Supporting Information

Transcription

1 Supporting Information Chlorinated Polyfluorinated Ether Sulfonates Exhibit Higher Activity towards Peroxisome Proliferator-Activated Receptors Signaling Pathways than Perfluorooctane Sulfonate Chuan-Hai Li 1,2, Xiao-Min Ren 1 *, Ting Ruan 1, Lin-Ying Cao 1,2, Yan Xin 1,2, Liang-Hong Guo 1,2 *, Gui-bin Jiang 1,2 1 State Key Laboratory of Environmental Chemistry and Eco-toxicology, Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, 18 Shuangqing Road, Beijing , P. R.China 2 University of Chinese Academy of Sciences, Beijing , P. R. China Corresponding authors: Xiao-Min Ren, xmren@rcees.ac.cn Liang-Hong Guo, LHGuo@rcees.ac.cn Address correspondence to Liang-Hong Guo, State Key Laboratory of Environmental Chemistry and Eco-toxicology, Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, 18 Shuangqing Road, P.O. Box 2871, Beijing , P.R. China. Telephone/Fax: LHGuo@rcees.ac.cn S1

2 Contents: Part 1: Methods The text includes details of cell viability assay for HEK 293 and 3T3-L1 cells, transient transfection assay and Oil Red O staining assay. Part 2: 6 Figures Figure S1. Fluorescence binding of C1-BODIPY-C12 to PPARα-LBD (A) PPARβ-LBD (B) PPARγ-LBD (C) and competitive binding of linoleic acid to PPAR (α, β, γ)-lbds (D). Figure S2. Effects of WY14643 on PPARα (A), GW on PPAR β (B), and rosiglitazone on PPAR γ (C) mediated luciferase reporter gene transcription activity. Figure S3. The cytotoxicity of PFOS and Cl-PFAESs on HEK 293 cells determined by WST-1 assay. Figure S4. The cytotoxicity of PFOS and Cl-PFAESs on 3T3-L1 cells determined by WST-1 assay. Figure S5. Effects of WY14643, GW and rosiglitazone on adipogenesis in 3T3-L1 cells. Figure S6. Effects of WY14643, GW and rosiglitazone on expression of four adipogenic related genes in 3T3-L1 cells. Part 3: 1 Table Table S1. List of primer pairs used for quantitative real-time PCR. S2

3 Methods Cell viability assay for HEK 293 and 3T3-L1 cells. Cells were seeded in 96-well plate at a density of cells/well in culture medium. After 24 hours, cells were treated with PFOS and Cl-PFAESs for another 24 hours. Then, cells were incubated with cell proliferation reagent WST-1 (1:10 dilution) (Roche Applied Science, Penzberg, Germany) at 37 for two hours. The absorbance was measured at 480 nm using SpectraMax i3x Multi-mode detection platform (Molecular Devices, Sunnyvale, CA). Fluorescence competitive binding assay. The fluorescence probe C1-BODIPY-C12 was used in the competitive binding assay. Change of the FP value, which depends on the rotational relaxation time of fluorescence probe, was used to detect the binding of probe with proteins (Figure S1A C). In the competitive binding assay, human PPAR (α/800 nm, β/400 nm, γ/800 nm)-lbd, 50 nm C1-BODIPY-C12 and different concentration of ligand were mixed in Tris-HCl buffer (20 mm Tris-HCl, 100 mm NaCl, ph 7.4) in a total volume of 20 μl. The content of DMSO in the final solution was kept below 1% to avoid solvent effect. After incubation for 5 min at room temperature, the FP was measured and plotted as a function of the ligand concentration. The competition curve for each ligand was fitted with a sigmoidal model (OriginLab, Northampton, MA) to calculate the IC 50 value. Relative binding potency (RP), in comparison with that of LA (binding potency set to 1), was obtained by dividing the IC 50 of LA by that of other chemicals. All the assays were performed in 384-well black plates (Corning, New York, USA) with three replicates. S3

