molecular function. The right hand y-axis indicates the number of annotated unigenes.
|
|
|
- Bryan Flynn
- 5 years ago
- Views:
Transcription
1 Takemura et al. Supplementary Fig.S1 Supplementary Fig. S1. GO assignment of all unigenes. The unigenes were mapped to three main categories: iological process, cellular component and molecular function. The right hand y-axis indicates the numer of annotated unigenes.
2 Takemura et al. Supplementary Fig.S2 Supplementary Fig. S2. Differentially expressed genes in the EOD-FR sample (EOD) compared with those in the control sample (Cont). The significantly up-regulated genes y EOD-FR treatment were marked in yellow while the significantly down-regulated genes were marked in lue with the threshold of FDR and (log2ratio) 1.
3 Takemura et al. Supplementary Fig.S3 P-value Supplementary Fig. S3A. Enriched GO terms in category of 'iologycal process' of differential expressed genes etween EOD and Cont plants in GO enrichment analysis.
4 Takemura et al. Supplementary Fig.S3 P-value Supplementary Fig. S3B. Enriched GO terms in category of 'cellular component' of differential expressed genes etween EOD and Cont plants in GO enrichment analysis.
5 Takemura et al. Supplementary Fig.S3 P-value Supplementary Fig. S3C. Enriched GO terms in category of 'molecular function' of differential expressed genes etween EOD and Cont plants in GO enrichment analysis.
6 Takemura et al. Supplementary Fig.S4 DEG up-regulated y EOD treatment DEG down-regulated y EOD treatment DEG up or down-regulated y EOD treatment Supplementary Fig. S4A. Circadian rhythm - plant KEGG pathway enriched in this study.
7 Takemura et al. Supplementary Fig.S4 DEG up-regulated y EOD treatment DEG down-regulated y EOD treatment DEG up or down-regulated y EOD treatment Supplementary Fig. S4B. Starch and sucrose metaolism KEGG pathway enriched in this study.
8 Takemura et al. Supplementary Fig.S4 DEG up-regulated y EOD treatment DEG down-regulated y EOD treatment DEG up or down-regulated y EOD treatment Supplementary Fig. S4C. Photosynthesis KEGG pathway enriched in this study.
9 Takemura et al. Supplementary Fig.S4 DEG up-regulated y EOD treatment DEG down-regulated y EOD treatment DEG up or down-regulated y EOD treatment Supplementary Fig. S4D. Plant hormone signal transduction KEGG pathway enriched in this study.
10 Takemura et al. Supplementary Fig.S4 DEG up-regulated y EOD treatment DEG down-regulated y EOD treatment DEG up or down-regulated y EOD treatment Supplementary Fig. S4E. Terpenoid ackone iosynthesis KEGG pathway enriched in this study.
11 Takemura et al. Supplementary Fig.S4 DEG up-regulated y EOD treatment DEG down-regulated y EOD treatment DEG up or down-regulated y EOD treatment Supplementary Fig. S4F. Flavonoid iosynthesis KEGG pathway enriched in this study.
12 Takemura et al. Supplementary Fig.S4 DEG up-regulated y EOD treatment DEG down-regulated y EOD treatment DEG up or down-regulated y EOD treatment Supplementary Fig. S4G. Flavone and flavonol iosynthesis KEGG pathway enriched in this study.
13 Takemura et al. Supplementary Fig.S4 DEG up-regulated y EOD treatment DEG down-regulated y EOD treatment DEG up or down-regulated y EOD treatment Supplementary Fig. S4H. Diterpenoid iosynthesis KEGG pathway enriched in this study.
14 Relative expression level Relative expression level Relative expression level (A) YUCCA (CL6581) c c c Cont EOD Cont EOD Cont EOD 16:45 19:45 22:45 AIP5 (Unigene42565) a Cont EOD Cont EOD Cont EOD 16:45 19:45 22:45 AIP15 (CL4296) a a Cont EOD Cont EOD Cont EOD 16:45 19:45 22:45 a c a a Relative expression level Relative expression level Relative expression level (B) Takemura et al. Supplementary Fig.S5 YUCCA (CL6581) a a Cont EOD Cont EOD Cont EOD 16:45 19:45 22:45 AIP5 (Unigene42565) a a Cont EOD Cont EOD Cont EOD 16:45 19:45 22:45 AIP15 (CL4296) c c c Cont EOD Cont EOD Cont EOD 16:45 19:45 22:45 a a a a c Supplementary Fig. S5. Relative expression levels of DEGs annotated as genes related to synthesis or signaling of auxin in leaf (A) and stem (3rd- and 4th-nodes) (B) of Eustoma grandiflorum collected on Decemer 25. Different letters within the same column show a significant difference y Tukey-Kramer s HSD tests at the 5% level.
15 Takemura et al. Supplementary Fig.S6 5 cm Control EOD-FR Supplementary Fig. S6. Photographs in mid developmental stages of Eustoma grandiflorum treated in this study. Eustoma plants in photographs were collected on January 22 as mid developmental stages.
16 Takemura et al. Supplementary Fig.S Radiation strength (W m -2 ) Wavelength (nm) Supplementary Fig. S7. Spectrum distriution characteristics of light sources used to study.
