salina under salinity

Transcription

1 International Journal of Biosciences IJB ISSN: (Print), (Online) Vol. 6, No. 7, p , 2015 RESEARCH PAPER OPEN ACCESS The psy transcript level and cell composition of Dunaliella salina under salinity Leila Zarandi Miandoab 1,3*, Mohammad Bager Bagherieh-Najjar 1, Mohammad Amin Hejazi 2, Nader Chaparzadeh 3 1 Department of Biology, Faculty of Sciences, Golestan University, Gorgan, Iran 2 Agricultural Biotechnology Research Institute of Iran, Northwest and West Region, Tabriz, Iran 3 Department of Biology, Azarbaijan Shahid Madani University, Tabriz, Iran Key words: Dunaliella salina, Salinity, Glycerol, β-carotene, psy gene expression. Article published on April 10, 2015 Abstract Dunaliella salina is a unicellular photosynthetic microalga that demonstrates a considerable degree of environmental adaptation to difficult conditions. Under abiotic stress conditions, such as salinity, the cells accumulate specific compounds, including carotenoids and/or glycerol, as a result of up regulation in certain genes as well as biosynthetic pathways. The final output of these changes manifests in resistance against hyper saline conditions. In the present study, we aimed to identify important compounds produced and accumulated in D. salina cell in resistance to salinity stress. D. salina CCAP 19/18 cells cultured under 2 or 4 M NaCl, while light intensity, temperature and nutrient supply were in optimal amounts for algal growth. Data show that, there were lower number of cells and protein content while lipid, glycerol and starch contents significantly increased in cells exposed to 4 M salinity. Interestingly, there were negative correlation between glycerol concentration and the amount of starch in the cells suggesting that the starch breakdown provides precursors of glycerol biosynthesis. Main nutrient uptake by cells in 2 M culture medium was higher than that in 4 M NaCl, leaded to higher amount of proteins in low salinity cultured cells. Unlike glycerol, accumulation of carotenoids was not observed under high salinity. Data indicated that reduced levels of psy transcript repressed carotenoid (β-carotene) production under 4 M NaCl after 4 day. This study strongly suggests that salinity level of medium can affect nutrient uptake and metabolites accumulation of D. salina cells. Molecular and biochemical changes are occurring for adapting cell to new conditions. For rapid and short term overcoming high salinity condition, D. salina cells allocate most of photo-assimilated carbon to the glycerol. * Corresponding Author: Leila Zarandi Miandoab zarandi@azaruniv.ac.ir 34 Miandoab et al.

2 Introduction Salinity is one of the most significant abiotic stresses and influence plant cell physiology and biochemical composition. The algae of the genus Dunaliella that can survive under high salinity conditions (Narváez- Zapata et al., 2011) are most famous and simple eukaryotic organisms for understanding mechanisms of adaptation to salinity. D. salina is a unicellular green alga that is motile and has not a rigid polysaccharide cell wall. The cell enclosed by a thin elastic membrane that permits rapid changes in cell volume in response to hypertonic changes. The extreme hypotonic conditions cause it to burst (Ben- Amotz and Avron, 1981). Over production of glycerol and β-carotene are most general responses of D. salina when cells exposed to high salinity (Ben-Amotz and Avron, 1981). The glycerol is the responsible solute for intracellular osmotic adjustment under high salinity which protects enzymes against both inactivation and inhibition (Hosseini Tafreshi and Shariati, 2009). Also, the alga accumulates massive amount of β-carotene to prevent photosynthetic apparatus when culture conditions include high light intensities, high temperature, high salinity and deficiency of nutrient (Hosseini Tafreshi and Shariati, 2009). Nowadays, we know that D. salina is one of the best commercial sources of glycerol (Ben-Amotz and Avron, 1981) and natural β- carotene (Borowitzka, 1999). The literature mentioned that rapid production of glycerol related to starch metabolism (Ben-Amotz and Avron, 1981) and overproduction of β-carotene related to