4 The FP was detected on a SpectraMax i3x fluorophotometer (Molecular Devices, CA, USA) equipped with a fluorescence polarization optics module including an excitation filter of 490/20 nm and an emission filter of 515/20 nm. Vector construction and transient transfection assay. The pbind-ppar (α, β, γ) vectors containing yeast Gal4 DNA-binding domain (Gal4-DBD) and peroxisome proliferators-activated receptors-ligand binding domain fusion genes were provided by GeneChem (Shanghai, China). The pbind-ppar (α, β, γ) vectors can induce the firefly luciferase transcription of pgl4.35[luc2p/9xgal4uas/hygro] vector (Promega, Madison, WI, USA) containing an upstream Gal4 upstream activator sequence (UAS) when activated by a PPAR ligand. A PRL-TK vector (Promega, Madison, WI, USA) was used as an internal control reporter. HEK 293 cells were seeded at a density of cells/well in 24-well plates and maintained in DMEM supplemented with 10% FBS. After 24 hours, cells were transiently transfected with 300 ng of pbind-ppar(α, β, γ) vector, 300 ng of pgl4.35[luc2p/9xgal4uas/hygro] vector and 300 ng of PRL-TK vector. After 24 hours, the wells were replaced with fresh medium containing tested compounds for another 24 hours. The concentrations of chemicals used in the transient transfection assay had no cytotoxicity on HEK 293 cells (Figure S3). The cells were then harvested and measured their luciferase activity using a dual-luciferase reporter assay kit (Promega) and normalized to the Renilla luciferase activity. All data points were performed in triplicate at least three independent experiments. 3T3-L1 adipogenesis assay. 3T3-L1 cells were seeded in 6-well plates at a density S4

5 of cells per well in culture medium. After two days of culture to achieve 90% confluence (define as day 0), cells were changed into culture medium supplemented with 1 μm dexamethasone, 0.5 mm 3-isobutyl-1-methylxan-thine (IBMX), and 10 μg/ml insulin (differentiation medium, DMI) for 2 days (day 2). Then, the medium was replaced with DMI medium without dexamethasone and IBMX, and incubated for another 2 days (day 4). After that, cells were changed into culture medium in the following 6 days and the medium was changed every two days (day 10). The cells were exposed to the tested chemicals throughout the entire experimental period. After 10 days of adipocyte differentiation, the effect of chemicals on adipogenesis was detected by assessing the lipid content and the expression level of four adipogenic related genes. Oil Red O staining and analysis. After 10 days of adipocyte differentiation, cells were washed twice with PBS and fixed with 10% formaldehyde in PBS at 4 for 30 min. Then, cells were washed with PBS for twice and stained with Oil Red O solution [containing 60% Oil Red O stock solution (0.5% Oil Red O in 100% isopropanol) and 40% H 2 O] for 30 min. The cells were washed twice with PBS and dried completely. The images of Oil Red O staining cells were photographed using an Olympus CKX41 inverted microscope. Then, the stained oil droplets were extracted in isopropanol and quantified at 520 nm using SpectraMax i3x Multi-mode detection platform (Molecular Devices, Sunnyvale, CA). Molecular docking. The protein files were prepared by the removal of water molecules and other ligands, addition of polar hydrogens and Kollman charges. The S5