17 Takemura et al. Supplementary Tale S2 Supplementary Tale S2A. List of GO enrichment analysis results: category 'iologycal process' (P-value < 1E-05). Gene Ontology term Cluster frequency Corrected (No. of DEGs (% of 547)) P-value proximal/distal pattern formation 14 ( 2.6% ) 9.44E-15 floral organ ascission 14 ( 2.6% ) 4.31E-11 ascission 15 ( 2.7% ) 4.69E-10 response to asence of light 13 ( 2.4% ) 1.96E-08 response to sucrose 24 ( 4.4% ) 8.14E-08 response to disaccharide 24 ( 4.4% ) 8.14E-08 chloride transport 12 ( 2.2% ) 2.12E-07 auxin efflux 11 ( 2.0% ) 1.36E-06 inorganic anion transport 23 ( 4.2% ) 7.30E-06 emryonic root morphogenesis 5 ( 0.9% ) 7.69E-05 root hair initiation 5 ( 0.9% ) 7.69E-05
18 Takemura et al. Supplementary Tale S2 Supplementary Tale S2B. List of GO enrichment analysis results: category 'cellular component' (P-value < 1E-05). Gene Ontology term Cluster frequency Corrected (No. of DEGs (% of 511)) P-value memrane 242 ( 47.4% ) 3.36E-07 cell periphery 160 ( 31.3% ) 2.50E-06 lateral plasma memrane 5 ( 1.0% ) 6.50E-06
19 Takemura et al. Supplementary Tale S2 Supplementary Tale S2C. List of GO enrichment analysis results: category 'molecular function' (P-value < 1E-05). Gene Ontology term Cluster frequency Corrected (No. of DEGs (% of 486)) P-value UTP:glucose-1-phosphate uridylyltransferase activity 20 ( 4.1% ) 2.30E-28 UTP-monosaccharide-1-phosphate uridylyltransferase activity 20 ( 4.1% ) 8.43E-28 uridylyltransferase activity 20 ( 4.1% ) 8.91E-27 oxidoreductase activity 108 ( 22.2% ) 1.30E-12 auxin efflux transmemrane transporter activity 11 ( 2.3% ) 4.25E-10 auxin transmemrane transporter activity 12 ( 2.5% ) 1.47E-08 voltage-gated chloride channel activity 12 ( 2.5% ) 2.15E-08 chloride channel activity 12 ( 2.5% ) 2.15E-08 chloride transmemrane transporter activity 12 ( 2.5% ) 3.95E-08 efflux transmemrane transporter activity 11 ( 2.3% ) 6.21E-08 voltage-gated anion channel activity 12 ( 2.5% ) 8.74E-08 anion channel activity 12 ( 2.5% ) 1.08E-07 transporter activity 87 ( 17.9% ) 5.45E-07 voltage-gated ion channel activity 16 ( 3.3% ) 6.00E-07 voltage-gated channel activity 16 ( 3.3% ) 6.00E-07 acid phosphatase activity 13 ( 2.7% ) 9.14E-07 4-hydroxy-3-methylut-2-en-1-yl diphosphate synthase activity 5 ( 1.0% ) 2.17E-06 oxidoreductase activity, acting on CH or CH2 groups, with an iron-sulfur protein as acceptor 5 ( 1.0% ) 2.16E-05 nitrate transmemrane transporter activity 7 ( 1.4% ) 4.62E-05 gated channel activity 16 ( 3.3% ) 6.98E-05 oxidoreductase activity, acting on diphenols and related sustances as donors, oxygen as acceptor 9 ( 1.9% ) 9.66E-05 sustrate-specific channel activity 17 ( 3.5% ) 9.72E-05
20 Takemura et al. Tale S3 Tale S3. Highly enriched KEGG classes of DEGs (P-value < 1E-05). Pathway No. of DEGs with pathway annotation (% of 577) P-value Pathway ID Circadian rhythm - plant 35 ( 6.07% ) 2.38E-22 ko04712 Biosynthesis of secondary metaolites 125 ( 21.66% ) 6.28E-17 ko01110 Metaolic pathways 184 ( 31.89% ) 1.33E-13 ko01100 Pentose and glucuronate interconversions 25 ( 4.33% ) 1.90E-13 ko00040 Starch and sucrose metaolism 39 ( 6.76% ) 1.23E-11 ko00500 Galactose metaolism 22 ( 3.81% ) 2.75E-11 ko00052 Sphingolipid metaolism 15 ( 2.60% ) 1.42E-08 ko00600 Amino sugar and nucleotide sugar metaolism 23 ( 3.99% ) 5.75E-08 ko00520 Stilenoid, diarylheptanoid and gingerol iosynthesis 12 ( 2.08% ) 6.22E-08 ko00945 Terpenoid ackone iosynthesis 32 ( 5.55% ) 1.30 E-07 ko00900 Flavonoid iosynthesis 13 ( 2.25% ) 7.01E-07 ko00941 Pantothenate and CoA iosynthesis 10 ( 1.73% ) 3.59E-05 ko00770 Diterpenoid iosynthesis 10 ( 1.73% ) 3.89E-05 ko00904 Phenylpropanoid iosynthesis 19 ( 3.29% ) 4.67E-05 ko00940
21 Takemura et al. Supplementary Tale S4 Supplementary Tale S4. Differentially expressed genes related to circadian rhythm in EOD-FR treatment of Eustoma grandiflorum. Gene ID Length log2 (p) (EOD-FR/Control) P-value Annotation PIF3 CL10572.Contig2 1, E-51 predicted protein [Populus trichocarpa] PREDICTED: transcription factor HLH130-like CL5482.Contig3 2, E-06 [Solanum lycopersicum] CL2342.Contig2 2, E-07 hypothetical protein PRUPE_ppa005829mg [Prunus persica] CL176.Contig7 4, E-08 PREDICTED: transcription factor HLH48-like [Solanum lycopersicum] CL10572.Contig2 1, E-51 predicted protein [Populus trichocarpa] LHY or CCA1 MYB transcription factor, partial CL6114.Contig24 2, E-10 [Catharanthus roseus] CL6114.Contig17 2, E-06 putative At5g37260 [Solanum ochranthum] Unigene E-06 protein CCA1-like, partial [Cucumis sativus] CL1022.Contig2 2, E-15 PREDICTED: protein LHY-like [Vitis vinifera] Unigene , E-13 predicted protein [Populus trichocarpa] Unigene E-15 predicted protein [Populus trichocarpa] COP1 CL11693.Contig1 3, E-06 PREDICTED: uncharacterized protein LOC [Solanum lycopersicum] CO CL7349.Contig1 1, E-12 PREDICTED: zinc finger protein CONSTANS-LIKE 5-like [Vitis vinifera] Unigene E-20 PREDICTED: proale salt tolerance-like protein At1g78600-like [Vitis vinifera] CL6195.Contig E-07 PREDICTED: proale salt tolerance-like protein At1g78600-like [Vitis vinifera] CHS Unigene , E-08 naringenin-chalcone synthase [Prunus avium] These genes were picked up after KEGG pathway enrichment.