up regulation of carotenoid biosynthesis pathway genes such as phytoene synthase (Sánchez-Estudillo et al., 2006; Coesel et al., 2008).The enzyme phytoene synthase coded by the psy gene and is considered the first regulatory step in carotenogenesis, which culminates during β-carotene formation (Sánchez-Estudillo et al., 2006). Protein and lipid biosynthesis in cells is quite sensitive to damage caused by salinity, leading to a clear reduction in cell growth and division (Hu 2004). Medium salinity also affects nutrient absorption and assimilation in cells, which are important for growth (Grattan and Grieve, 1992; Grobbelaar, 2004). In spite of growing body of evidence about D. salina behavior under different levels of salinity, adaptation method under proper condition for photosynthesis is almost unclear yet. Thus, the present investigation is an attempt to understand the role of main metabolites in creating tolerance to high salinity (2 and 4 M NaCl) in D. salina cells. Salinity effects on growth rate as well as the relationship between β-carotene content and psy gene expression was studied to better understand the molecular basis of stress-induced pigment accumulation. Moreover, lipids, proteins, glycerol and starch contents of cells and nutrient (nitrate and phosphate) removed from the culture medium were measured. Materials and methods Microorganism and treatments: Microalgae of D. salina CCAP 19/18 was obtained from [ABRII NW] (Tabriz). The modified Johnson medium was used for cells grown (Hejazi and Wijffels, 2003). In order to avoid precipitation of certain compounds, all stock solutions were sterilized separately and pooled aseptically. Cultures took place under 600 µmol photon m -2 s -1, 30 C and 275 ppm nitrate and 58 ppm phosphate concentration according to D. salina needs for optimum growth (Hejazi and Wijffels, 2003). Medium salinity was adjusted to 2 or 4 M NaCl. All experiments were performed with 3 replicates in a 2-week growth period. Microalgae cells were grown in 250 ml Erlenmeyer flasks, containing 150 ml of fresh medium with constant shaking at 120 rpm. Cell number determining: Cells were immobilized and stained by addition of 10µl of Lugol s solution (1 gr iodine and 0.5 gr potassium iodide in 100 ml distilled water) to 190 µl aliquots of the algal cultures. Then the cells were counted using a 1 mm deep counting chamber and a light microscope (magnification 10) according to Hejazi and Wijffels (2003). 35 Miandoab et al.

3 Pigment concentration and gene expression analysis: Pigments extracted from algal pellets in 80% acetone after removal of cell debris by centrifugation at 8000 rpm for 5 min. Supernatant absorbance was measured at 412, 431, 460 and 480 nm with a spectrophotometer according to Eijckelhoff and Dekker (1997) and β-carotene content (Cc= µg/ml β- carotene) calculated using the following formula. Final data of β-carotene content present by pg/cell. Cc= A A A A480 RNA was extracted using RNXplus reagents (CinaGen) according to the manufacturer's instructions. Quality of total RNA was checked by visual measurements and spectrophotometry. Quantification of total RNA was calculated using absorption in 260 nm. Samples containing (5-10 µg) of RNA were used for complementary DNA (cdna) synthesis, using 2-steps RT-PCR kit (vivantis) according to the manufacturer's instructions. The primers of nucleotides in length were designed using the Primer 3 web based software. Quantitative real time reverse transcription polymerase chain reaction (qrt-pcr) analysis was performed with a CFX instrument (Bio Rad) using the Quanti-Tect SYBR Green PCR kit (ABI). All quantifications were normalized to the amount of 18S rrna as internal standard by the Livak method (2 - ΔΔCT ) (Livak and Schmittgen, 2001). All reactions were set up in duplicates for each sub replicate. The sequences and other properties of the primers are listed in Table 1. The following standard thermal profiles were used for the PCR reactions: Initial denaturation: 94 C for 10 min, (Denaturation: 94 C for 1min, Annealing: 64 C for 30 sec. and Elongation: 72 C for 15 sec) 50, final extension: 72 C for 10 min. Measurement of glycerol, starch, proteins and lipids: Glycerol concentration was determined according to Chitlaru and Pick (1989). In this method, for 200 µl of the cell culture medium 1 ml of periodate reagent (65 mg NaIO4, 10 ml acetic acid, and 7.7 gr ammonium acetate) was added, and 2.5 ml of acetylacetone reagent (2.5 ml acetylacetone, ml isopropanol) were added and mixed. The samples were incubated at 45ᵒC for 20 min. Optical density was determined at 410 nm and compared to calibration standards. Total Carbohydrates were analyzed according to the phenol sulfuric acid method (Dubois et al., 1956). According this method two ml of 1 N HCl was added to cells. The mixture was boiled for 20 min, cooled, and centrifuged (5 min, 2000 rpm). Then, 0.5 ml of samples was mixed with 0.5 ml of 5% phenol; 2.5 ml of H2SO4 and the optical density was determined at 488 nm and compared with calibration standards. Then soluble carbohydrates measured using disrupted cells. Because D.salina has no cellulose, non-soluble carbohydrates (starch) content calculated using difference of total and soluble carbohydrates and represented in µg per 10 6 cells. Total proteins content was measured according to the Bradford method (1976). 1 ml algal culture medium cells separated from the supernatant by centrifugation at 5000 rpm for 5 min. and cells were destroyed by putting in deionized ice cold water. Then Bradford reagent containing l00 mg Coomassie Brilliant Blue G- 250 dissolved in 50 ml 95% v/v ethanol, added and absorbance of mixture in 595 nm was used for final calculation (µg per 10 6 cells) using standard curve. Total lipids were measured by an optimized gravimetric method using petroleum benzene. Algal plates were dried in oven (70 C) and shacked overnight in petroleum benzene. After removing the organic solvent by putting in room temperature, the lipid content was calculated and reported in percent of dry weight. Measurement of nitrate and phosphate concentrations: Culture medium nitrate and phosphate concentrations were determined according to standard methods for the examination of water and wastewater (Eaton et al., 2005). For culture medium nitrate monitoring, 5 ml of culture medium sample was filtered. Then 200μl Al(OH)3 was added and mixed. After 5 min sample filtered again and 1 ml HCl 1 N was added and total volume was adjusted to 50 ml by distilled water. The 36 Miandoab et al.

4 supernatant absorbance was measured at 220 and 275 nm with a spectrophotometer (Perkin Elmer precisely- Lambda 35-UV/Vis spectrometer). The culture medium nitrate concentration was calculated using standard curve at ppm unit. For calculation of phosphate concentration, 2 ml of culture medium was filtered. Then one drop of H2SO4 added. Then 1.6 ml ascorbic acid reagent was added and the sample volume was adjusted to 10 ml. After 10 min the absorbance at 880 nm was determined and the final culture medium phosphate concentration was calculated using standard curve at ppm unit. Statistical Analysis: All experiments were done in 3 replicates and data were shown in mean ± SE. Mean values and significance (at p 0.05) were determined by using SPSS 16.0 software. Analysis of variance was applied to the data to evaluate the salinity effect on each individual parameter. Results Effect of salinity on cell number and growth: Direct cell counting results are demonstrated in Fig.1. Salinity at 4 M NaCl decreased the cell number in D. salina in comparison with 2 M NaCl treatment on 14 th day. With respect of data illustrated in Fig. 1, it is clear that cell number in low salinity is almost 3 times more than cell number in high salinity. In Table 2, the statistical analysis of variance, demonstrated F and p value for each measured parameter. ANOVA data showed significant effect of salinity on the cell numbers. Table 1. Properties of selected primers used in experiment. Gene Coding RNA/ protein Ac.no Primer sequence 18S 18S rrna EF F TGCATGGCCGTTCTTAGTTG 18S 18S rrna R ATTTAGCAGGCTGAGGTCTCG psy phytoene synthase AY F ACTTCCAGGAGGCTGAGGATG psy phytoene synthase R AGATGAGCGCAGACCACAC Analysis of variance (ANOVA) for evaluated parameters of D. salina cells exposure to different levels of salinity demonstrates in Table 2. Significant variables p