Sodium channels play an important role in neuronal. Sodium Current in Human Jejunal Circular Smooth Muscle Cells. Materials and Methods

Transcription

1 GASTROENTEROLOGY 2002;122: Sodium Current in Human Jejunal Circular Smooth Muscle Cells ADRIAN N. HOLM,*, ADAM RICH,*, STEVEN M. MILLER,*, PETER STREGE,*, YIJUN OU,*, SIMON J. GIBBONS,* MICHAEL G. SARR, JOSEPH H. SZURSZEWSKI,*, JAMES L. RAE,* and GIANRICO FARRUGIA*, *Department of Physiology and Biophysics, Division of Gastroenterology and Hepatology, and Department of Surgery, Enteric NeuroScience Program, Mayo Clinic and Mayo Foundation, Rochester, Minnesota Background & Aims: Sodium channels are key regulators of neuronal and muscle excitability. However, sodium channels have not been definitively identified in gastrointestinal smooth muscle. The aim of the present study was to determine if a Na current is present in human jejunal circular smooth muscle cells. Methods: Currents were recorded from freshly dissociated cells using patch-clamp techniques. Complementary DNA (cdna) libraries constructed from the dissociated cells were screened to determine if a message for subunits of Na channels was expressed. Smooth muscle cells were also collected using laser-capture microdissection and screened. Results: A tetrodotoxin-insensitive Na channel was present in 80% of cells patch-clamped. Initial activation was at 65 mv with peak inward current at 30 mv. Steady-state inactivation and activation curves revealed a window current between 75 and 60 mv. The Na current was blocked by lidocaine and internal and external QX314. A cdna highly homologous to SCN5A, the subunit of the cardiac Na channel, was present in the cdna libraries constructed from dissociated cells and from smooth muscle cells collected using laser-capture microdissection. Conclusions: Human jejunal circular smooth muscle cells express a tetrodotoxin-insensitive Na channel, probably SCN5A. Whether SCN5A plays a role in the pathophysiology of human gut dysmotilities remains to be determined. Sodium channels play an important role in neuronal and skeletal muscle excitability. 1 3 In response to a membrane depolarization, voltage-gated Na channels open and allow Na to enter the cell following its electrochemical gradient. The rapid influx of Na results in rapid depolarization. Inactivation of Na channels is followed by repolarization, and an action potential is produced whose current is carried by Na. In contrast, in gastrointestinal smooth muscle, Na channels are not required for the action potential, which is carried by Ca Gastrointestinal action potentials are usually triggered by the electrical slow wave, a rhythmic oscillation of the membrane potential crossing the threshold for firing of the action potential. The electrical slow wave, generated in interstitial cells of Cajal 7 9 and present at all levels of the gastrointestinal tract, is required for coordinated gastrointestinal motility. The smooth muscle slow wave is altered but not immediately abolished in the absence of extracellular Na. 4 6 This observation suggests that Na channels are not absolutely required for slow wave generation but contribute to the electrical event. Recordings of inward current in human jejunal circular smooth muscle cells show the presence of a mechanosensitive L-type Ca 2 channel. 10 At hyperpolarized holding voltages, a second component of the inward current is discernible with faster kinetics of activation and inactivation than the L-type Ca 2 current. The aim of the present study was to determine the ionic conductances that carry the fast component of the inward current. Materials and Methods Human jejunal tissue, use of which was approved by the Institutional Review Board, was obtained as surgical waste tissue during gastric bypass operations performed for morbid obesity. Tissue specimens were harvested directly into chilled buffer with warm ischemia times of approximately 30 seconds. Single, isolated, relaxed circular smooth muscle cells were obtained from the human jejunal specimens as previously described. 11,12 Cells were used within 6 hours of dissociation. Patch-Clamp Recordings Whole-cell patch-clamp recordings were made using standard and amphotericin-perforated patch-clamp whole-cell techniques Steady-state inactivation was determined us- Abbreviations used in this paper: C m, cell capacitance; NMDG, N- methyl-d-glucamine; PCR, polymerase chain reaction; R a, access resistance; TTx, tetrodotoxin by the American Gastroenterological Association /02/$35.00 doi: /gast