22 Supplementary Tale S5. Morphology of internode of the main stem in early developmental stages of Eustoma grandiflorum (Cross section). Takemura et al. Tale S5 Node Treatment Pith Cortex Pith area (mm 2 ) Numer of cells Cortex area (mm 2 ) Numer of cells Control th-node EOD-FR T-test NS Z NS * NS Control rd-node EOD-FR T-test NS NS NS NS Z NS, *, or ** indicate non-significant, significant at p < 0.05, or 0.01, respectively. (n = 5).
23 Takemura et al. Supplementary Tale S6 Supplementary Tale S6. Effect of EOD-FR treatment on growth in mid developmental stages of Eustoma grandiflorum. Treatment Stem length (cm) Numer of nodes on main stem Mean internode length (mm) fresh weight on aerial part (g) fresh weight on underground part (g) Control EOD-FR T-test ** Z ** ** NS NS Z NS, *, or ** indicate non-significant, significant at p < 0.05, or 0.01, respectively. (n = 10).
24 Takemura et al. Supplementary Tale S7 Supplementary Tale S7. Primers used for real-time PCR. Target gene Primer sequence (5 to 3 ) Product size (p) BTB/POZ 1 ATATTCAAAGCTGATGCTCAGTGG ( CL1719 ) GAGAGGAGAAGAAGGTAGAGGGAGA BTB/POZ 2 ACAAACACCAGCCCAGCA ( CL11343 ) GGACAAAGAGACAGAGTAAGGAGGA ABCB transporter GCCTGCCTCTCTCCAGTTCTT ( Unigene72607 ) ATGCGATTTTGCTCTGCTACAC PIN 4 CCGGCAGATGCATTAGGA ( CL6181 ) TTGGAGGTGGTGGGAGAGA YUCCA AGCGTGTGGTGCCTGAAA ( CL6581 ) TCCGCATCCCACAACAAG AIP 5 AACACTGGGCCTTTTCTCCTC ( Unigene42565 ) CGGCTGGAACCCTATTTTACTATCT AIP 15 TTCTCCCCTACATACACAGCAAAA ( CL4296 ) AACAAACTGCATCAAGCTCCAA GA20ox ATCACTTGCCTTCTTTCTTTGTCC ( CL10815 ) CATGTCGGCTCTGTAATGCTTC GA2ox CCATAAGGCAAGGCAAAGGA ( CL14653 ) AAATGGAAGGTTGAAGAGTGTGAAG HLH 157 TTCACACAGGACCTCTATCAGCA ( CL2504 ) ATCCGTAAAGAAAATCCCAGCA HLH 135 AACGTGATCTTCGGCTAGACATT ( CL7761 ) CCCCTTCTTGCTTTCACATCTT HLH 130 CAACATCATTCCAGCCAAAATC ( CL5482 ) CGTCTTCCCTATCACTCACTCTACC HLH 63 CAGCGGAAAAGCAAATGAAA ( CL2342 ) CGAGCACAAAACCGAACC Actin TCTCTATGCTAGTGGTCGAA CTCTCGGTGAGGATCTTC
Chapter 2 Part 3: Organic and Inorganic Compounds
Chapter 2 Part 3: Organic and Inorganic Compounds Objectives: 1) List the major groups of inorganic chemicals common in cells. 2) Describe the functions of various types of inorganic chemicals in cells.
5. Groups A and B in the table below contain molecular formulas of compounds.
1. Which group consists entirely of organic molecules? A) protein, oxygen, fat B) protein, starch, fat C) water, carbon dioxide, oxygen D) water, starch, protein 2. Which statement describes starches,
Chapter 2: Biochemistry
Chapter 2: Biochemistry Biochemistry Biochemistry is the study of chemical makeup and reactions of living matter All chemicals in the body are either organic & inorganic Organic compounds contain carbon
Chemical Formulas. Chemical Formula CH 3 COCHCHOCHClCHNH Lewis Dot Structure
Biochemistry . Chemical Formulas A chemical formula represents the chemical makeup of a compound. It shows the numbers and kinds of atoms present in a compound. It is a kind of shorthand that scientists
What is an atom? An atom is the smallest component of all living and nonliving materials.
