Brain-derived neurotrophic factor in autonomic nervous system : nicotinic acetylcholine receptor regulation and potential trophic effects

Transcription

1 The University of Toledo The University of Toledo Digital Repository Theses and Dissertations 2005 Brain-derived neurotrophic factor in autonomic nervous system : nicotinic acetylcholine receptor regulation and potential trophic effects Xiangdong Zhou Medical University of Ohio Follow this and additional works at: Recommended Citation Zhou, Xiangdong, "Brain-derived neurotrophic factor in autonomic nervous system : nicotinic acetylcholine receptor regulation and potential trophic effects" (2005). Theses and Dissertations This Dissertation is brought to you for free and open access by The University of Toledo Digital Repository. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of The University of Toledo Digital Repository. For more information, please see the repository's About page.

2 FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Medical Sciences Brain-derived Neurotrophic Factor in Autonomic Nervous System: Nicotinic Acetylcholine Receptor Regulation and Potential Trophic Effects Submitted by Xiangdong Zhou In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Medical Sciences Date of Defense: January 7, 2005 Major Advisor Joseph F. Margiotta, Ph.D. Academic Advisory Committee Linda Dokas, Ph.D. Marthe Howard, Ph.D. David Giovannucci, Ph.D. Elizabeth Tietz, Ph.D. Dean, College of Graduate Studies Keith K. Schlender, Ph.D.

3 Brain-derived Neurotrophic Factor in Autonomic Nervous System: Nicotinic Acetylcholine Receptor Regulation and Potential Trophic Effects Xiangdong Zhou Medical University of Ohio 2005

4 ACKNOWLEDGMENTS I want to thank my major advisor, Dr. Joseph Margiotta, who guided me through all my research with his enthusiasm, passion and systematic training. Also, I want to thank all of my committee members for valuable comments. I thank all of my colleagues: Phyllis Pugh, Qiang Nai, Min Chen, Jason Dittus, Bo Hu, Xiaodong Wu, Hongbin Liu, and all other friends who have given me encouragement and support during my research period. ii

5 TABLE OF CONTENTS Acknowledgements Table of Contents ii iii Introduction 1 Literature 5 Manuscript Manuscript 1: 47 BDNF and trkb signaling in parasympathetic neurons: relevance to regulating α7-containing nicotinic receptors and synaptic function Manuscript 2: 108 Depolarization promotes survival of ciliary ganglion neurons by BDNF-dependent and independent mechanisms Discussion/Summary 143 References 149 Abstract 226 iii

6 INTRODUCTION The neurotrophin (NT) family is composed of a variety of neurotrophic factors, including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and neurotrophin-3 (NT-3). Both NTs and their specific receptors, the trypomyosin-related kinases (Trks) are widely expressed in the neuronal and non-neuronal tissues. The NT signaling has been implicated in various areas such as survival, differentiation, neurite outgrowth and synaptic plasticity. Among them, BDNF is one of most studied neurotrophins in regulating excitatory and inhibitory synapses, as well as in promoting the neuronal survival. Brain-derived neurotrophic factor was first purified from mammalian brain extracts, and named for its trophic effects on promoting the survival of sensory neurons in culture (Barde et al., 1982). Like other neurotrophins, BDNF signaling is mediated by its specific high-affinity receptor TrkB and the pan-neurotrophin receptor p75. Three major signaling pathways through TrkB have been identified to date: mitogen-activated protein kinase (MAPK) pathway, phospholipase C-γ1 (PLC-γ1) pathway and phosphatidylinositol-3 kinase (PI-3K) pathway (Barbacid, 1994; Huang and Reichardt, 2001). The BDNF has been implicated in regulating cholinergic synapses in the peripheral nervous system (PNS). The acute application of BDNF upregulates synaptic transmission of functional synapses in the neuromuscular junctions (NMJ) (Lohof et al., 1993; Boulanger and Poo, 1999a). The fact that NGF, another neurotrophin family member, 1

7 supported the expression and function of acetylcholine receptors (AChRs) in the sympathetic system (Henderson et al., 1994b; Yeh et al., 2001), further extended the idea that BDNF may be involved in the regulation of cholinergic synapses and AChRs of the parasympathetic system. The chick ciliary ganglion (CG) has been demonstrated as a good model for such studies of the parasympathetic system. Two populations of neurons, ciliary neurons and chroid neurons, exist in the CG, with distinct structural and functional profiles (Dryer, 1994). The CG neuron is a classic model in the study of nachrs because they express diverse nachrs with well-defined subunit composition (Vernallis et al., 1993) and channel properties (McNerney et al., 2000; Nai et al., 2003). One nachr type, α7 nachr containing only α7 subunits, is specifically recognized by α-bungarotoxin (αbgt) and the other major AChR type, α3*-achr containing α3, α5, β4 ± β2 subunits, is insensitive to αbgt, but recognized by mab35, an α5 subunit selective antibody (Conroy et al., 1992). The αbgt-sensitive nachrs mediate fast decaying whole-cell nicotinic currents, while α3 * -nachrs are responsible for slow decaying currents (Ullian et al., 1997; McNerney et al., 2000; Nai et al., 2003). Previous studies concluded that BDNF was irrelevant to CG neuronal survival. First, exogenous BDNF failed to promote CG neuron survival in culture. Second, mrna encoding TrkB, the major specific receptor for BDNF signaling, was undetectable in the ganglion (Rohrer and Sommer, 1983; Dechant et al., 1993b). However, it was possible that the detection methods were insufficiently sensitive and that BDNF may regulate other 2