2 January 2002 SODIUM CHANNEL IN GUT SMOOTH MUSCLE 179 ing a pulse protocol in which cells were held at 100 mv, stepped to a range of voltages from 80 to 20 mv for 3 seconds to reach a steady state of inactivation, then briefly stepped to 110 mv for 10 milliseconds (to standardize transients) and stepped to 40 mv. Current was measured at 40 mv. The start-to-start time was 6 seconds. To assess the effects of lidocaine, an open channel blocker of Na channels, cells were held at 100 mv and then stepped to 30 mv for 16 milliseconds at frequencies ranging from 0.5 to 10 Hz. Series resistance compensation of 70% 75% (lag of 10 microseconds) was applied during each recording. The mean cell capacitance (C m ) was pf, and the access resistance (R a ) was 5 10 M (with 70% 75% series resistance compensation of m ). Therefore, the band width was Hz. Maximal peak currents for both the Na and Ca 2 current components were made by individually analyzing each trace of each record. Drugs were applied by complete bath changes with the solution containing the drug. All records were obtained at room temperature (22 C). Records were not leak-subtracted because the mean input resistance at 80 mv was 19 4G. Complementary DNA Library Preparation Libraries were prepared from dissociated jejunal circular smooth muscle cells obtained from 3 jejunal preparations as previously outlined. 11,12,14 16 Total RNA was extracted using the RNAzolB method (TelTest Inc., Friendswood, TX). Approximately 200 ng of poly(a) RNA were used per library (3 libraries generated). Polymerase Chain Reaction and Primers Sequencing was performed on fragments generated by polymerase chain reaction (PCR) from the complementary DNA (cdna) libraries. The cdna sequences for tetrodotoxin (TTx)-insensitive Na channels were submitted to the Gene Runner (Hastings Software, Inc., Hastings-on-the-Hudson, NY) software to identify several primer pairs (22 24 bases) with Tm values matched to within 0.2. Several primer sets were used for each sequence of interest. For SCN5A, the primer pairs used in the figures shown were ACCATCGT- GAACAACAAGAGCC(F), GGCAGCCAGCTTGACAA TA- CAC (B), GGCATCGACGACATGTTCAAC (F), GGTC- CATGTTGATGAGG CTTATCT (B) for the library experiments and CAGCTCTTTGGCAAGAACTACTCG (F), CGCCTTC- CTCAAACTGTGTTTC (B) for the laser-capture microdissection experiments. Other primer pairs were also used. Primer pairs used were AAAGATGCTCAAGCCGAGTG (F) and GTGATCCGACCATGAGTAAG (B) for c-kit and GG- GAAACTGTGGCGTGAT (F) and AAAGGTGGAGGA- GTGGGT (B) for glyceraldehyde-3-phosphate dehydrogenase (phosphorylating). Product sequences were aligned with the published sequences and with each other using GeneWorks (Mountain View, CA) software on a Power Mac computer. Laser-Capture Microdissection Laser-capture microdissection was performed using the PIX II Cell LCM system (Arcturus Engineering Inc., Santa Clara, CA). The 7.5- m laser spot size was used. Tissues were fixed in ice-cold acetone under RNase-free conditions and dehydrated according to the recommended protocol (Arcturus Engineering Inc.). A rabbit anti c-kit antibody (MBL, Watertown, MA) was used with the ABC method (Vector Labs, Burlingame, CA) to allow positive identification of interstitial cells of Cajal with transmitted light. These cells were avoided. All solutions were prepared using diethyl pyrocarbonate treated water and RNase inhibitor (1 U/mL) added to antibody solutions to eliminate potential RNase contamination. Smooth muscle cells were easily identified and collected and transferred to a sterile RNase-free 0.5-mL tube containing RNA extraction buffer. Messenger RNA was isolated using a standard kit (Invitrogen, Carlsbad, CA), and reverse-transcription (RT) PCR was performed according to standard procedures. Drugs and Solutions The pipette solution contained 145 mmol/l Cs,20 mmol/l Cl, 2 mmol/l EGTA, 5 mmol/l HEPES, and 130 mmol/l methanesulfonate. The bath solution contained mol/l Na, 4.74 mmol/l K, mmol/l Cl, 2.54 mmol/l Ca 2, and 5 mmol/l HEPES (normal Ringer solution). In certain experiments, Na was replaced with N- methyl-d-glucamine (NMDG) and Ca 2 with manganese. Drugs were purchased from Sigma Chemical Co. (St. Louis, MO). Nifedipine and lidocaine stock solutions were made up in 100% ethanol. The final dilution of alcohol applied was 1:1000. At this concentration, ethanol had no effect on recorded currents. Data Analysis Electrophysiologic data were analyzed using PCLAMP 8 software or custom macros in Excel (Microsoft, Redmond, WA). Voltages were adjusted for the junction potential. The paired Student t test or analysis of variance (ANOVA) with Tukey correction were used to evaluate statistical significance. A P value of 0.05 was considered significant. Values in the text are presented as mean SEM maximal peak inward current values. Results The Fast Component of the Inward Current Is Carried by Sodium At a holding voltage of 100 mv, 2 transient inward components could be identified in most patchclamp recordings from jejunal circular smooth muscle cells (Figure 1). At voltages positive to 0 mv, an outward nonselective cation current was also present (see below). One inward component activated at more negative voltages ( 60 mv) and inactivated rapidly, and the second