value marked with an asterisk (*) for identification. Effect of salinity on β-carotene and its related gene psy transcript level: β-carotene content was calculated in the end of the experiment (14 th day). The result illustrated in Fig. 2 shows non-significant change between treatments under different salinity. Also ANOVA data (Table 2) confirm this statistic output. To analyze the reason behind the approximately stable metabolism of β-carotene (non-significant reduction), transcript level of the most effective gene in carotenogenesis pathway (psy) was investigated during 4 days after salinity treatment. The results presented in Fig. 3 show that at 2 M NaCl, the psy transcript level was 2.5-fold increased on the first day of the treatment and slightly reduced to 1.5-fold on the 4 th day of the treatment. However, at 4 m NaCl, no increase in the transcript level of the psy gene was observed on the first day, instead a steady decrease of the psy transcript level was observed from the beginning of the treatment towards the end (Fig. 3). Effect of salinity on glycerol metabolism: The level of glycerol was measured in a time course manner during 14 days. At 2 M NaCl the concentration of glycerol decreased to half of its initial value after 7 days of treatment. Whereas, at 4 M NaCl, a 5-fold change in the glycerol concentrations was observed on the first day of the treatment, which even increased to almost 6-fold on the 7th day (Fig. 4 A). Fig. 4 B shows the starch content changes in D. salina over 14 day of the treatment. At both concentrations of NaCl treatment, after a slight decrease of the starch 37 Miandoab et al.

5 content of the cells in the first day of the experiment, a clear general increased was observed afterwards. This increase was more obvious in 4M NaCl after 14 days. Effect of salinity on total protein and lipid: The results presented in Fig. 5 illustrate total protein and lipid contents of the cells two weeks post treatment, indication that the protein content of the cells was decreased by increasing NaCl concentration. However, the lipid concentration was almost two-fold increased by salinity stress (Fig 5). Table 2. Analysis of variance (ANOVA) for evaluated parameters of D. salina. Significant variable p value marked with an asterisk (*) for identification. Source Dependent Variable SS DF MS F Value p Value NaCl Cell number 2.11E E * β-carotene Starch * Protein * Lipid * N culture medium E * P culture medium * Error Cell number 5.47E E+11 β-carotene Starch Protein Lipid N culture medium P culture medium Total Cell number 1.19E+14 6 β-carotene Starch Protein Lipid N culture medium P culture medium Effect of salinity on nutrient removed from media: Nitrate and phosphate concentrations were adequate in all treatments at the beginning of the experiment (nitrate = 275 ppm and phosphate = 58 ppm). At various time points, the concentration of nitrate and phosphate present in the medium was measured and depicted in Fig. 6 A and B. These data indicate that the ability of algal cell in absorption of both nitrate as well as phosphate was decreased by NaCl stress. Apparently cells in high salinity condition were not able to absorb any phosphate (Fig. 6 B). ANOVA data (Table 2) confirm significant effect of salinity on culture medium nitrate and phosphate concentration. Discussion Recent evidences suggest that all photosynthetic organisms respond to environmental stress in essentially the same way by displaying slow growth rates and a reduced ability to acquire resources (Cowan et al., 1992). These observations have led to the proposed 'centralized system of physiological response' to stress that involves integrating changes in physiological and biochemical balances of plants (photosynthetic organisms) (Cowan et al., 1992). Thus flux redistributions that occur in metabolism during adverse conditions should be considered a complex function of the sensitivity coefficients of all metabolic steps. To date, plenty of studies have focused on the response of plants to specific stresses and, as yet, no single system has been defined in which, we are able to study responses that can be triggered by a diverse range of stresses. 38 Miandoab et al.