8 neuronal properties besides neuronal survival. To have a better understanding of the role of BDNF in the parasympathetic system, we used CG neuronal culture to assess its effects. Contrary to previous findings, we demonstrated the expression of TrkB receptor and BDNF in developing CG neurons. The BDNF application upregulated the αbgt surface binding sites and mrna level of the α7 nachr subunits, indicating an increase in both mrna level and protein level. Moreover, BDNF elevated the amplitude of α7 nachr mediated whole cell current, as well as the frequency of spontaneous excitatory postsynaptic currents (sepscs). The BDNF-induced acute effects on synaptic transmission, however, were not mediated through α7 nachrs, suggesting an alternative pathway activated by BDNF/TrkB, e.g., PLC-γ1 pathway activation. More strinkingly, BDNF is required for the depolarization-induced survival of CG neurons in culture as well. Both the synthesis and the release of chicken BDNF was increased following the depolarization in culture. Application of BDNF antibody to block the endogenous BDNF function significantly decreased the survival rates of CG neurons in culture induced by the depolarization, indicating the requirement of such neurotrophin in the survival-promoting process. The coincidence between the decrease in the BDNF expression level and the decline in the survival rates of CG neurons from E8 to E14 further implies the potential role of BDNF in regulating the CG neuronal survival in vivo. It is the first time that BDNF was shown to regulate the AChR expression and function, the synaptic activity in AChRs-containing synapses, and neuronal survival of chicken CGs, 3

9 which may contribute to our better understanding of the development and regulation of this system during the embryogenesis. 4

10 LITERATURE Identification of Neurotrophic Factors and Their Receptors Neurotrophins (NTs) The NT family consists of NGF, BDNF, NT3, NT4/5, NT6 and NT7. The NGF, the first member identified in the early 1950s, provided neurotrophic supports and induced the fiber outgrowth on sympathetic neurons, as well as on sensory neurons. (Bueker, 1948; Levi-Montalcini and Hamburger, 1951, 1953). The fact that NGF is highly concentrated in mouse salivary glands as a soluble factor made it possible to produce a specific NGF antibody, which greatly facilitated subsequent studies on this molecule. It has been demonstrated that in supporting the sensory and sympathetic neuron survival, endogenous NGF is produced by their target cells (Davies et al., 1987), and the presence of NGF is essential for the survival of these neurons in the peripheral nervous system (Cohen, 1960; Johnson et al., 1980). Cloning of mouse and human NGF (Scott et al., 1983; Ullrich et al., 1983) was accomplished after new molecular techniques were introduced, and so was the characterization of the NGF receptor (Levi-Montalcini, 1987; Barbacid, 1994; Ultsch et al., 1999). About two decades after the NGF discovery, another interesting neurotrophic factor, now known as BDNF, was isolated from pig brain extracts. With its molecular size similar to that of NGF, BDNF also shares the very similar function, which supports the neuronal survival and neurite outgrowth of chick sensory neurons in the culture (Barde et al., 1982). However, unlike NGF, BDNF supported the survival of a variety of sensory neuron populations that are unresponsive to NGF, and also failed to support sympathetic or parasympathetic (e.g., CG) neuronal survival (Lindsay et al., 1985b; Davies et al., 5

11 1986b). Other members of the neurotrophin family such as NT-3 (Hohn et al., 1990) and NT-4/5 (Berkemeier et al., 1991; Hallbook et al., 1991) also were identified by molecular cloning techniques in the 1990s. More recently, NT6, found in the teleost fish Xiphophorus, distinguishes itself from the other members in the NT family as a protein molecule not found in the medium of producing cells (Gotz et al., 1994), while another neurotrophin homolog NT-7 was identified in fish by different groups recently (Lai et al., 1998; Nilsson et al., 1998; Dethleffsen et al., 2003). All genes except for NT-6 and NT-7 have been found in amphibians, reptiles and mammals (Hallbook et al., 1991). Homologous sequences to NGF, BDNF, NT-3 and NT4/5 also have been isolated in fishes such as salmon, zebrafish (Gotz et al., 1992; Hallbook et al., 1998; Dethleffsen et al., 2003). All mammalian NT genes encoding for NT family members appear to derive from the same ancestor NT gene. This gene underwent two subsequent duplications during the evolution, which finally caused the differentiation and formation of the gene family (Hallbook et al., 1998). The amino acide sequence among them (NGF, BDNF, NT-3 and NT4/5) shares high degree of homology and around 50% amino acid residues are common within all the neurotrophin genes. In avian species, genes of NGF, BDNF and NT-3 were identified so far, and chicken and mammalian BDNF share all but seven amino acid residues distributed along the whole sequence (Meier et al., 1986; Isackson et al., 1991; Maisonpierre et al., 1992a; Hallbook et al., 1993). 6