3 180 HOLM ET AL. GASTROENTEROLOGY Vol. 122, No. 1 Figure 1. Distribution of transient inward current recorded from human jejunal circular smooth muscle cells at a holding voltage of 100 mv. In 73 of 100 cells studied, 2 components of the inward current were identified (A), a component with faster kinetics of activation and inactivation and a second component with slower kinetics of activation and inactivation carried by Ca 2 through L-type Ca 2 channels. The current voltage relationship of the representative currents shown in A is shown in D, with maximal peak inward current for the 2 components at 30 mv and 10 mv. In 8 of 100 cells, only the faster of the 2 components could be determined definitively. A representative example is shown in B, with initial inward current seen at 60 mv and maximal peak inward current at 30 mv (E). In 19 of 100 cells, only the slower Ca 2 current could be determined definitively. A representative example is shown in C, with initial inward current seen at 50 mv and maximal peak inward current at0mv(f ). The insets show current traces at 30 mv (solid line) and0mv(dashed line) from each of the 3 cells. The outward current seen at positive voltages (e.g., B) is caused by a nonselective cation current activated at voltages positive to 0 mv. inward component activated at more positive voltages ( 40 mv) and had slower inactivation kinetics. Of 100 cells patch-clamped, both components could be clearly identified in 73 cells (73%; Figure 1A), only the fast component could be definitively identified in 8 cells (Figure 1B), and only the slow component could be definitively identified in 19 cells (Figure 1C). All cells patched had the typical spindle shape of smooth muscle cells, and no differences in cell shape or cell capacitance (60 11 pf for the fast component only cells and 56 6 pf for the slow component only cells; P 0.68) were noted between the cell populations. Replacement of Na with NMDG resulted in loss of the fast component of the inward current. Mean maximal peak current of the fast component of the inward current was pa in normal Ringer solution and 0 0 pa (at 30 mv) in normal Ringer solution with NMDG replacing Na (n 14; P ; Figure 2). Replacement of normal Ringer solution with a solution of 74.6 mmol/l NaCl and 74.6 mmol/l NMDG decreased maximal peak inward current by 58% 2% (n 3). Similarly, replacement of Na ions with K ions resulted in loss of the fast component of the transient inward current ( pa in normal Ringer solution and 0 0 pa in Ringer solution with K replacing Na,n 4; P 0.05). Replacement of Ca 2 in the bath with manganese did not change the size of the fast component ( to pa, n 6; P 0.05) but abolished the slower component of the inward current (66 13 to 2 2 pa, n 5; P 0.01). The data therefore suggest that the fast component of the inward current was carried by Na and the slower component by Ca 2. Under the recording conditions used, with cesium in the pipette to block potassium current, a residual outward nonselective cation current was present. The current voltage relationships of the nonselective cation current obtained after block of the Na and Ca 2 currents showed that the current reversed at 0 mv with strong outward rectification at voltages positive to 0 mv and less than 10 pa of current at negative voltages. Therefore, the current at voltages around the expected reversal potentials for Na and Ca 2 currents is largely caused by the nonselective current that dominates the reversal potential, and the reversal potentials of the current voltage relationships reflect predominantly the size of the out-

4 January 2002 SODIUM CHANNEL IN GUT SMOOTH MUSCLE 181 Figure 2. Effect of removal of Na from the bath. (A) Representative current traces obtained using the pulse protocol shown in the inset. Both fast and slower components were present in this cell. (B) Effect of substitution of Na with NMDG on inward currents. (C) Current voltage relationships; the inset shows the mean maximal peak currents for both the fast and slow components in normal Ringer ( ) and in NMDG ( ). Removal of Na resulted in complete loss of the fast component (Na ), with no effect on the slow (Ca 2 ) current (inset, *P ). (D) Normalized mean current voltage relationship obtained from human jejunal circular smooth muscle cells. Currents were recorded either from cells with no discernible Ca 2 current (n 8), in the presence of manganese replacing Ca 2 (n 5), or in the presence of nifedipine (1 mol/l, n 9). Inward Na current was first noted at approximately 60 mv, and maximal peak inward current was seen at 25 mv. ward nonselective current and not the reversal potential of the Na current. To circumvent this, cells were loaded with 50 mmol/l Na and the bath solution changed to 50 mmol/l, 5 mmol/l, and 1 mmol/l Na with NMDG substituting for Na. Under these recording conditions, the equilibrium potential for a selective Na current is 0 mv, 56 mv, and 95 mv. At the last 2 voltages, there is little to no contribution to the whole-cell current by the L-type Ca 2 current and the nonselective cation current. The equilibrium potentials for Ca 2 ( 60 mv) and for a nonselective cation current (0 mv) are well away from the Na equilibrium potential. Instantaneous current voltage relationships were obtained by stepping to 35 mv (maximal peak current for the fast component) for 10 milliseconds and then stepping to a series of voltages from 90 to 60 mv. The reversal potential right after the step from 35 mv reflects the selectivity of the channels carrying the current at 35 mv because at 35 mv the current is dominated by the fast component of the inward current, and channel closure is slower than the close to instantaneous effect of the voltage change. Nifedipine (1 mol/l) was added to the bath to block the L-type Ca 2 current. The reversal potential of the fast component current closely followed the equilibrium potential for Na ( 3 3 mv with 50 mmol/l Na in the bath, 47 2 mv with 5 mmol/l Na in the bath, and 79 3 mv with 1 mmol/l Na in the bath, n 