studies have revealed significant associations

More information

PROTHROMBIN TIME, ACTIVATED PARTIAL THROMBOPLASTIN TIME AND OTHER HAEMATOLOGICAL PARAMETERS AMONG NON-DIABETIC HYPERTENSIVE PATIENTS

PROTHROMBIN TIME, ACTIVATED PARTIAL THROMBOPLASTIN TIME AND OTHER HAEMATOLOGICAL PARAMETERS AMONG NON-DIABETIC HYPERTENSIVE PATIENTS Nigerian Journal of Clinical Practice March 200. Vol 12(1):-10 PROTHROMBIN TIME, ACTIVATED PARTIAL THROMBOPLASTIN TIME AND OTHER HAEMATOLOGICAL PARAMETERS AMONG NON-DIABETIC HYPERTENSIVE PATIENTS *EO Ukaejiofo,

More information

Supplementary Online Content. Abed HS, Wittert GA, Leong DP, et al. Effect of weight reduction and

Supplementary Online Content. Abed HS, Wittert GA, Leong DP, et al. Effect of weight reduction and 1 Supplementary Online Content 2 3 4 5 6 Abed HS, Wittert GA, Leong DP, et al. Effect of weight reduction and cardiometabolic risk factor management on sympton burden and severity in patients with atrial

More information

JUPITER NEJM Poll. Panel Discussion: Literature that Should Have an Impact on our Practice: The JUPITER Study

JUPITER NEJM Poll. Panel Discussion: Literature that Should Have an Impact on our Practice: The JUPITER Study Panel Discussion: Literature that Should Have an Impact on our Practice: The Study Kaiser COAST 11 th Annual Conference Maui, August 2009 Robert Blumberg, MD, FACC Ralph Brindis, MD, MPH, FACC Primary

More information

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the

More information

Clinical Trial Synopsis TL-OPI-518, NCT#

Clinical Trial Synopsis TL-OPI-518, NCT# Clinical Trial Synopsis, NCT# 00225264 Title of Study: A Double-Blind, Randomized, Comparator-Controlled Study in Subjects With Type 2 Diabetes Mellitus Comparing the Effects of Pioglitazone HCl vs Glimepiride

More information

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada

More information

CVD Prevention, Who to Consider

CVD Prevention, Who to Consider Continuing Professional Development 3rd annual McGill CME Cruise September 20 27, 2015 CVD Prevention, Who to Consider Dr. Guy Tremblay Excellence in Health Care and Lifelong Learning Global CV risk assessment..

More information

Know Your Number Aggregate Report Comparison Analysis Between Baseline & Follow-up

Know Your Number Aggregate Report Comparison Analysis Between Baseline & Follow-up Know Your Number Aggregate Report Comparison Analysis Between Baseline & Follow-up... Study Population: 340... Total Population: 500... Time Window of Baseline: 09/01/13 to 12/20/13... Time Window of Follow-up:

More information

Module 2. Global Cardiovascular Risk Assessment and Reduction in Women with Hypertension

Module 2. Global Cardiovascular Risk Assessment and Reduction in Women with Hypertension Module 2 Global Cardiovascular Risk Assessment and Reduction in Women with Hypertension 1 Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored,

More information

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP Blood Physiology Rodolfo T. Rafael, M.D.,CFP http://clinical-updates.blogspot.com rtrafaelmd@gmail.com +639212147558 July 26, 2006 1 Blood Physiology General Consideration Plasma Cellular Elements of the

More information

PFIZER INC. THERAPEUTIC AREA AND FDA APPROVED INDICATIONS: See USPI.

PFIZER INC. THERAPEUTIC AREA AND FDA APPROVED INDICATIONS: See USPI. PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. For publications based on this study, see associated bibliography.

More information

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr. 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:

More information

2.0 Synopsis. Choline fenofibrate capsules (ABT-335) M Clinical Study Report R&D/06/772. (For National Authority Use Only) Name of Study Drug:

2.0 Synopsis. Choline fenofibrate capsules (ABT-335) M Clinical Study Report R&D/06/772. (For National Authority Use Only) Name of Study Drug: 2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: Choline Fenofibrate (335) Name of Active Ingredient:

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Characterization of systemic metabolic phenotypes associated with subclinical atherosclerosis

Characterization of systemic metabolic phenotypes associated with subclinical atherosclerosis Characterization of systemic metabolic phenotypes associated with subclinical atherosclerosis Peter Würtz, Pasi Soininen, Antti J. Kangas, Ville-Petteri Mäkinen, Per-Henrik Groop, Markku J. Savolainen,

More information

Biology 1442 Supplemental Instruction Worksheet Cardiovascular System Jacaruso - 1 -

Biology 1442 Supplemental Instruction Worksheet Cardiovascular System Jacaruso - 1 - Biology 1442 Supplemental Instruction Worksheet Cardiovascular System Jacaruso - 1-2. Organs of a closed circulatory system: A. Have valves a. Arteriole B. Regulate blood flow b. Artery C. Lead to heart

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Solomon SD, Uno H, Lewis EF, et al. Erythropoietic response