What is an atom? An atom is the smallest component of all living and nonliving materials. It is composed of protons (+), neutrons (0), and electrons (-). The Periodic Table Elements are composed of all
Terry Richmond s Fertilizer Package mentioned in the panel discussion March 14, 2013.
Terry Richmond s Fertilizer Package mentioned in the panel discussion March 14, 2013. Roles of the 16 essential nutrients in plant development Sixteen plant food nutrients are essential for proper crop
Metabolic response induced by parasitic plant-fungus interactions hinder amino sugar and nucleotide sugar metabolism in the host
Supplementary information Metabolic response induced by parasitic plant-fungus interactions hinder amino sugar and nucleotide sugar metabolism in the host Dong-Kyu Lee, Soohyun Ahn, Hae Yoon Cho, Hye Young
Molecules of Life. Carbohydrates Lipids Proteins Nucleic Acids
Molecules of Life Carbohydrates Lipids Proteins Nucleic Acids Molecules of Life All living things are composed of the following basic elements: Carbon Hydrogen Oxygen Nitrogen Phosphorous Sulfur Remember
What is an atom? An atom is the smallest component of all living and nonliving materials.
What is an atom? An atom is the smallest component of all living and nonliving materials. It is composed of protons (+), neutrons (0), and electrons (-). The Periodic Table Elements are composed of all
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma
Linlin Liu 1, Yingying Li 1, Guangbiao She 1, Xianchen Zhang 1, Brian Jordan 2, Qi Chen 1, Jian Zhao 1* and Xiaochun Wan 1*
Liu et al. BMC Plant Biology (2018) 18:233 https://doi.org/10.1186/s12870-018-1440-0 RESEARCH Open Access Metabolite profiling and transcriptomic analyses reveal an essential role of UVR8- mediated signal
REMEMBER as we go through this exercise: Science is the art of making simple things complicated!
REMEMBER as we go through this exercise: Science is the art of making simple things complicated! Fertilization of Hops Ron Godin, Ph.D., Colorado State University Extension Fertilization of Hops - Care
BRIEF CONTENTS COPYRIGHTED MATERIAL III METABOLIC AND DEVELOPMENTAL INTEGRATION COMPARTMENTS CELL REPRODUCTION PLANT ENVIRONMENT AND AGRICULTURE
BRIEF CONTENTS I COMPARTMENTS 1 Membrane Structure and Membranous Organelles 2 2 The Cell Wall 45 3 Membrane Transport 111 4 Protein Sorting and Vesicle Traffic 151 5 The Cytoskeleton 191 II CELL REPRODUCTION
Biochemistry Name: Practice Questions
Name: Practice Questions 1. Carbohydrate molecules A and B come in contact with the cell membrane of the same cell. Molecule A passes through the membrane readily, but molecule B does not. It is most likely
KEY NAME (printed very legibly) UT-EID
BIOLOGY 311C - Brand Spring 2007 KEY NAME (printed very legibly) UT-EID EXAMINATION II Before beginning, check to be sure that this exam contains 7 pages (including front and back) numbered consecutively,
Mineral Nutrition of Fruit & Nut Trees. Fruit & Nut Tree Nutrition 3/1/2013. Johnson - Nutrition 1
Mineral Nutrition of Fruit & Nut Trees R. Scott Johnson Extension Pomologist UC Kearney Ag Center Fruit & Nut Tree Nutrition 1. Basic Principles 2. Sampling for Nutrients 3. Environmental Issues 4. BMPs
Biology 12 - Biochemistry Practice Exam
Biology 12 - Biochemistry Practice Exam Name: Water: 1. The bond between water molecules is a (n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond 2. The water properties: good solvent,
The Structure and Function of Macromolecules
The Structure and Function of Macromolecules I. Polymers What is a polymer? Poly = many; mer = part. A polymer is a large molecule consisting of many smaller sub-units bonded together. What is a monomer?
Supplementary figure legends
Supplementary figure legends Fig. S1. Lineweaver-Burk plot of putrescine uptake by YeeF. An overnight culture of SK629 was inoculated in 100-mL LBG medium in 500-mL Erlenmeyer flasks. The medium was supplemented
Unit B: Seed Germination, Growth, and Development. Lesson 4: Determining Nutrient Functions and Utilization
Unit B: Seed Germination, Growth, and Development Lesson 4: Determining Nutrient Functions and Utilization 1 Terms Denitrification Leach Macronutrient Micronutrient Nitrification Nitrogen cycle Nitrogen
The Structure and Function of Biomolecules
The Structure and Function of Biomolecules The student is expected to: 9A compare the structures and functions of different types of biomolecules, including carbohydrates, lipids, proteins, and nucleic
Ms. Golub & Ms. Sahar Date: Unit 2- Test #1
Name Ms. Golub & Ms. Sahar Date: Unit 2- Test #1 1. The interaction between guard cells and a leaf opening would not be involved in A) diffusion of carbon dioxide B) maintaining homeostasis C) heterotrophic
Biochemistry. Chapter 6
Biochemistry Chapter 6 Game Plan for Today. - Collect your papers - Hand back quests - Go over Amoeba Sister Chart - Biochem Notes - Video Carbohydrate Lab Food Label Lab! Testing For Carbohydrates Benedict's
Learning Target: Describe characteristics and functions of carbohydrates, lipids, and proteins. Compare and contrast the classes of organic
Learning Target: Describe characteristics and functions of carbohydrates, lipids, and proteins. Compare and contrast the classes of organic compounds. What are inorganic molecules? Molecules that CANNOT
Supplementary Information. Deciphering the Venomic Transcriptome of Killer- Wasp Vespa velutina
Supplementary Information Deciphering the Venomic Transcriptome of Killer- Wasp Vespa velutina Zhirui Liu, Shuanggang Chen, You Zhou, Cuihong Xie, Bifeng Zhu, Huming Zhu, Shupeng Liu, Wei Wang, Hongzhuan
Macromolecules. Macromolecules. What are the macromolecules? Organic molecules. The human body uses complex organic molecules known as macromolecules.