4), suggesting that the channels carrying the whole-cell current were highly sodium selective. The normalized current voltage relationships for the Na current are also shown in Figure 2. Peak current voltage relationships were obtained from cells with only the fast component of the inward current (n 12), with Ca 2 replaced by manganese (n 5), or in the presence of nifedipine (1 mol/l, n 9). Inward Na current was first noted at approximately 60 mv with maximal peak inward current at 25 mv. The Na current was strongly holding voltage-dependent with a decrease in maximal peak inward current of 91% 4% when the holding voltage was changed from 100 to 70 mv ( pa to 14 7pA,n 11; P 0.001). The Ca 2 current decreased by 23% 4% (61 10 pa to 47 9 pa, n 11; P 0.001). Channel Kinetics Whole-cell current traces showed overlap of the Na current with the L-type Ca 2 current at certain voltages. Therefore, analysis of Na current activation kinetics was carried out on cells with no discernible Ca 2 current, and steady-state inactivation kinetics were measured at a step to 40 mv, a voltage at which there is little if any Ca 2 current (see Figure 1). No difference was noted between the kinetic parameters obtained from cells with a Na current and no

5 182 HOLM ET AL. GASTROENTEROLOGY Vol. 122, No. 1 discernible Ca 2 current and the kinetic parameters obtained from cells with both currents with the Ca 2 current blocked by nifedipine (1 mol/l), suggesting that the same Na channel was present and that nifedipine (1 mol/l) adequately separated the 2 current types. At a holding voltage of 100 mv, the Na current activated at 63 1 mv and peaked at 26 2 mv (Figure 3). The V 1/2 and k of activation of the Na current were 47 1 and mv (n 8), respectively (Figure 3). The V 1/2 and k for steady-state inactivation of the Na current were 78 3 and mV(n 7; Figure 3). A window current was present between 75 and 60 mv. Activation times and inactivation times were voltage dependent. Activation times were determined as time to maximal peak inward current. Inactivation times were calculated by a single exponential fit to individual voltage traces. The time to peak current was 14 1 milliseconds at 60 mv (n 21) and milliseconds at 0 mv (n 21; P 0.01), well within the resolvable band width. Activation times were voltage dependent, with a decrease in time to peak at more depolarized voltages. The of inactivation (fit started at peak current) was 12 2 milliseconds at 50 mv and milliseconds at 10 mv (n 7 12; P 0.01). Similar to activation, Figure 3. Steady-state activation and inactivation of the Na current obtained using the pulse protocols shown in the insets. Fits were obtained from the average V 1/2 and slope (k) calculated for each experiment (n 8 for the activation experiments, n 7 for the inactivation experiments). V 1/2 for activation was 47 mv, and k was 4.8. V 1/2 for inactivation was 78 mv, and k was 3.2. A window current was present at voltages from 75 mv to 60 mv. inactivation was voltage dependent with a decrease in at more depolarized voltages. Ca 2 Channel Blockers The effects of nifedipine, an L-type Ca 2 channel blocker, were tested on both the Na and Ca 2 currents. Nifedipine (100 nmol/l) had no effect on the maximal peak Na current (89 18 pa to pa, n 9; P 0.05) but blocked 73% 8% of the maximal peak Ca 2 current (45 7pAto13 4pA,n 7; P 0.01). Nifedipine (1 mol/l, 10 mol/l) blocked 12% 5% and 48% 11% of the maximal peak Na current, respectively (99 26 pa to pa, n 10; pa to pa, n 5; P 0.01) and 88% 6% and 100% 0% of the maximal peak Ca 2 current (68 11 pa to 10 6pA,n 7; pa to 0 0pA,n 3; P 0.01). The effects of nickel, a Ca 2 channel blocker with some selectivity to T-type Ca 2 channels, were also tested on the Na and Ca 2 currents. Nickel (100 mol/l) had no effect on the Na current ( pa before and pa after 100 mol/l nickel, n 10; P 0.05) but blocked 30% 9% of the maximal peak Ca 2 current (55 12 pa before and 35 7 pa after 100 mol/l nickel, n 8; P 0.01). Na Channel Blockers Most Na channels are reversibly blocked by TTx, and most TTx-sensitive Na channels are blocked withak D of 1 5 nmol/l. Some Na channels, including the cardiac isoform, are relatively insensitive to TTx and are known as TTx-insensitive Na channels. The effects of TTx were tested on human jejunal circular smooth muscle cells in the presence of nifedipine (1 mol/l). TTx at 1 nmol/l, 10 nmol/l, and 100 nmol/l had no effect on the Na current (97% 5%, 105% 4%, and 84% 11% of control current, n 5; P 0.05; data not shown). TTx at 1 mol/l and 10 mol/l blocked 30% 7% and 67% 6%, respectively, of the Na current (n 10 for 1 mol/l, n 5 for 10 mol/l; P 0.05), suggesting that the Na channel carrying the Na current in human jejunal circular smooth muscle cells was relatively insensitive to TTx. Lidocaine, a lipid-soluble tertiary amine, blocks Na channels in a voltage- and use-dependent manner. 17 Therefore, the effects of lidocaine on the Na current were assessed. Lidocaine block was assessed by a pulse protocol with an interpulse holding voltage of 100 mv. Twenty pulses to 30 mv for 16 milliseconds were applied at frequencies of 0.5, 5, and 10 Hz in the absence and presence of lidocaine (10 mol/l, 100 mol/l). The 20th pulse was used to determine the effect of lidocaine.