12 Mature monomer NT ( amino acids, 14kDa) derives from a precursor protein called pro-neurotrophin (approximately amino acids long) that undergoes the cleavage at dibasic amino acid residues (Angeletti and Bradshaw, 1971; Maisonpierre et al., 1990a). Common features of the NT family include: 1) a signal peptide following the initiation codon (Rosenthal et al., 1990; Ip et al., 1992); 2) a pro-region, including an N-linked glycosylation site and proteolytic cleavage site (Bresnahan et al., 1990; Seidah et al., 1996); 3) a distinctive three-dimensional domain formed by two pairs of anti-parallel β-strands, and six cystine residues forming three S-S bridges (Sun and Davies, 1995; Ibanez, 1998). Pro-region, containing ~120 amino acids located at the N-terminal, is cleaved by the so-called pro-protein convertases such as PC1/3, PC2 and furin (Khatib et al., 2002). The process of the cleavage happens in the either trans-golgi apparatus by furin or secretory granules by other pro-protein convertases to form mature forms of neurotrophins (Seidah et al., 1996). Further studies on the pro-region of neurotrophins suggest that it may be involved in the intracellular sorting, receptor trafficking and/or secretion of neurotrophins (Egan et al., 2003). Three S-S bridges and connecting residues form a cystine knot motif, which constitutes the core structure of neurotrophins (McDonald and Hendrickson, 1993). Due to its presence, NTs are able to form stable non-covalent homodimers with each other (active form, 28kDa). Evidence also shows that heterodimers can be formed between different NTs (Radziejewski and Robinson, 1993). The heterodimers comprised of BDNF and NT-3 is highly stable and indistinguishable from either BDNF or NT-3 homodimer in the ability of inducing the 7

13 neurite outgrowth of chicken DRG explants and the phosphorylation of Trk receptors (Arakawa et al., 1994). NT Receptors Two types of NT receptors have been identified so far: trypomyosin-related kinase receptor (Trk, known as TrkA, TrkB and TrkC) and p75 receptor (Chao, 1994; Bothwell, 1995). The TrkA receptor gene was first identified as a proto-oncogene coding a 140kDa membrane glycoprotein. Two related genes were named subsequently in the mammalian brain as TrkB (Klein et al., 1989) and TrkC (Lamballe et al., 1991). Each neurotrophin binds with high affinity to a specific Trk receptor: NGF binds to TrkA, BDNF and NT4/5 bind to TrkB, and NT3 mainly binds to TrkC but can bind also to TrkA and TrkB with lower affinity in biochemical assays (Hempstead et al., 1991; Klein et al., 1991a, b; Squinto et al., 1991; Klein et al., 1992; Urfer et al., 1995). The Trk receptor structure includes an extracellular ligand-binding domain, a transmembrane anchoring segment, and an intracellular domain with the protein-kinase activity (Haniu et al., 1997; Patapoutian and Reichardt, 2001). The extracellular domain contains a leucine-rich motif flanked by two cysteine-rich motifs, followed by two immunoglobulin (Ig)-like motifs. Based on previous studies of the NGF-TrkA binding, it is suggested that the second Ig motif is involved in the binding of neurotrophins to Trks with high affinities (Urfer et al., 1995; Holden et al., 1997), and the leucine repeat motif may also be involved (Windisch et al., 1995). The binding of neurotrophins to Trks leads to the receptor dimerization and autophosphorylation of tyrosine residues in the receptor intracellular domain 8

14 (Schlessinger and Ullrich, 1992). Active Trk receptor then recognizes and binds to src-homology-2 (SH-2) or phosphotyrosine-binding (PTB) motifs of some intracellular adapter proteins (Pawson and Nash, 2000). These target proteins coupled with Trk receptors trigger intracellular signaling cascades, which include Ras/ERK (extracellular signal-regulated kinase, also known as MAPK pathway (Boulton et al., 1991; Loeb et al., 1992), PLC-γ1 pathway (Stephens et al., 1994) and PI-3K pathway (Ohmichi et al., 1992). Activation of these pathways triggers other downstream molecules, for example, calcium/calmodulin-dependent kinase (CaMK) (Blaquet and Lamour, 1997) and cyclic AMP response element-binding protein (CREB) (Finkbeiner et al., 1997). The p75 receptor belongs to the tumor necrosis factor receptor (TNFR) superfamily and shares no homology with Trk receptors (Smith et al., 1994). It consists of four consecutive extracellular cystine-rich extracellular repeats (CRR), one transmembrane domain, and one unique intracellular motif also known as death domain that lacks the tyrosine kinase activity. p75 receptor is believed to bind neurotrophins through CRR2 and CRR3 domains. All mature neurotrophin molecules can be recognized by the p75 receptor with lower affinity (K d =10-9 M), compared to relatively high affinity by the Trk receptor (K d =10-11 M) (Sutter et al., 1979; Rodriguez-Tebar and Barde, 1988; Rodriguez-Tebar et al., 1992; Dechant et al., 1993b). Unexpectedly, pro-neurotrophins showed high affinity to bind p75 receptors, and are considered as one of the apoptotic ligands involved in the p75-mediated apoptosis (Lee et al., 2001). It is now demonstrated that the p75 receptor modulates TrkA and TrkB receptors (Verdi et al., 1994; Vesa et al., 2000) probably by 9