Macromolecules Macromolecules Biochemistry The human body uses complex organic molecules known as macromolecules. Macro - long or large It is a large molecule that is made up of smaller units joined together.
Plant Nutrients in Mineral Soils
The Supply and Availability of Plant Nutrients in Mineral Soils Plant Nutrients in Mineral Soils Factors Controlling the Growth of Higher Plants 1. Light 2. Mechanical Support. Heat. Air 5. Water 6. Nutrients
Basic Plant Biology A Review
Basic Plant Biology A Review What is a plant? Traditional View of Biology: Animals and Plants What is a plant? Traditional View of Biology: Animals and Plants Problem: Microscopic Organisms (Bacteria,
What are the most common elements in living organisms? What is the difference between monomers, dimers and polymers?
What do each of these terms mean? Atom Molecule Element Compound Organic Inorganic What are the most common elements in living organisms? What are the roles of magnesium, iron, phosphate and calcium in
Animal, Plant & Soil Science. D3-7 Characteristics and Sources of Secondary Nutrients and Micronutrients
Animal, Plant & Soil Science D3-7 Characteristics and Sources of Secondary Nutrients and Micronutrients Interest Approach Obtain samples of minerals that serve as sources of calcium, magnesium, and sulfur
Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds
Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed
The Atoms of Life. What are other elements would you expect to be on this list? Carbon Hydrogen Nitrogen Oxygen Phosphorous Sulfur (sometimes)
Macromolecules The Atoms of Life The most frequently found atoms in the body are Carbon Hydrogen Nitrogen Oxygen Phosphorous Sulfur (sometimes) What are other elements would you expect to be on this list?
Metabolism. Topic 11&12 (ch8) Microbial Metabolism. Metabolic Balancing Act. Topics. Catabolism Anabolism Enzymes
Topic 11&12 (ch8) Microbial Metabolism Topics Metabolism Energy Pathways Biosynthesis 1 Catabolism Anabolism Enzymes Metabolism 2 Metabolic Balancing Act Catabolism Enzymes involved in breakdown of complex
-are poly-hydroxylated aldehydes and ketones -can cyclise -can form polymeric chains
CARBOHYDRATES -compounds of C, H and O -originally thought of as hydrates of carbon e.g. glucose C 6 H 12 O 6 thought to be C(H 2 O) carbohydrates: -are poly-hydroxylated aldehydes and ketones -can cyclise
Introduction to Biochemistry
Life is Organized in Increasing Levels of Complexity Introduction to Biochemistry atom simple molecule What is the chemical makeup of living things? macromolecule organ organ system organism organelle
Mineral Nutrition. Criteria for Essentiality
Mineral Nutrition Criteria for Essentiality The element is absolutely necessary for supporting normal growth and reproduction. In the absence of essential elements, plants cannot complete their life cycle
Organic compounds. Lipids, Carbohydrates, Proteins, and Nucleic Acids
Organic compounds Lipids, Carbohydrates, Proteins, and Nucleic Acids Essential for life Organic compounds: Contain carbon Most are covalently bonded Example: C 6 H 12 O 6 (Glucose) Inorganic Compounds:
Bioenergetics. Chapter 3. Objectives. Objectives. Introduction. Photosynthesis. Energy Forms
Objectives Chapter 3 Bioenergetics Discuss the function of cell membrane, nucleus, & mitochondria Define: endergonic, exergonic, coupled reactions & bioenergetics Describe how enzymes work Discuss nutrients
The. Crash Course. Basically, almost all living things are made up of these 4 Elements: - Carbon (C) - Nitrogen (N) - Hydrogen (H) - Oxygen (O)
The Biochemistry Crash Course Basically, almost all living things are made up of these 4 Elements: - Carbon (C) - Nitrogen (N) - Hydrogen (H) - Oxygen (O) This exercise is designed to familiarize you with
Activity: Biologically Important Molecules
Activity: Biologically Important Molecules AP Biology Introduction We have already seen in our study of biochemistry that the molecules that comprise living things are carbon-based, and that they are thought
Figure S3 Differentially expressed fungal and plant genes organised by catalytic activity ontology Organisation of E. festucae (A) and L.