6 Fig. 1. Effect of salinity on D. salina cell numbers at 14 th day. Data are shown as mean ± SE, n=3. Fig. 3. Effect of salinity on relative psy mrna levels of D. salina cells over 4 days of salinity treatment. Data are shown as mean ± SE, n=3. Fig. 2. Effect of salinity on β-carotene content of D. salina cells at 14 th day. Data are shown as mean ± SE, n=3. In all photosynthetic (plant or alga) cells, salinity can lead to a rapid increase in some physiological solutes concentration to adjust osmotic fluctuations in the medium. Glycerol is the most important compatible solute in D. salina. The halo tolerant D. salina responds to osmotic stress by regulating the flux of carbon between synthesis of starch in the chloroplast and production of glycerol in the cytoplasm (Cowan et al., 1992). Our data show that, the increase in salinity was accompanied by a significant decline in starch contents at the first day. These results are according to finding by Cowan (1992); who recognized constant growth inhibition (the number of cells) in high salinity followed by increasing glycerol, despite of reduction in starch contents. Finally in 14 th day starch concentration in 4 M NaCl treatment was higher than 2 M NaCl treatment. It seems likely that adaptation to salinity after 1 week stress and reduced division rate are the reason of high accumulation of starch in D. salina cells. A well-documented fact is that under hyper saline conditions, glycerol maintains protein structures and membrane integrity doing functions in the cytoplasm as a compatible osmotic solute (Ben-Amotz and Avron, 1981; Jiménez and Niell, 1991; Cowan et al., 1992; Hosseini Tafreshi and Shariati, 2009). Under high salinity, Dunaliella cells can accumulate glycerol up to 50% or β-carotene up to 14% of its dry weight (Hosseini Tafreshi and Shariati, 2009). Synthesis (under hypertonic conditions) or elimination (under hypotonic conditions) of glycerol begins minutes after the transition. The contribution of products of starch breakdown to glycerol synthesis increased progressively with increasing salt stress (Tammam et al., 2011). During transition from hypertonic to hypotonic condition, the reconversion of glycerol to starch can be occurring thereby restoring the osmotic equilibrium. As mentioned above, characteristic response of D. salina to salinity is the adjustment of the intracellular concentration of glycerol by regulation of carbon flux between starch and glycerol production in the different compartments. Glycerol synthesis under hyper saline conditions and glycerol elimination under hypo saline conditions are independent of protein synthesis and occurs in the light or dark (Ben-Amotz and Avron, 1981; Cowan et al., 1992). The flux of carbon between starch production in the chloroplast, synthesis of glycerol in the cytoplasm and accumulation of proteins and lipids are some of the important physiological responses under stress conditions (Raja et al., 2007). 39 Miandoab et al.

7 Under high salinity, lower growth associated with low protein content and reduced ability of nutrients, nitrate and phosphate, absorption from medium, may be due to the fact that, organism diverts some of the protein from growth state to osmoregulation state. We can say that the efficient uptake of nutrient from media directly improve protein content, cell growth and division rate in low salinity condition. Salinity level changes protein quantity and quality (Fisher et al., 1994; Golldack et al., 1995; Khalil et al., 2010; Ördög et al., 2012). These results are consonant with the findings by Mishra et al (Mishra et al., 2008). The cells ability in nitrate and phosphate absorption and assimilation can affects protein concentration. As well as salinity also have roles in determining lipid accumulation. Increasing salinity reduces lipid content in diatoms (Chaffin et al., 2012). Fig. 4. Effect of salinity on glycerol and starch contents of D. salina cells over 14 days. Data are shown as mean ± SE, n=3. Fig. 5. Effect of salinity on protein and lipid contents of D. salina cells at 14 th day. Data are shown as mean ± SE, n=3. Although, salinity level significantly affects cells growth and lipid formation, the lipids are acting as secondary metabolite for algae, and so, salinity leads to the accumulation of more lipids (Hu 2004). Here, we can conclude that increasing the lipid content in D. salina is a strategy for survival under severs conditions. In this way lipids acting as a storage reserve energy material till favorable conditions arise. Monitoring of main enzyme involved in β-carotene biosynthesis (phytoene synthase) gene expression showed higher transcription under low salinity at the first day. But, we noticed that this increasing in mrna level lead to a slight increase in β-carotene content. Notwithstanding, this amount of increasing was not significant at p>0/05. Interestingly, gene transcription repression leads to β-carotene content decrease under high salinity. Other side, β-carotene concentration in 2 M NaCl was slightly higher than 4 M NaCl, while ANOVA data showed that salinity effect on β-carotene concentration was not significant. Thus, β-carotene production or accumulation was not responsible for halotolerance of D. salina exposed to NaCl in this experiment. These results are consistent with finding by Kim et al. (2010), who identified down regulated genes number is larger than up regulated genes under high salinity (Kim et al., 2010). Similarly, our study confirmed Sanchez-Estudillo et al. (2006) report that declared possibility of reduction in psy transcript level under certain condition such as nitrogen availability (Sánchez-Estudillo et al., 2006). In addition, our 40 Miandoab et al.