6 January 2002 SODIUM CHANNEL IN GUT SMOOTH MUSCLE 183 Figure 4. Internal and external QX314 blocks the Na current. (A) Block of the Na current by internal QX314 (100 m, E, n 4). The data were fit with a single-order exponential. In contrast, there was no decrease in Na current in control records obtained in the absence of QX314 (, n 3). (B) Effect of external QX314 (500 m, n 4). External QX314 also blocked the Na current. This protocol was used in view of the frequency dependence of lidocaine block. Lidocaine (10 mol/l) blocked Na current in a frequency-dependent manner with a 2% 3% block at 0.5 Hz (compared with control at 0.5 Hz; P 0.05), 11% 4% block at 5 Hz (P 0.08), and 23% 6% block at 10 Hz (P 0.05; all n 4); lidocaine at 100 mol/l caused a 26% 5% block at 0.5 Hz (compared with control at 0.5 Hz, P 0.005), 61% 6% block at 5 Hz (P ) and 82% 6% block at 10 Hz (P ; all n 5). QX314 is a quaternary membrane-impermeant derivative of lidocaine; when applied externally, it has different effects on neuronal and cardiac Na channels Therefore, QX314 was used to further characterize the human jejunal circular smooth muscle Na current. QX314 (100 mol/l), applied inside the pipette, blocked the Na current. Figure 4 shows the maximal peak Na current recorded from single human jejunal circular smooth muscle cells with and without QX314. In the absence of QX314, the magnitude of the maximal peak Na current was unaltered after 30 minutes (n 3, data fit with a first-order linear regression). With QX314 (100 mol/l) in the pipette, the magnitude of the maximal peak Na current decreased by 75% at 30 minutes (n 4, data fit with a first-order exponential). QX314 (100 mol/l) hyperpolarized the membrane potential by 6 2mV(n 4). When applied externally, QX314 does not block nerve-like Na channels but blocks cardiac-like Na channels. External QX314 (500 mol/l) blocked 65% of the peak Na current (n 4, data fit with a first-order linear regression), suggesting that the Na current present in human jejunal circular smooth muscle cells was cardiac-like. The Anemonia sulcata derived toxin ATX II binds to an external site of Na channels and decreases the rate of inactivation. 21 The effects of ATX II (100 mol/l) were tested on the Na current. Before application of ATX II, inactivation kinetics were best fit with a single exponential ( milliseconds at 35 mv, n 5; Figure 5C). After application of ATX II, inactivation kinetics were best fit with double exponential ( milliseconds and milliseconds at 35 mv, n 5; Figure 5C). Constraining the control data to 2 exponentials did not reveal a measurable second exponential. Molecular Biology The genes encoding the subunits (the poreforming subunit) of the voltage-gated Na channels are referred to as SCNA. Of the published SCNA subunit sequences, SCN5A, SCN10A, and SCN11A are TTx insensitive. 1,22 26 Nested PCR using primers designed against human SCN10A and SCN11A did not detect the presence of their cdnas in the human jejunal libraries with appropriate positive controls. Primer sets designed against parts of the published sequence of SCN5A all resulted in bands of the expected size (Figure 6). The sequence fragments obtained showed more than 99% homology with the corresponding portions of the published sequence of human SCN5A (accession number NM000335; Figure 6). Only 1 change was noted in the nucleotide sequence (C to G at position 3111 of accession number NM000335) compared with the published human sequence obtained from the heart. This resulted in substitution of histidine (CAC) to glutamine (CAG; Figure 6). Human jejunal circular smooth muscle cells (approximately 1500) were collected using lasercapture microdissection from 5- m-thick sections of circular muscle stained with an antibody to c-kit to identify and avoid interstitial cells of Cajal. The laser spot size was 7.5 m. Messenger RNA was isolated from the collected cells, and RT-PCR was performed using gene-specific primers designed against SCN5A. Primers were designed to recognize

7 184 HOLM ET AL. GASTROENTEROLOGY Vol. 122, No. 1 Figure 5. Slowing of inactivation by ATX II. (A) Representative recording of Na current obtained from a single smooth muscle using the pulse protocol shown in the inset. The cell was held at 100 mv. (B) Records from the same cell 10 minutes after addition of ATX II (10 mol/l). Inactivation was slowed by ATX II. (C) Results of exponential fits to the inactivation curves (n 5). Control data were best fit with a single exponential with a of milliseconds at 35 mv (ƒ). In contrast, the data obtained in the presence of ATX II were best fit with a double exponential with values of milliseconds and milliseconds at 35 mv (E, ). sequences on either side of intron exon boundaries to exclude the possibility of genomic DNA contamination. A band of the expected size was obtained, and sequencing showed more than 99% homology with the published sequence of human SCN5A (Figure 6). Primers designed to recognize c-kit sequence (expressed on interstitial cells of Cajal) did not result in a band. Figure 6. SCN5A is present in human jejunal smooth muscle cell libraries. (A) cdna bands obtained using PCR with primers designed against portions of the published sequence of SCN5A. (B) The bands were of the expected size for SCN5A, and sequencing of the bands (2 with overlapping sequence) showed 99% homology with the published SCN5A sequence. (C) cdna bands obtained using RT-PCR from messenger RNA isolated from human jejunal circular smooth muscle cells collected by laser-capture microdissection. Bands were the expected size for SCN5A and glyceraldehyde-3-phosphate dehydrogenase (phosphorylating; control), and the products were confirmed by sequencing. No band was seen using c-kit primers.