15 binding to the Trk receptors. Moreover, activation of the p75 receptor induces a apoptosis/survival-related signaling cascade (Dechant and Barde, 1997)., which may involve the activation of sphingomyelinase (Dobrowsky et al., 1994), NFκB (Carter et al., 1996) or c-jun N-terminal kinase (JNK) (Casaccia-Bonnefil et al., 1996). Different from the full length Trk receptors with the intrinsic tyrosine kinase activity, several isoforms of TrkB and TrkC, such as TrkB.T1 and TrkB.T2, lack tyrosine kinase domains (Klein et al., 1990; Tsoulfas et al., 1993; Valenzuela et al., 1993; Middlemas et al., 1994). Shortly after the detection of mammalian TrkB and TrkC isoforms, chicken TrkB and TrkC isoforms also were identified, respectively (Okazawa et al., 1993; Garner et al., 1996). The distinctive expression pattern of those Trk isoforms suggests their different roles in the specific period of the development. For example, full length TrkB is predominantly expressed during the embryogenesis, while TrkB.T1 is the most abundant isoform expressed in mammalian adult brains (Allendoerfer et al., 1994; Escandon et al., 1994; Armanini et al., 1995). Studies suggested that truncated Trk receptors mediate neurotrophin-dependent signaling cascades (Baxter et al., 1997), regulate neuron dendrite outgrowth (Yacoubian and Lo, 2000) or serve as dominant negative suppressors to the TrkB or TrkC signaling (Eide et al., 1996; Ninkina et al., 1996; Palko et al., 1999). The TrkA isoform, TrkA II, is a TrkA gene splicing variant that only has six amino acids less located at the extracellular domain compared to the full length TrkA gene. Function studies suggested that the two TrkA isoforms have similar biological properties in binding to NGF in fibroblast and PC12 cell lines (Klein et al., 1991a), but TrkA II has a 10

16 predominant expression pattern over TrkA I in neuronal cells while the latter has a unique expression pattern in non-neuronal cells (Barker et al., 1993). Other Neurotrophic Factors Although neurotrophin signalings have been implicated in promoting neuronal survivals in various systems, it is considered irrelevant to CG neuronal survival. Previous studies have demonstrated that the survival of CG neuron requires the activity of some other neurotrophic factors, such as ciliary neurotrophic factor (CNTF) and glial cell line-derived neurotrophic factor (GDNF). Chicken and mammalian CNTF were identified so far, with most of the studies performed on the mammalian form and its receptor complex. Chicken CNTF (also known as growth-promoting activity, i.e., GPA) was first purified from chick eye tissues (iris and ciliary body) and named after its effect in supporting the survival of embryonic chick ciliary ganglion neurons in vitro, as well as that of rodent sympathetic and sensory neurons (Nishi and Berg, 1981; Barbin et al., 1984; Manthorpe et al., 1985). Mammalian CNTF, purified from rat sciatic nerves, exerted similar trophic effects on sympathetic and ciliary ganglion neurons (Manthorpe et al., 1986). The CNTF receptor, CNTFα, widely expressed in both embryonic and adult brain, is essential for normal development and may be involved in postnatal and adult neuronal maintenance (Sendtner et al., 1994; MacLennan et al., 1996). The sequence of mammalian (rat, rabbit) and chicken CNTF (Lin et al., 1989; Stockli et al., 1989; Leung et al., 1992a) displays high homology with members of the hematopoietic cytokine superfamily such as interleukin-6 (IL6) and leukemia inhibitory factor (LIF) (Bazan, 1991), and the sequence CNTF-α also 11

17 shares high homology with the interleukin receptor IL-6α (Davis et al., 1991; Heller et al., 1995). Subsequent studies showed that like LIF and IL-6 signaling cascades, CNTF needs gp130 and LIFR, which bind to distinctive sites of this neurotrophic factor, to form tri-receptor-complex along with CNTF α (Davis et al., 1993a; Murakami et al., 1993). Lacking a cytoplasmic tyrosine kinase domain, the tripartite CNTF receptor recruits the JAK/Tyk family of intracellular tyrosine kinases, which in turn activates downstream signaling molecules such as signal transducers and activators of transcription (STAT) class of transcription factors (Akira et al., 1994; Stahl et al., 1994; Zhong et al., 1994). In fact, mammalian CNTF is commonly referred as a lesion-derived regeneration factor (Sendtner et al., 1994). The low expression level of mammalian CNTF in the peripheral targets (muscle and skin) at the embryonic stage suggests that CNTF is unlikely involved in the regulation of neuronal survival in the prenatal period (Manthorpe et al., 1986; Stockli et al., 1989), In addition, lesions of the facial nerve lead to more severe motor neuron degeneration in newborn mice compared with that in adult mice. The fact that exogenous application of CNTF prevented almost all motor neuron degeneration indicates that the CNTF level present in lesioned nerves determines the severity of the degeneration (Tetzlaff et al., 1988; Sendtner et al., 1990). This idea was further extended by the evidence that the expression levels of both CNTF and CNTF-α increased after injuries (Sendtner et al., 1992b; Davis et al., 1993b; Ip et al., 1993b). Chicken CNTF is not simply recognized as a mammalian CNTF homolog, despite its sequence similarity to the mammalian form because: 1) rat CNTF is expressed in adult animals but barely detectable 12