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information

Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures

Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures Supplementary Data Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures Quintiles of Systolic Blood Pressure Quintiles of Diastolic Blood Pressure Q1 Q2

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Scoring Life Insurance Applicants Laboratory Results, Blood Pressure and Build to Predict All-Cause Mortality Risk

Scoring Life Insurance Applicants Laboratory Results, Blood Pressure and Build to Predict All-Cause Mortality Risk Copyright E 2012 Journal of Insurance Medicine J Insur Med 2012;43:169 177 MORTALITY Scoring Life Insurance Applicants Laboratory Results, Blood Pressure and Build to Predict All-Cause Mortality Risk Michael

More information

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385

More information

(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects

(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects Table 1. Distribution of baseline characteristics across tertiles of OPG adjusted for age and sex (n=6279). Continuous variables are reported as mean with 95% confidence interval and categorical values

More information

-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e

-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e -1 -Renad Habahbeh -Shahd Alqudah - Saleem 1 P a g e Introduction: *Hematology and lymph system (MLS): it is a branch of medicine concerned with the study, diagnosis, prevention and treatment of blood

More information

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

i. Where is the participant seen?

i. Where is the participant seen? PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant

More information

egfr > 50 (n = 13,916)

egfr > 50 (n = 13,916) Saxagliptin and Cardiovascular Risk in Patients with Type 2 Diabetes Mellitus and Moderate or Severe Renal Impairment: Observations from the SAVOR-TIMI 53 Trial Supplementary Table 1. Characteristics according

More information

Safety of Sutherlandia fructescensin HIV-seropositive South African adults: an adaptive double-blind randomized placebo controlled trial

Safety of Sutherlandia fructescensin HIV-seropositive South African adults: an adaptive double-blind randomized placebo controlled trial Safety of Sutherlandia fructescensin HIV-seropositive South African adults: an adaptive double-blind randomized placebo controlled trial Douglas Wilson, 1 Kathleen Goggin, 2 Karen Williams, 2 Mary Gerkovich,

More information

2010 Korean Society of Cardiology Spring Scientific Session Korea Japan Joint Symposium. Seoul National University Hospital Cardiovascular Center

2010 Korean Society of Cardiology Spring Scientific Session Korea Japan Joint Symposium. Seoul National University Hospital Cardiovascular Center 2010 Korean Society of Cardiology Spring Scientific Session Korea Japan Joint Symposium Does Lt Late Cth Catch up Exist Eiti in DES? : Quantitative Coronary Angiography Analysis Kyung Woo Park, MD Cardiovascular

More information

Clinical Significance of Aldosterone Levels and Low Grade Inflammation in Patients with Coronary Vasospasm

Clinical Significance of Aldosterone Levels and Low Grade Inflammation in Patients with Coronary Vasospasm Clinical Significance of Aldosterone Levels and Low Grade Inflammation in Patients with Coronary Vasospasm Department of Cardiology Keiji Inoue Akira Ueoka, Naoki Maruyama, Yoshiaki Shimoda, Eigo Kishita,

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Serra AL, Poster D, Kistler AD, et al. Sirolimus and kidney

More information

Cardiac Pathophysiology

Cardiac Pathophysiology Cardiac Pathophysiology Evaluation Components Medical history Physical examination Routine laboratory tests Optional tests Medical History Duration and classification of hypertension. Patient history of

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Cho et al., 2009 Journal of Cardiology (2009), 54:

Cho et al., 2009 Journal of Cardiology (2009), 54: Endothelial Dysfunction, Increased Carotid Artery Intima-media Thickness and Pulse Wave Velocity, and Increased Level of Inflammatory Markers are Associated with Variant Angina Cho et al., 2009 Journal

More information

Dr Anne King dc life dclife.co.uk

Dr Anne King dc life dclife.co.uk The Vampire Strikes Back Dr Anne King dc life dclife.co.uk Overview Clinical -v- Underwriting Blood physiology The blood sample Screening for the 3 main killers The top 3 useful blood tests The future

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Pedersen SB, Langsted A, Nordestgaard BG. Nonfasting mild-to-moderate hypertriglyceridemia and risk of acute pancreatitis. JAMA Intern Med. Published online November 7, 2016.

More information

Influence of deep-freezing on the autofluorescent properties of human plasma proteins

Influence of deep-freezing on the autofluorescent properties of human plasma proteins ORIGINAL ARTICLE Joanna Sikora 1, Małgorzata Ostrowska 2, Michał Kasprzak 1, 3, Jacek Fisz 4, Grażyna Odrowąż-Sypniewska 5, Jacek Kubica 1 1 Department of Cardiology and Internal Medicine 2 Department

More information

Summary ID# Clinical Study Summary: Study B4Z-JE-LYBD

Summary ID# Clinical Study Summary: Study B4Z-JE-LYBD CT Registry ID#5286 Page 1 Summary ID# 5286 Clinical Study Summary: Study B4Z-JE-LYBD An Open Label, Dose-Titration Safety Study of Hydrochloride in Outpatient Japanese Children with Attention-Deficit/Hyperactivity

More information