sak WT Number of branches 3 WT sak Figure S1 Vasculature of plants infected with the E. festucae sak mutant. Light micrographs of perennial ryegrass blade tissue showing branching between the vasculature
Visit For All NCERT solutions, CBSE sample papers, Question papers, Notes for Class 6 to 12. Chapter-12 MINERAL NUTRITION
Chapter-12 MINERAL NUTRITION POINTS TO REMEMBER Autotroph : An organism that synthesize its required nutrients from simple and inorganic substances. Heterotroph : An organism that cannot synthesise its
An example of a carbohydrate A) 1 B) 2 C) 3 D) 4
1. Which chemical formula represents a carbohydrate? A) CH4 B) C3H7O2N C) Cl2H22O11 D) CO2 2. Base your answer to the following question on the diagram below. For each of the following phrases, select
Plants Essential Elements. Macro and Micronutrients
Plants Essential Elements Macro and Micronutrients Nutrients Are elements needed by a plant to promote healthy tissue, processes, and growth. When plants are lacking in nutrients have a deficiency and
Dehydration Synthesis and Hydrolysis Reactions. ne_content/animations/reaction_types.ht ml
Glucose Molecule Macromolecules Carbohydrates, proteins, and nucleic acids are polymers Polymers long molecules made from building blocks linked by covalent bonds Monomers the building blocks to polymers
INORGANIC COMPOUNDS. Ex: Water. Compounds that may be essential to life, but are not necessarily found in living things.
INORGANIC COMPOUNDS Compounds that may be essential to life, but are not necessarily found in living things. Ex: Water Other example: CO2 - ¾ of earth - 90% of living tissue WATER Water is a POLAR compound.
Enzymes what are they?
Topic 11 (ch8) Microbial Metabolism Topics Metabolism Energy Pathways Biosynthesis 1 Catabolism Anabolism Enzymes Metabolism 2 Metabolic balancing act Catabolism Enzymes involved in breakdown of complex
Chapter Three (Biochemistry)
Chapter Three (Biochemistry) 1 SECTION ONE: CARBON COMPOUNDS CARBON BONDING All compounds can be classified in two broad categories: organic compounds and inorganic compounds. Organic compounds are made
Chapter 1-2 Review Assignment
Class: Date: Chapter 1-2 Review Assignment Multiple Choice dentify the choice that best completes the statement or answers the question. Corn seedlings A student wanted to design an investigation to see
½ cup of CHEX MIX contains 13 g of carbs = 4% daily value. How much more can you have the rest of the day??? _4_ = X X= 325 g
BIOCHEMISTRY ½ cup of CHEX MIX contains 13 g of carbs = 4% daily value. How much more can you have the rest of the day??? _4_ = 13 100 X X= 325 g These spinach imposters contain less than 2 percent of
Plant Biochemistry 31S2-33. ACADEMIC PRESS San Diego London Boston New York Sydney Tokyo Toronto. P.M. Dey. J.B. Harborne. edited by.
31S2-33 Plant Biochemistry edited by P.M. Dey Division of Biochemistry, School of Biological Sciences, Royal Holloway, University of London, Egham Hill, Egham, Surrey TW20 OEX, UK. and J.B. Harborne Department
Topic 3: The chemistry of life (15 hours)
Topic : The chemistry of life (5 hours). Chemical elements and water.. State that the most frequently occurring chemical elements in living things are carbon, hydrogen, oxygen and nitrogen...2 State that
Front Plant Sci Mar 14
Case Study Front Plant Sci. 2016 Mar 14 30 33 Study Background Cryptochromes (CRY) are blue-light photoreceptors that mediate various light responses in plants and animals. It is known that CRY1 and CRY2
Water: 1. The bond between water molecules is a(n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond
Biology 12 - Biochemistry Practice Exam KEY Water: 1. The bond between water molecules is a(n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond 2. The water properties: good solvent,
Metabolism III. Aim: understand gluconeogenesis, pentose phosphate pathway, photosynthesis and amino acid synthesis
Metabolism III Aim: understand gluconeogenesis, pentose phosphate pathway, photosynthesis and amino acid synthesis Anabolism From a carbon source and inorganic molecules, microbes synthesize new organelles
f(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31.
14 12 f(x) = 1.633186874x - 21.46732234 R² =.995616541 RPKM (M8.MXA) 1 8 6 4 2 2 4 6 8 1 12 14 RPKM (M8.MXB) 14 12 f(x) =.821767782x - 4.192595677497E-14 R² = 1 RPKM (M31.XA) 1 8 6 4 2 2 4 6 8 1 12 14
CP Biology: Basic Biochemistry
CP Biology: Basic Biochemistry Organic Chemistry Organic chemistry is the study of carbon compounds. Organic compounds are compounds composed primarily of a carbon skeleton. All living things are composed
Importance of Nutrition
The EAT WELL Plate Canada s food guide Food pyramid Importance of Nutrition Energy for body metabolism (nerve impulses, contraction of muscles, repair and replacement of cells Raw materials for building
2-3 Carbon Compounds 10/22/2013. The Chemistry of Carbon. More Carbon. Chemistry (cont) More Macromolecules. Macromolecules
The Chemistry of Carbon 2-3 Carbon Compounds Because of carbons 4 valence electrons it can form covalent bonds with many other elements (octet rule) 2 Chemistry (cont) Plus, it can bond with itself More
Connections of Carbohydrate, Protein, and Lipid Metabolic Pathways
OpenStax-CNX module: m44441 1 Connections of Carbohydrate, Protein, and Lipid Metabolic Pathways OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution
Supplementary Figures
Supplementary Figures Supplementary Figure 1. AtMYB12 antibody detects both Arabidopsis and tomato MYB12 protein. (a) AtMYB12 antibody detects both SlMYB12 and AtMYB12 in tomato fruit. Both WT and AtMYB12