18 in the embryoes, while chicken CNTF is present at both embryonic and adult stages (Stockli et al., 1989; Leung et al., 1992a; Finn and Nishi, 1996); 2) mammalian CNTF is a non-secreted protein while chicken CNTF could be easily secreted from transfected cells (Lin et al., 1989; Sendtner et al., 1990; Reiness et al., 2001). Thus, chicken CNTF is probably more involved in support of the neuronal survival than its mammalian form in vivo. Glial-cell-line-derived neurotrophic factor was purified and characterized in 1993 as a growth factor promoting the survival of embryonic dopaminergic neurons of the midbrain (Lin et al., 1993). Subsequently, it was shown that GDNF is also a trophic factor for noradrenergic neurons and spinal motoneurons (Henderson et al., 1994a; Arenas et al., 1995). The fact that GDNF was much more potent than neurotrophins in supporting motorneuron survival in vitro and in vivo and noradrenergic neuron survival in the CNS in vivo suggest that it may act as a physiological neurotrophic factor to prevent neuronal death. In addition to the effects in the CNS, application of GDNF promoted the survival of several PNS neuron populations in vitro, including sympathetic, parasympathetic (e.g., CG) and sensory neurons (Buj-Bello et al., 1995; Forgie et al., 1999; Hashino et al., 1999). Despite the low homology in amino acid sequence, GDNF belongs to the transforming growth factor-β (TGF-β) superfamily, and contains seven cysteine residues that are distributed with the same relative spacing as other members of this family (Lin et al., 1993; Ibanez, 1998), A few other family members are neurturin (NRTN) (Kotzbauer et al., 1996), persephin (PSPN) (Milbrandt et al., 1998) and artemin (ARTN) (Baloh et al., 13

19 1998), which share similar functions with GDNF. The cellular response to GDNF family members is mainly mediated by a bi-receptor-complex composed of ret proto-oncogene (RET) receptor tyrosine kinase (Durbec et al., 1996a; Trupp et al., 1996; Vega et al., 1996) and glycosyl phosphatidylinositol (GPI)-linked GDNF family receptor α (GFRα), the latter of which determines the specificity of binding with GDNF family ligand (Scott and Ibanez, 2001). Four GPI-linked receptors have been cloned so far and designated as GFR 1 (Jing et al., 1996; Treanor et al., 1996), GFR 2 (Baloh et al., 1997; Klein et al., 1997), GFR 3 (Jing et al., 1997; Baloh et al., 1998), and GFR 4 (Thompson et al., 1998). Previous evidence suggested that GDNF, NRTN, ARTN, and PSPN have the highest binding affinity for GFR 1, GFR 2, GFR 3, and GFR 4, respectively (Baloh et al., 1997, 1998; Jing et al., 1997; Thompson et al., 1998). Interestingly some recent evidence also suggested that GDNF may initiate its signaling cascade independent of RET, e.g., GDNF triggers Src-family kinase and ERK/MAPK activation in RET-deficient mice (Poteryaev et al., 1999; Trupp et al., 1999). The binding of GDNF dimer to GFRα recruits the RET receptor to the complex and triggers tyrosine phosphorylation within its specific domains and subsequent intracellular signaling (Airaksinen et al., 1999; Baloh et al., 2000; Airaksinen and Saarma, 2002). Like other receptor tyrosine kinases, phosphorylated RET receptor activates a variety of downstream signaling molecules such as MAPK, PI-3K and c-jun N-terminal kinase (JNK) (Worby et al., 1996; Chiariello et al., 1998; Segouffin-Cariou and Billaud, 2000). Similar pathways utilized in NT/Trk signaling cascades are activated by RET signaling as well, including the MAP kinase pathway involved in the neurite outgrowth and survival (Fisher et al., 2001), the PI-3K pathway 14

20 crucial for neuronal survival (Soler et al., 1999) and the PLC-γ1 pathway (Borrello et al., 1996). Interestingly, the survival effects promoted by GDNF in vitro and in vivo, except for motoneurons, requires the presence of TGF-β (Peterziel et al., 2002). Despite the survival promoting effects induced by CNTF and GDNF in the chick CG system, and both CNTF and GDNF are expressed in CG target tissues (Barbin et al., 1984; Buj-Bello et al., 1995), neither of them is likely to act as the only neurotrophic factor required in CG neuron survival in vivo for a couple of reasons: 1) the response of CG neurons to CNTF decreased gradually with age during the embryonic stage (Buj-Bello et al., 1995; Heller et al., 1995); 2) GDNF expression peaks and gradually decreases before the onset of cell death at embryonic day 8 (E8), and the expression level of GFR 1 significantly decreased from E8 to E14 (Buj-Bello et al., 1995; Hashino et al., 2001). These findings above suggest that additional neurotrophic factor(s) are required to rescue CG neurons from the regular cell death in vivo. 15

21 Figure 1. Structure Illustration of Multicomponent Receptor System of Neurotrophic Factors (adapted from Ibanez, 1998 review in Trends in Neurosci, 21, ) Nerve growth factor (NGF) binds separately to the p75 neurotrophin receptor (p75 NTR ) and to TrkA. Interaction between ligand-bound TrkA and p75 NTR have been proposed. GDNF binds to a complex formed by GFRα-1 and RET. In this complex, GFRα-1 is essential for ligand binding. CNTF interacts with a tripartite receptor complex formed by CNTFα and two signal-transducing β-component, LIF- β and gp