8 January 2002 SODIUM CHANNEL IN GUT SMOOTH MUSCLE 185 Discussion The data presented in this report suggest that a Na current is present in human jejunal circular smooth muscle cells and that at voltages expected to approximate physiologic membrane potentials, there is steady-state Na entry into the cells. The data supporting the presence of a Na current in human jejunal circular smooth muscle cells include the shift in the reversal potential of current when external Na was changed, loss of current when Na was replaced by NMDG, lack of effect on current of removal of bath Ca 2, blockage of current by lidocaine and the lidocaine derivative QX314, and change in inactivation kinetics evoked by the Anemonia sulcata derived toxin ATX II. Although the finding of a Na current in small intestinal smooth muscle cells was somewhat unexpected, previous reports have suggested that Na channels may be present in gastrointestinal smooth muscle cells. In human and rat circular colonic smooth muscle cells, a Na current was identified in a subset of smooth muscle cells from the ascending colon and less frequently in smooth muscle cells from the descending colon. 27 Unlike the current described in this report, the Na current was blocked by nanomolar concentrations of TTx, unaltered by nifedipine (10 mol/ L). 27 ANa current was also identified in smooth muscle cells from rat fundus 28,29 and rat ileum. 30 The Na current was described as TTx sensitive, but in the rat fundus the Kd for blockade by TTx was 874 nmol/l. 28 Unlike neuronal cells, in which Na channels are required for generation of the action potential, generation of the action potential and initiation of the slow wave in gastrointestinal smooth muscle do not appear to be dependent on Na influx through Na channels. 4 6 In murine colonic muscle strips, removal of Na from the bath decreases amplitude and duration of the slow wave recorded from smooth muscle cells with little change in the frequency. Therefore, Na is not an absolute requirement for initiation of the pacemaker signal, which originates in interstitial cells of Cajal. The amplitude and duration of the smooth muscle slow wave determine if the threshold for initiation of contraction is crossed via activation of L-type Ca 2 channels or firing of aca 2 -dependent action potential. Therefore TTx-insensitive Na channels may play a role in the regulation of smooth muscle contraction by affecting the membrane potential, amplitude, or duration of the slow wave. Most cells maintain an intracellular Na concentration of mmol/l. Na drives the Na /K pump and the Ca 2 /Na exchanger. The Na channel reported here may serve as a pathway for Na to enter the cell and maintain intracellular Na concentration. A change in intracellular Na will change the driving force for Na, altering the rate of movement of ions by the Na /K pump and the Na /Ca 2 exchanger. The latter may change intracellular Ca 2 concentration, affecting many Ca 2 -dependent mechanisms. Three TTx-insensitive Na channel subunits have been described to date 1 : SCN5A, SCN10A, and SCN11A. SCN5A message was detected in libraries constructed from dissociated human jejunal circular smooth muscle cells and from smooth muscle cells picked by lasercapture microdissection but not SCN10A and SCN11A messages. The electrophysiologic and pharmacologic properties of the Na current described in this report and SCN5A expressed in oocytes are similar. Both are TTx insensitive, and both have similar values for inactivation ( 3 milliseconds at 10 mv) and similar V 1/2 values of inactivation ( 70 mv), and both are blocked similarly with lidocaine ( 75% block at 10 Hz, 100 mol/l), suggesting the possibility that the subunit of the Na channel carrying the Na current in human jejunal circular smooth muscle cells may be SCN5A. The data obtained from the use of QX314, a quaternary lidocaine derivative, also suggest similarities between the Na current studied in this report and cardiac Na channels. Several studies have shown that lidocaine derivatives such as QX314 block Na channels from inside and that QX314 does not block nerve and skeletal muscle Na channels when applied externally The Na channel studied in this report was blocked by external QX314, similar to native fast cardiac channel and the expressed (in oocytes) SCN5A subunit. The mechanism of action of external QX314 appears to be by permeation through the Na channel pore rather than by nonselective permeation because the external QX314 effect is blocked by toxins that alter pore permeability. The data obtained in the report also favor direct permeation through the pore as the degree of block by external QX314 appeared to be directly proportional to the number of depolarizing pulse protocols, with an increasing rate of blocking with an increase in the frequency of pulse protocols (data not shown). Dissociated smooth muscle cells were collected to prepare the libraries used in this report to minimize contamination of the libraries with other cell types. However, other cell types, such as interstitial cells of Cajal, are present in preparations of dissociated human jejunal circular smooth muscle cells. However, the sum of the data reported here strongly suggest that the subunit of the Na channel present in human jejunal circular smooth muscle is SCN5A. The current activation and inactivation kinetics most closely match the