I. ROLE OF CARBON IN ORGANISMS: Organic compounds = compounds that contain carbon Ex: Carbohydrates, lipids, proteins
I. ROLE OF CARBON IN ORGANISMS: Organic compounds = compounds that contain carbon Ex: Carbohydrates, lipids, proteins Inorganic compounds = compounds that DO NOT contain carbon Ex: Vitamins, minerals,
Macromolecules. Biology
Macromolecules Biology Intro Video https://vimeo.com/83005599 The Importance of CHNOPS CARBON Major structural atom in all organic molecules. Key component in photosynthesis, returned back to the environment
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:
The building blocks for this molecule are A) amino acids B) simple sugars C) fats D) molecular bases
1. Base your answer to the following question on the diagram below and on your knowledge of biology. The diagram represents a portion of a starch molecule. The building blocks for this molecule are A)
Mineral Nutrients and their functions in plants
Mineral Nutrients and their functions in plants PLANT NUTRITION The term "nutrition" refers to the interrelated steps by which a living organism assimilates food and uses it for growth and replacement
Carbohydrates. Organic compounds which comprise of only C, H and O. C x (H 2 O) y
Carbohydrates Organic compounds which comprise of only C, H and O C x (H 2 O) y Carbohydrates Monosaccharides Simple sugar Soluble in water Precursors in synthesis triose sugars of other (C3) molecules
BCH 445 Biochemistry of nutrition Dr. Mohamed Saad Daoud
BCH 445 Biochemistry of nutrition Dr. Mohamed Saad Daoud 1 Carbohydrates Carbohydrates: Compounds composed of carbon, oxygen, and hydrogen arranged as monosaccharides or multiples of monosaccharides. Most,
Carbon. Has four valence electrons Can bond with many elements. Can bond to other carbon atoms. Hydrogen, Oxygen, Phosphorus, Sulfur, and Nitrogen
Organic Compounds Carbon Has four valence electrons Can bond with many elements Hydrogen, Oxygen, Phosphorus, Sulfur, and Nitrogen Can bond to other carbon atoms Gives carbon the ability to form chains
Molecule - two or more atoms held together by covalent bonds. Ex. = water, H O
ORGANIC CHEMISTRY NOTES Why study carbon? ORGANIC CHEMISTRY NOTES Why study carbon? * All of life is built on carbon * Cells are made up of about 72% water 3% salts (NaCl, and K) 25% carbon compounds which
Elements & Macromolecules in Organisms
Name: Period: Date: Elements & Macromolecules in Organisms Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body weight.
COMMON ASSESSMENT
1. The diagram above is a model of a cellular process called transcription. What class of biological molecules is represented in the diagram? A. Carbohydrates B. Nucleic acids C. Proteins D. Lipids B.9.A.R
1.3.1 Function of Food. Why do we need food?
1.3.1 Function of Food Why do we need food? Need to know The Function of Food Three reasons for requiring food 2 Food is needed for: 1.Energy 2.Growth of new cells and Repair of existing cells, tissues,
January 31, Chemistry of Life. Carbohydrates. Lipids. Proteins. Biologically Important Macromolecules. Nucleic Acids
Chemistry of Life Carbohydrates Lipids Proteins Biologically Important Macromolecules Nucleic Acids Polymers Polymers are large molecules of repeating sub units (building blocks) Individual Building Blocks......can
Organic Compounds: Carbohydrates
Organic Compounds: Carbohydrates Carbohydrates include sugars and starches Contain the elements C,H,O (H & O ratio like water, 2 H s to 1O), ex. glucose C 6 H 12 O 6 Word means hydrated carbon Classified
SOILS AND PLANT NUTRITION
SOILS AND PLANT NUTRITION WHAT IS SOIL? Soil is the medium in which plants grow - the basis for plant growth. I can t get any respect. People treat me like dirt! Four Major Components of Soil Sand Silt
B i o c h e m i s t r y N o t e s
14 P a g e Carbon Hydrogen Nitrogen Oxygen Phosphorus Sulfur ~Major ~Found in all ~Found in most ~Found in all component of all organic organic molecules. molecules. ~Major structural atom in all organic
BY4. Question Answer Mark. D = Synaptic knob/motor end plate/ axon ending/ axon. NOT synpase/ dendrite/ nerve ending/ neuromuscular.
BY4 1. (a) (i) A = Dendrite(s), accept dendron; B = Axon/ axoplasm; C = Node(s) of Ranvier; D = Synaptic knob/motor end plate/ axon ending/ axon 4 terminal/ synaptic bulb; NOT synpase/ dendrite/ nerve
Botany Physiology. Due Date Code Period Earned Points
Name Botany Physiology C/By Due Date Code Period Earned Points Bot Phys 4W1 Flowers (divide by 6.5) Completion Complete each sentence or statement. 1. (4 points) The female reproductive organs are the
Supplemental Data. Pick and Bräutgam et al. Plant Cell. (2011) /tpc Mean Adjustment FOM values (± SD) vs. Number of Clusters
Mean Adjustment FOM values (± SD) vs. Number of Clusters Mean Adjustment FOM Number of Clusters Supplemental Figure 1. Figure of merit analysis of metabolite clustering. The algorithm tries 20 times to
XI CLASS BIOLOGY CHAPTER 12: MINERAL NUTRITION
XI CLASS BIOLOGY CHAPTER 12: MINERAL NUTRITION Mineral nutrition is the study of source, mode of absorption, distribution and metabolism of various inorganic substances (minerals) by plants for their growth,
Lesson Overview. Carbon Compounds. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview 2.3 The Chemistry of Carbon What elements does carbon bond with to make up life s molecules? Carbon can bond with many elements, including Hydrogen, Oxygen, Phosphorus, Sulfur, and Nitrogen
BIOLOGICAL MOLECULES REVIEW-UNIT 1 1. The factor being tested in an experiment is the A. data. B. variable. C. conclusion. D. observation. 2.