22 Neurotrophin Expression and Regulation Expression Pattern Mature neurotrophins are expressed in a variety of tissues, including both nervous system and peripheral tissues. The NGF and BDNF expression have been shown not only in the CNS region such as hippocampus and cortex, but also in spleen and heart as well (Tirassa et al., 2000). The NT-3 mrna is not only consistently expressed in the hippocampal area of adult rat brain, but also present transiently in the cingulate cortex in the first 2 wk of the embryogenesis, suggesting its potential role in the neurogenesis and differentiation (Friedman et al., 1991). NT-4 mrna as well as BDNF mrna is detectable in hippocampus, cortex, cerebellum, brainstem and peripheral tissues (heart, lung and kidney) in rats (Timmusk et al., 1993b). As the first identified neurotrophin member from brain extracts, BDNF mrna and protein are widely expressed in the CNS, such as the hippocampal formation, amygdaloid complex, claustrum, cerebral cortex, cerebellum, spinal cord, and retinal ganglion cells/optic tectum (Phillips et al., 1990; Herzog et al., 1994; Herzog and von Bartheld, 1998; Nishio et al., 1998; Ferrer et al., 1999; Soontornniyomkij et al., 1999), and the expression level increases gradually until reaching the maximum after the birth (Schecterson and Bothwell, 1992). In the PNS, BDNF is present in dorsal root ganglia (Ernfors et al., 1990), which is believed to contribute to the survival of these source neurons, respectively (Schecterson and Bothwell, 1992). Although the expression pattern of neurotrophins in mammalian species is strikingly similar, variance occurs in some non-mammalian species, for example, BDNF, in place of 17

23 NT3, predominates in avian cochlea and is believed to support neuronal survival and development in such regions (Pirvola et al., 1997). The presence of TrkA mrna is confined to the sensory cranial (trigeminal, superior, jugular) and dorsal root ganglia (DRG) of neural crest origin in mouse embryos (Martin-Zanca et al., 1990), suggesting that TrkA plays an important role in the neurogenesis. TrkB and TrkC mrnas are widely expressed throughout the brain regions, such as hippocampus, neocortex, brainstem nuclei, spinal cord motorneuron, olfactory formation, while TrkA mrnas are expressed in more restricted areas such as cholinergic neurons in basal forebrain (Merlio et al., 1992). Interestingly, TrkB and TrkC mrna expression in the embryonic CNS have both overlapping and exclusive patterns compared to each other. A wide expression pattern of TrkB protein also was observed in rat CNS, implying a broad role of TrkB (Yan et al., 1997). In the peripheral nervous system (PNS), TrkB and TrkC mrnas are much less abundant in DRG and trigeminal neurons in the early development compared to TrkA mrna expression (Martin-Zanca et al., 1990; Carroll et al., 1992). More importantly, Kokaia and colleagues used in situ hybridization to show mrnas of BDNF and TrkB were coexpressed in hippocampal and cortical neurons (Kokaia et al., 1993). Similar results demonstrated the mrna colocalization of p75 receptor with NGF/BDNF/NT3, TrkA with NGF and TrkB with BDNF in cerebral cortex, hippocampal formation, anterior and lateral hypothalamus regions, implying the potential autocrine and/or paracrine interaction between NTs and Trk receptors (Miranda et al., 1993). 18

24 Table I. Expression of Neurotrophins in Mammalian Central Nervous System. Reference list for Table I: a.(martin-zanca et al., 1990) b.(arumae et al., 1993) c.(huang et al., 1999a) d.(ozdinler et al., 2005) e.(obata et al., 2004) f.(wetmore and Olson, 1995) g.(rifkin et al., 2000) h.(josephson et al., 2001) i.(wyatt et al., 1999) j.(maclennan et al., 1996) k.(palmada et al., 2002) l.(yamashita et al., 1999c) m.(ip et al., 1993b) n.(escandon et al., 1994) o.(johnson et al., 1999) p.(tirassa et al., 2000) q.(moore et al., 2004) r.(shelton et al., 1995) s.(miranda et al., 1993) t.(fagan et al., 1996) u.(yan et al., 1997) v.(zhou and Rush, 1994) w.(friedman et al., 1991) Activity-Dependent Expression It is well established that both neurotrophin and Trk expression are activity-dependent. The expression of NGF and BDNF in the brain was upregulated significantly following the administration of kainic acid or a high concentration of extracellular KCl to increase the neuronal activity (Zafra et al., 1990; Ballarin et al., 1991; Gall et al., 1991). In addition to long-duration seizures, brief focal hippocampal seizures induced by the electrical kindling stimulation leads to an increase in the level of NGF and BDNF mrna in the hippocampus and amygdaloid complex (Ernfors et al., 1991). Non-NMDA receptors were demonstrated to be responsible for the upregulation of BDNF mrnas in the basal forebrain area, since NBQX, a non-nmda receptor antagonist, partially blocked the effect. No significant change occurred after the application of MK-801 (NMDA receptor 19