9 186 HOLM ET AL. GASTROENTEROLOGY Vol. 122, No. 1 published SCN5A kinetics. The human jejunal circular smooth muscle Na current is relatively resistant to TTx, requiring 10 mol/l for blocking; of the 3 known TTx-insensitive subunits, only the message for SCN5A was detected in the human jejunal libraries. Similar to the cardiac (SCN5A) current, but not in neuronal Na currents, external QX 314 blocked the human jejunal circular smooth muscle current. Finally, the message for SCN5A was identified in smooth muscle cells picked by laser-capture microdissection. SCN5A is known as the cardiac Na channel (NaH1, rnaskm2) gene because it codes for the subunit of the Na channel thought to be the major entry pathway for inward Na current in cardiac myocytes. 24 SCN5A message has also been identified in neurons in the deep layers of the frontal cortex and within subcortical limbic circuitry. 31 In both heart and brain, mutations in SCN5A have been reported to result in clinically evident electrical dysrhythmias. In the heart, mutations in SCN5A result in LQT3 syndrome, Brugada syndrome, and Lenegre or Lev disease Because our report is the first to describe the presence of SCN5A message in the human gastrointestinal tract, no information is available on the possible role of mutations in SCN5A in the pathophysiology of human gut dysmotilities. In summary, a TTx-insensitive Na current is present in normal human jejunal circular smooth muscle cells. There appears to be steady-state Na influx through Na channels at voltages in the range of the resting membrane potential. The cdna sequence for SCN5A was present in libraries constructed from dissociated normal human jejunal circular smooth muscle cells and from smooth muscle cells collected by laser-capture microdissection, and the electrophysiologic and pharmacologic properties of the Na current observed in human jejunal circular smooth muscle cells were similar to those of SCN5A expressed in oocytes. Whether SCN5A plays a role in the pathophysiology of human gut dysmotilities remains to be determined. References 1. Brammer WJ. Voltage-gated sodium channels. In: Conley EC, Brammar WJ, eds. The ion channel facts book IV. Voltage-gated channels; San Diego, CA: Academic, 1996: Catterall WA. Molecular properties of sodium and calcium channels. J Bioenerg Biomembr 1996;28: Marban E, Yamagishi T, Tomaselli GF. Structure and function of voltage-gated sodium channels. J Physiol (Lond) 1998;508: Huizinga JD, Barajas-Lopez C. Ionic and cellular basis for slow wave-type and spike-like action potentials. In: Sperelakis N, Wood JD, eds. Frontiers in smooth muscle research. New York, NY: Wiley-Liss, 1990: Mikkelsen HB, Malysz J, Huizinga JD, Thuneberg L. Action potential generation, Kit receptor immunohistochemistry and morphology of steel-dickie (Sl/Sld) mutant mouse small intestine. Neurogastroenterol Motil 1998;10: Sanders KM, Ward SM. Electrical rhythmicity in gastrointestinal muscles. In: Bolton T, ed. Smooth muscle excitation. San Diego, CA: Academic, 1996: Ward SM, Burns AJ, Torihashi S, Sanders KM. Mutation of the proto-oncogene c-kit blocks development of interstitial cells and electrical rhythmicity in murine intestine. J Physiol 1994;480: Huizinga JD, Thuneberg L, Kluppel M, Malysz J, Mikkelsen HB, Bernstein A. W/kit gene required for interstitial cells of Cajal and for intestinal pacemaker activity. Nature 1995;373: Thomsen L, Robinson TL, Lee JC, Farraway LA, Hughes MJ, Andrews DW, Huizinga JD. Interstitial cells of Cajal generate a rhythmic pacemaker current. Nat Med 1998;4: Farrugia G, Holm AN, Rich A, Sarr MG, Szurszewski JH, Rae JL. A mechanosensitive calcium channel in human intestinal smooth muscle cells. Gastroenterology 1999;117: Farrugia G, Rae JL, Sarr MG, Szurszewski JH. Potassium current in circular smooth muscle of human jejunum activated by fenamates. Am J Physiol 1993;265:G873 G Farrugia G, Rae JL, Szurszewski JH. Characterization of an outward potassium current in canine jejunal circular