6 PPAR-LBDs were kept rigid, the grid box was centered at the core site of the PPAR-LBDs (PPARα,( , -2.41, 3.68); PPARβ, (1.304, , ); PPARγ, (8.913, , )) and built with Å points cube coverage. A spacing of A between the grid points was used. All other docking parameters were set to defaults, including a medium number of 2.5 million energy evaluations, a population size of 150, a maximum of 2700 generations, a mutation rate of 0.02, crossover rate of 0.8 and 10 GA runs. For each compound, 10 independent docking runs were carried out, and the binding mode with the lowest binding energy was selected for analysis. Hazard quotients (HQs). According to the serum data reported by Shi et al. (2016) and the adipogenesis toxicity endpoints measured in our study, the margin of safety (MoS) was calculated. Shi et al. reported that the median 6:2 Cl-PFAES serum concentration of general population was 4.7 ng/ml, and the median 6:2 Cl-PFAES serum concentration of occupational population was 93.7 ng/ml. The Hazard Quotient (HQ) was used to estimate the potential risk. HQs were calculated based on the formula as follows 1,2 : HQ = Measured serum level Uncertainty factor (UF)/PoD; Where PoD derived lowest observed adverse effect level (LOAEL) (6:2 Cl-PFAES: 10µM), the generally accepted default UF = 300 (3 for inter-species interpolation, 10 for human variability, and 10 for LOAEL to NOAEL extrapolation) are used. HQs below 1 indicate an absence of risk for the particular endpoint considered, whereas HQs greater than 1 indicate exposure that may be regarded as being of S6

7 concern. (Safe) 1 > HQ > 1 (unsafe). S7

8 Figure S1. Fluorescence binding of C1-BODIPY-C12 to PPARα-LBD (A) PPARβ-LBD (B) PPARγ-LBD (C) and competitive binding of linoleic acid to PPAR (α, β, γ)-lbds (D). S8

9 Figure S2. Effects of WY14643 on PPARα (A), GW on PPAR β (B), and rosiglitazone on PPAR γ (C) mediated luciferase reporter gene transcription activity. The relative luciferase activity was determined by setting 0.1% DMSO (Veh) treated cells as 1. S9

10 Figure S3. The cytotoxicity of PFOS and Cl-PFAESs on HEK293 cells determined by WST-1 assay. *p < 0.05, compare with the control group (0.1% DMSO). S10

11 Figure S4. The cytotoxicity of PFOS and Cl-PFAESs on 3T3-L1 cells determined by WST-1 assay. *p < 0.05, compare with the control group (0.1% DMSO). S11

12 Figure S5. Effects of WY14643, GW and rosiglitazone on adipogenesis in 3T3-L1 cells. (A) Oil Red O staining of 3T3-L1 cells after treated with 10 µm WY14643, 100 nm GW and 100 nm rosiglitazone for 10 days. (B) Lipid contents of WY14643, GW and rosiglitazone treated 3T3-L1 cells. The relative TG content was determined by setting 0.1% DMSO (Veh) treated cells as 1. *p < 0.05, compared with Veh. S12

13 Figure S6. Effects of WY14643, GW and rosiglitazone on expression of four adipogenic related genes in 3T3-L1 cells. The relative mrna levels were normalized to β-actin mrna level. S13

14 Table S1. List of primer pairs used for quantitative real-time PCR. Primer Forward (5-3 ) Reverse (5-3 ) Cebpα TTACAACAGGCCAGGTTTCC CTCTGGGATGGATCGATTGT ap2 TCACCTGGAAGACAGCTCCT AATCCCCATTTACGCTGATG Adip TGACTGGCTGAAAGACAACG TTGGTCTCAGCATCGTCAAG Lep TCTTTCCGGAACATTTGGAG TGTGAGATCAACCCTGGACA β-actin AGCCATGTACGTAGCCATCC CTCTCAGCTGTGGTGGTGAA S14

15 References (1) Ludwicki, J. K.; Góralczyk, K.; Struciński, P.; Wojtyniak, B.; Rabczenko, D.; Toft, G.; Lindh, C. H.; Jönsson, B. A.; Lenters, V.; Heederik, D. Hazard quotient profiles used as a risk assessment tool for PFOS and PFOA serum levels in three distinctive European populations. Environ Int. 2015, 74, (2) Wang, B.; Chen, Q.; Shen, L.; Zhao, S.; Pang, W.; Zhang, J. Perfluoroalkyl and polyfluoroalkyl substances in cord blood of newborns in Shanghai, China: Implications for risk assessment. Environ Int. 2016, 97, S15