25 specific antagonist) following induced ischemia (Lindvall et al., 1992) or the administration of kainic acid, a non-nmda receptor agonist (Zafra et al., 1990). In hippocampus, however, application of MK-801 in vitro and in vivo both significantly decreased BDNF mrna level and NGF mrna and protein expression (Zafra et al., 1991). The evidence above suggested the involvement of both NMDA and non-nmda receptors in the regulation of BDNF expression, while the contradictory results concerning the role of non-nmda receptor may be explained as the difference between the physiological condition and the experimental condition. Confirmatory results demonstrated the increase in the level of NGF and BDNF protein induced by seizures (Bengzon et al., 1992; Nawa et al., 1995; Smith et al., 1997). The cholinergic activation also plays an important role in regulating NGF and BDNF expression levels. Application of muscarinic AChR agonists increased the expression of both NGF and BDNF in rat hippocampal neurons in vitro (Zafra et al., 1990). Intraperitoneal injection of pilocarpine, a muscarinic receptor agonist, increased BDNF and NGF mrna level in postnatal rat hippocampus, and the effects were blocked by the administration of cholinergic receptor antagonist scopolamine (Berzaghi et al., 1993; Knipper et al., 1994a). Removal of cholinergic inputs from septum to hippocampus also decreased the level of BDNF and NGF mrna in hippocampus, implying the involvement of the cholinergic system in the regulation of neurotrophin expressions (Berzaghi et al., 1993; Lapchak et al., 1993). Inhibition of gamma-aminobutyric acid (GABA) receptor GABA A with bicuculline or pentylenetetrazol increased BDNF mrna levels in hippocampal neurons in culture (Zafra et al., 1991; Humpel et al., 1993); while when GABA A receptors act as an excitatory 20

26 transmission system at the embryonic stage, both GABA and the GABA A receptor agonist muscimol induced the increase of BDNF mrna in rat hippocampal neurons in vitro (Berninger et al., 1995). These results above suggest that activation of glutamergic and/or cholinergic systems upregulates the neurotrophin mrna level while enhanced GABAergic transmission may suppress the neurotrophin expression. As for the underlying mechanism for the activity-dependent BDNF expression, Timmusk and colleagues discovered that for the rat BDNF gene, four short untranslated 5 exons and one 3 exon encoding the mature BDNF are present with a separate promoter upstream of each 5 exons, respectively. Promoter I, II and III are mainly present in the brain while promoter IV is more active in the peripheral tissues such as lung and heart. The BDNF mrnas transcribed from promoter I-III are upregulated in hippocampal neurons and cortical neurons following neuronal activations (Metsis et al., 1993; Timmusk et al., 1993a; Kokaia et al., 1994). Confirmatory results demonstrated that different promoter regions are responsible for the tissue specific distribution and regulation of different BDNF transcripts in vivo (Timmusk et al., 1995). The existence of multiple BDNF promoters may be involved in controlling BDNF transcription, mrna stability, translation and post-translational modification, subcellular location, and hence BDNF function. An increase in the intracellular Ca 2+ concentration has been suggested to play an essential role in regulating BDNF expression (Zafra et al., 1992; Ghosh et al., 1994; Berninger et al., 1995), possibly caused by the calcium influx through L-type Ca 2+ channels and/or NMDA receptors (Zafra et al., 1991; Shieh et al., 1998; Tao et al., 1998). 21

27 Consistent with that idea, two elements upstream of promoter III, called cyclic AMP-responsive element (CRE) and Ca 2+ -responsive sequence 1 (CaRE1) were identified recently (Shieh et al., 1998; Tao et al., 2002). The binding of CREB to CRE, which is initiated by the activation of CaM-kinase IV following the calcium influx, and binding of a novel transcription factor CaRF to CaRE1, are implicated in the activity-regulated BDNF expression. Subsequent work demonstrated that long-term potentiation induced by electrical stimulation also increased BDNF and NGF mrna expression in hippocampal formation (Castren et al., 1993; Dragunow et al., 1993; Bramham et al., 1996). Moreover, it is also clearly indicated that other types of sensory stimulation caused an increase in BDNF mrna expression in the corresponding target regions of the brain. For example, the light activation upregulated BDNF expression in rat visual cortex (Castren et al., 1992) and the whisker stimulation induced a change in BDNF expression in somatosensory cortex (Rocamora et al., 1996). Furthermore, neurotrophin expression was modified by insults, including an increased expression in NGF and BDNF following ischemia and hypoglycemic coma (Lindvall et al., 1992; Merlio et al., 1993) and lesions in the peripheral and central nervous system (Meyer et al., 1992; Berzaghi et al., 1993). The regulation of NGF and BDNF mrna levels may require different signaling cascades. It has been reported that NBQX partially blocked the increase of BDNF mrna level but not that of NGF (Lindvall et al., 1992). The application of cytokines increased NGF 22

28 mrna and protein levels in non-neuronal cells but induced no significant changes in the level of BDNF mrna (Zafra et al., 1992). Moreover, the time-course and spatial pattern of BDNF mrna expression were distinctly different from those of NGF mrna after sciatic nerve lesions in the PNS (Meyer et al., 1992). Unlike the activity-dependent pattern of NGF and BDNF expression, NT3 mrna expression showed mixed results following increased neuronal activities (Lindvall et al., 1992; Patterson et al., 1992; Berzaghi et al., 1993; Castren et al., 1993; Bramham et al., 1996). Notably, NT3 was demonstrated to have an activity-dependent expression pattern in the muscle cells of neuromuscular junction in vitro after the electrical stimulation or ACh application, implying its potential role in the development of neuromuscular synapses (Xie et al., 1997). Like neurotrophins, Trk receptor expression also could be regulated by bioelectrical activities, hypoxia-ischemia and axotomy. Studies have shown increases in TrkB mrna level and TrkB protein-like immunoreactivity in the injured rat and cat spinal cord (Frisen et al., 1992), upregulation of TrkB mrna and protein in the hippocampus after kindlinginduced seizure and cerebral ischemia (Merlio et al., 1993), and rapid increase of TrkB and TrkC mrna level following the long-term potentiation (LTP) induction (Bramham et al., 1996). Besides full length Trk receptors, truncated TrkB receptor mrna and/or protein expression also was upregulated by neuronal activities or injuries (Beck et al., 1993; Merlio et al., 1993). 23