BIOLOGICAL MOLECULES REVIEW-UNIT 1 1. The factor being tested in an experiment is the A. data. B. variable. C. conclusion. D. observation. 2. A possible explanation for an event that occurs in nature is
Carbohydrates. 1. Using the terms provided below, complete the concept map showing the characteristics of organic compounds.
Name: Class: Date: Grade 10 Science Related Reading/Biology Carbohydrates Biology Gr10 1. Using the terms provided below, complete the concept map showing the characteristics of organic compounds. maltose
Lesson 2. Biological Molecules. Introduction to Life Processes - SCI 102 1
Lesson 2 Biological Molecules Introduction to Life Processes - SCI 102 1 Carbon in Biological Molecules Organic molecules contain carbon (C) and hydrogen (H) Example: glucose (C 6 H 12 O 6 ) Inorganic
Organic Molecules. 1. The structural formulas shown represent certain organic compounds found in living cells.
Name: ate: 1. The structural formulas shown represent certain organic compounds found in living cells. 1. (1) () (3) Which formula represents a monosaccharide? (4) (5). 1.. 3. 5. Which formula represents
Chun-Fang Li 1,2, Yan-Xia Xu 1, Jian-Qiang Ma 1, Ji-Qiang Jin 1, Dan-Juan Huang 1, Ming-Zhe Yao 1, Chun-Lei Ma 1 and Liang Chen 1*
Li et al. BMC Plant Biology (2016) 16:195 DOI 10.1186/s12870-016-0885-2 RESEARCH ARTICLE Open Access Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three
Introduction to Macromolecules. If you were to look at the nutrition label of whole milk, what main items stick out?
Introduction to Macromolecules Macromolecules are a set of molecules that are found in living organisms. Macromolecules essentially mean big molecules as the word macro means large. The functions of these
The Star of The Show (Ch. 3)
The Star of The Show (Ch. 3) Why study Carbon? All of life is built on carbon Cells ~72% 2 O ~25% carbon compounds carbohydrates lipids proteins nucleic acids ~3% salts Na, Cl, K Chemistry of Life Organic
BOTANY AND PLANT GROWTH Lesson 9: PLANT NUTRITION. MACRONUTRIENTS Found in air and water carbon C oxygen hydrogen
BOTANY AND PLANT GROWTH Lesson 9: PLANT NUTRITION Segment One Nutrient Listing Plants need 17 elements for normal growth. Carbon, oxygen, and hydrogen are found in air and water. Nitrogen, phosphorus,
WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA
A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure
MACROMOLECULES The Chemistry of Life
MACROMOLECULES The Chemistry of Life SB1c. Identify the function of the four major macromolecules (i.e., carbohydrates, proteins, lipids, nucleic acids). Vocabulary of the Day carbon macromolecule element
Carbon Compounds. Lesson Overview. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview Carbon Compounds Lesson Overview 2.3 THINK ABOUT IT In the early 1800s, many chemists called the compounds created by organisms organic, believing they were fundamentally different from
B. Element - each different kind of atom is a different element 1. Examples: C = carbon H = hydrogen
I. Chemistry study of what substances are made of and how they change and combine Structural Formula A. Atom fundamental unit of matter 1. Subatomic particles: n o = neutron p + = proton e - = electron
Organic Compounds. B-3.5 Students will be able to summarize the functions of proteins, carbohydrates, and fats in the human body.
Organic Compounds B-3.4 tudents will be able to summarize how the structures of organic molecules (including proteins, carbohydrates, and fats) are related to their relative caloric values. B-3.5 tudents
How to Develop a Balanced Program for Pecan and Chili. Robert R Smith
Essential Plant Nutrients How to Develop a Balanced Program for Pecan and Chili Robert R Smith Nutrition Management Involves Knowledge of: Site/Soil characteristics and chemistry Plant requirements Cropping
BIOCHEMISTRY. There are 4 major types of organic compounds each with unique characteristics: A. CARBOHYDRATES Contain,, and. Ratio of H:O is always
BIOCHEMISTRY All organic compounds must contain and Are the following organic? Why or why not? H2O CO2 CH4 There are 4 major types of organic compounds each with unique characteristics: A. CARBOHYDRATES
Carbon. p Has four valence electrons p Can bond with many elements p Can bond to other carbon atoms
Organic Compounds Carbon p Has four valence electrons p Can bond with many elements p Can bond to other carbon atoms n Gives carbon the ability to form chains that are almost unlimited in length. p Organic
Most life processes are a series of chemical reactions influenced by environmental and genetic factors.
Biochemistry II Most life processes are a series of chemical reactions influenced by environmental and genetic factors. Metabolism the sum of all biochemical processes 2 Metabolic Processes Anabolism-
A CRISPR/Cas9-mediated gene editing to enhance the expression of the Solanum lycopersicum MYB12 gene and the nutritional value of tomato
A CRISPR/Cas9-mediated gene editing to enhance the expression of the Solanum lycopersicum MYB12 gene and the nutritional value of tomato Dr. Aurelia Scarano Napoli, 22 Dicembre 2017 Phenylalanine Phenolic