smooth muscle and its activation by fenamates. J Physiol (Lond) 1993;468: Rae J, Cooper K, Gates P, Watsky M. Low access resistance perforated patch recordings using amphotericin B. J Neurosci Methods 1991;37: Shepard AR, Rae JL. Ion transporters and receptors in cdna libraries from lens and cornea epithelia. Curr Eye Res 1998;17: Gubler U, Hoffman BJ. A simple and very efficient method for generating cdna libraries. Gene 1983;25: Rothstein JL, Johnson D, Jessee J, Skowronski J, Deloia JA, Solter D, Knowles BB. Construction of primary and subtracted cdna libraries from early embryos. Methods Enzymol 1993;225: Hille B. Mechanisms of block. In: Hille B (ed). Ionic channel of excitable membranes. Sunderland, MA: Sinauer, 1992: Butterworth J, Cole L, Marlow G. Inhibition of brain cell excitability by lidocaine, QX314, and tetrodotoxin: a mechanism for analgesia from infused local anesthetics? Acta Anaesthesiol Scand 1993;37: Frazier DT, Narahashi T, Yamada M. The site of action and active form of local anesthetics. II. Experiments with quaternary compounds. J Pharmacol Exp Ther 1970;171: Strichartz GR. The inhibition of sodium currents in myelinated nerve by quaternary derivatives of lidocaine. J Gen Physiol 1973; 62: Bergman C, Dubois JM, Rojas E, Rathmayer W. Decreased rate of sodium conductance inactivation in the node of Ranvier induced by a polypeptide toxin from sea anemone. Biochim Biophys Acta 1976;455: Dib-Hajj SD, Tyrrell L, Cummins TR, Black JA, Wood PM, Waxman SG. Two tetrodotoxin-resistant sodium channels in human dorsal root ganglion neurons. FEBS Lett 1999;462: Dib-Hajj SD, Tyrrell L, Escayg A, Wood PM, Meisler MH, Waxman SG. Coding sequence, genomic organization, and conserved chromosomal localization of the mouse gene Scn11a encoding the sodium channel NaN. Genomics 1999;59: Gellens ME, George AL Jr, Chen LQ, Chahine M, Horn R, Barchi RL, Kallen RG. Primary structure and functional expression of the human cardiac tetrodotoxin-insensitive voltage-dependent sodium channel. Proc Natl Acad Sci U S A 1992;89: Rabert DK, Koch BD, Ilnicka M, Obernolte RA, Naylor SL, Herman RC, Eglen RM, Hunter JC, Sangameswaran L. A tetrodotoxin-

10 January 2002 SODIUM CHANNEL IN GUT SMOOTH MUSCLE 187 resistant voltage-gated sodium channel from human dorsal root ganglia, hpn3/scn10a. Pain 1998;78: Souslova VA, Fox M, Wood JN, Akopian AN. Cloning and characterization of a mouse sensory neuron tetrodotoxin-resistant voltage-gated sodium channel gene, Scn10a. Genomics 1997;41: Xiong Z, Sperelakis N, Noffsinger A, Fenoglio-Preiser C. Fast Na current in circular smooth muscle cells of the large intestine. Pflugers Arch 1993;423: Muraki K, Imaizumi Y, Watanabe M. Sodium currents in smooth muscle cells freshly isolated from stomach fundus of the rat and ureter of the guinea-pig. J Physiol (Lond) 1991;442: Yamamoto Y, Fukuta H, Suzuki H. Blockade of sodium channels by divalent cations in rat gastric smooth muscle. Jpn J Physiol 1993;43: Smirnov SV, Zholos AV, Shuba MF. Potential-dependent inward currents in single isolated smooth muscle cells of the rat ileum. J Physiol (Lond) 1992;454: Hartmann HA, Colom LV, Sutherland ML, Noebels JL. Selective localization of cardiac SCN5A sodium channels in limbic regions of rat brain. Nat Neurosci 1999;2: Brugada P, Brugada J. Right bundle branch block, persistent ST segment elevation and sudden cardiac death: a distinct clinical and electrocardiographic syndrome. A multicenter report. J Am Coll Cardiol 1992;20: Gussak I, Antzelevitch C, Bjerregaard P, Towbin JA, Chaitman BR. The Brugada syndrome: clinical, electrophysiologic and genetic aspects. J Am Coll Cardiol 1999;33: Lenegre J. Etiology and pathology of bilateral bundle branch block in relation to complete heart block. Prog Cardiovasc Dis 1964; 6: Lev M, Kinare SG, Pick A. The pathogenesis of atrioventricular block in coronary disease. Circulation 1970;42: Schott JJ, Alshinawi C, Kyndt F, Probst V, Hoorntje TM, Hulsbeek M, Wilde AA, Escande D, Mannens MM, Le Marec H. Cardiac conduction defects associate with mutations in SCN5A. Nat Genet 1999;23: Received April 12, Accepted September 17, Address requests for reprints to: Gianrico Farrugia, M.D., Guggenheim 8, Enteric NeuroScience Program, Division of Gastroenterology and Hepatology, Mayo Clinic and Mayo Foundation, 200 First Street, SW, Rochester, Minnesota farrugia.gianrico@mayo.edu. This work was supported by National Institutes of Heath grants DK52766, 57061, 17238, 39337, and EY The authors thank Gary Stoltz for providing technical assistance, Kristy Zodrow for providing secretarial assistance, and Jerry Dewey, Sara Braun, Cheryl Bernard, and Joan Rae for performing the molecular biology.