8 results suggest that despite of psy expression importance in carotenoid biosynthesis pathway, final product concentration may relate to other factors such as enzyme activity. Also, salinity could repress psy gene expression. But a few studies describe whether primary stress for example high salinity is responsible in gene expression repression or secondary stress such as reactive oxygen species production. Fig. 6. Effect of salinity on nitrate and phosphate concentration in culture medium of D. salina cells at 14 th day. Data are shown as mean ± SE, n=3. environmental conditions but in unfavorable conditions carbohydrate can reach to 80% (Hu 2004). With regard to this fact, it could be concluded that accumulation of storage organic material and reduced protein may be the main reason for low cell division and growth under high salinity. Furthermore, the enhanced cell number in low salinity could be related to the main nutrients absorption from medium. Fig. 7. Effect of salinity on main metabolites percent in D. salina cells when grown in 2 M or 4 M salinity. The relationship between glycerol, starch and β- carotene production, psy gene expression, protein biosynthesis, nutrient uptake from medium, accumulation percent of storage and cell number under high salinity during the 14 day experiment in D. salina are complex. Fig 7 presents relationship between main metabolites percentages in 2 or 4 M NaCl treatments. The salinity of 4 M NaCl leads to decrease in protein and increase in lipid and starch contents percentage. In Chlorella sp., Botryococcus braunii, and D. salina, which are all classified under Chlorophyceae, Volvocales, show the typical biochemical composition: 30-50% proteins, 20-40% carbohydrate and 8-15% of lipids under favorable Conclusion In summary, it seems clear that molecular and biochemical changes are occurring for adapting D. salina cells to new conditions. This work demonstrates that, the mechanisms of salt tolerance are related to fast production of glycerol using isolated monomers from starch. But in respect of psy expression results, unfortunately we cannot say enhanced levels of psy transcripts lead to production and accumulation of β-carotene under low salinity. Also, nitrate and phosphate collects and usage in protein biosynthesis affected by high salinity. Under high salinity, photosynthetic carbon channeled to the synthesis and accumulation of some storage materials such as lipids and starch that, in the low nitrogen, cannot be utilized to make amino acids and hence, proteins. This study suggests that, changes in main organic molecules finally lead to survive in difficult 41 Miandoab et al.

9 high salinity condition, although cell numbers were lower than favorable low salinity condition. References Ben-Amotz A, Avron M Glycerol and ß- carotene metabolism in the halotolerant alga Dunaliella: a model system for biosolar energy conversion. Trends in Biochemical Sciences 6, Borowitzka MA Commercial production of microalgae: ponds, tanks, tubes and fermenters. Journal of Biotechnology 70, Bradford MM A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry 72, Chaffin JD, Mishra S, Kuhaneck RM, Heckathorn SA, Bridgeman TB Environmental controls on growth and lipid content for the freshwater diatom, Fragilaria capucina: a candidate for biofuel production. Journal of Applied Phycology 24, /s x Cowan A, Rose P, Horne L Dunaliella salina: a model system for studying the response of plant cells to stress. Journal of experimental botany 43, /jxb/ Dubois M, Gilles KA, Hamilton JK, Rebers P, Smith F Colorimetric method for determination of sugars and related substances. Analytical chemistry 28, Eaton AD, Clesceri LS, Greenberg AE Standard methods for the examination of water and wastewater American Public Health Association. Washington, DC: Eijckelhoff C, Dekker JP A routine method to determine the chlorophyll a, pheophytin a and β- carotene contents of isolated Photosystem II reaction center complexes. Photosynthesis research 52, Fisher M, Pick U, Zamir A A salt-induced 60-kilodalton plasma membrane protein plays a potential role in the extreme halotolerance of the alga Dunaliella. Plant physiology 106, Chitlaru E, Pick U Selection and characterization of Dunaliella salina mutants defective in haloadaptation. Plant physiology 91, Golldack D, Dietz KJ, Gimmleri H The Effects of Sudden Salt stress on Protein Synthesis in the Green Alga Dunaliella parva. Journal of plant physiology 146, /S (11)82016-X Coesel SN, Baumgartner AC, Teles LM, Ramos AA, Henriques NM, Cancela L, Varela JC Nutrient limitation is the main regulatory factor for carotenoid accumulation and for Psy and Pds steady state transcript levels in Dunaliella salina (Chlorophyta) exposed to high light and salt stress. Mar Biotechnol (NY) 10, /s Grattan S, Grieve CM Mineral element acquisition and growth response of plants grown in saline environments. Agriculture, ecosystems & environment 38, Grobbelaar JU Algal Nutrition, Mineral Nutrition. In: Richmond A, editor. Handbook of microalgal culture: biotechnology and applied 42 Miandoab et al.

10 phycology. 1st ed. Oxford, UK: Blackwell Scientific, / Hejazi MA, Wijffels RH Effect of light intensity on β-carotene production and extraction by Dunaliella salina in two-phase bioreactors. Biomolecular Engineering 20, / (91) Hosseini Tafreshi A, Shariati M Dunaliella biotechnology: methods and applications. Journal of Applied Microbiology 107, Hu Q Environmental Effects on Cell Composition. In: Richmond A, editor. Handbook of microalgal culture: biotechnology and applied phycology. 1st ed. Oxford, UK: Blackwell Scientific, P. Jiménez C, Niell FX Influence of temperature and salinity on carbon and nitrogen content in Dunaliella viridis teodoresco under nitrogen sufficiency. Bioresource Technology 38, / (91) Khalil ZI, Asker MM, El-Sayed S, Kobbia IA Effect of ph on growth and biochemical responses of Dunaliella bardawil and Chlorella ellipsoidea. World Journal of Microbiology and Biotechnology 26, /s z Kim M, Park S, Polle JE, Jin E Gene expression profiling of Dunaliella sp. acclimated to different salinities. Phycological research 58, Livak KJ, Schmittgen TD Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 ΔΔCT Method. Methods 25, /meth Mishra A, Mandoli A, Jha B Physiological characterization and stress-induced metabolic responses of Dunaliella salina isolated from salt pan. Journal of industrial microbiology & biotechnology 35, /s Narváez-Zapata JA, Rojas-Herrera R, López- Uc Y, Sánchez-Estudillo L Different physiological responses influenced by salinity in genetically related Dunaliella salina isolates. Biotechnology letters 33, /s x Ördög V, Stirk WA, Bálint P, van Staden J, Lovász C Changes in lipid, protein and pigment concentrations in nitrogen-stressed Chlorella minutissima cultures. Journal of Applied Phycology 24, /s Raja R, Hemaiswarya S, Rengasamy R Exploitation of Dunaliella for β-carotene production. Applied microbiology and biotechnology 74, /s Sánchez-Estudillo L, Freile-Pelegrin Y, Rivera- Madrid R, Robledo D, Narváez-Zapata JA Regulation of two photosynthetic pigmentrelated genes during stress-induced pigment formation in the green alga, Dunaliella salina. Biotechnology letters 28, /s Tammam AA, Fakhry EM, El-Sheekh M Effect of salt stress on antioxidant system and the metabolism of the reactive oxygen species in Dunaliella salina and Dunaliella tertiolecta. African Journal of Biotechnology 10, Miandoab et al.