29 Interestingly, BDNF expression in chicken is also regulated by activities, similar to that in mammalians. The mrna expression of BDNF in chicken retinal ganglion cells (RGCs) and optic tectum was upregulated by the intraocular injection of kainic acid but was blocked by the application of tetrotoxin (Herzog et al., 1994; Karlsson and Hallboos, 1998). Also, BDNF mrna level was significantly upregulated in avian hypothalamus slices following the exposure to high concentration of potassium choloride (Viant et al., 2000), indicating the activity-dependent pattern present both in vivo and in vitro. However, most of the studies on the regulation of BDNF expression in chicken focused on the visual system, it is still unclear whether this pattern applies in other systems as well. Neurotrophin/Trk Signaling Pathways Most of the neurotrophin-induced signaling cascades go thorugh Trk receptors. The binding of neurotrophin homodimer to Trks causes the receptor dimerization, and autophosphorylation on tyrosine residues in the activation loop within the Trks (Heldin, 1995; Cunningham et al., 1997). Phosphorylated tyrosine residues as docking sites then recruit downstream signaling molecules such as MAPK, PI-3K and PLC-γ1, which are essential for a variety of neurotrophin-induced functions (Segal and Greenberg, 1996b; Huang and Reichardt, 2001). In the MAPK pathway, upon neurotrophin binding, the adaptor protein Shc binds to one specific phosphorylated tyrosine residue within Trk, which recruits Grb2 and the son of sevenless (SOS), an exchange factor for Ras (Nimnual et al., 1998), at the membrane, and 24

30 hence, leads to the activation of Ras and a series of downstream signaling molecules such as Raf, p38 MAPK, and PI-3K (Stephens et al., 1994; Xing et al., 1996; Klesse and Parada, 1998; Atwal et al., 2000). The activation of ERK1 and ERK2 requires the sequential activation of MEK1 and/or MEK2 by Raf, followed by the ERK1/ERK2 phosphorylation induced by MEK1/MEK2 (Robinson and Cobb, 1997). Another adaptor protein, fibroblast growth factor receptor substrate-2 (FRS-2), binds to the same tyrosine residue where Shc adaptor protein binds. The FRS-2 provides binding sites for additional signaling molecules including Grb2, Crk and Shp2, the last of which is essential for NGF-dependent activation of the MAPK pathway (Wright et al., 1997). Binding of FRS-2 to Trk, associated with Crk, results in the activation of guanyl nucleotide exchange factor, C3G, followed by Rap1 activation, which stimulates the downstream MAPK cascade and is involved in sustained MAPK activity (York et al., 1998; Nosaka et al., 1999). Compared with the Ras-Raf-MEK-ERK pathway which mediates transient activation of MAPK and leads to the cell proliferation, FRS-2-C3G-Rap1-MAPK pathway is more likely to induce the cell differentiation (Kouhara et al., 1997; Meakin et al., 1999). The activation of Ras, first neurotrophin-activated small GTP-binding protein shown to support neuronal survival, regulates a variety of cell signaling events, such as cell survival, differentiation and synaptic plasticity, through the activation of MAPKs (Xia et al., 1995; English and Sweatt, 1997; Impey et al., 1998). Increased Ras activity as a result of NF1 (Ras regulatory inhibitor) deletion, allowed neurons in the PNS to survive with no need of neurotrophins (Vogel et al., 1995), whereas inhibition of Ras activity decreased the survival rate of most populations of sympathetic neurons (Borasio et al., 1993; Nobes and 25

31 Tolkovsky, 1995). Ras does not directly act to promote survival; however, it functions through downstream signaling molecules such as ERKs (mainly ERK1/2) to support the survival of certain populations of neurons against insults (Xia et al., 1995; Meyer-Franke et al., 1998; Anderson and Tolkovsky, 1999; Hetman et al., 1999). Besides the involvement of well-studied ERK1/2 pathway, one novel neurotrophin signaling pathway through ERK-5 was recently demonstrated in the neurotrophin-induced neuroprotection of cortical, cerebellar and DRG neurons (Cavanaugh et al., 2001; Watson et al., 2001; Liu et al., 2003; Shalizi et al., 2003). It is believed that MAPK pathway induces the cell survival by stimulating the activity or the expression of anti-apoptotic proteins such as Bcl-2 and CREB. The inactivation of Bcl-2 induced the occurrence of progressive degeneration in motorneurons, sensory and sympathetic neurons (Michaelidis et al., 1996) which also suppressed the BDNF-induced survival response (Allsopp et al., 1995). The evidence that the expression level of this anti-apoptotic protein increased upon NGF treatment complies with its support role in mediating the neurotrophin-induced neuronal survival (Aloyz et al., 1998). The CREB, a camp and calcium regulated transcription factor (Finkbeiner et al., 1997), is also a crucial factor in the neurotrophin-induced survival because the disruption of either CREB phosphorylation or CREB binding sites to DNA lead to a significant decrease in the survival induced by NGF and BDNF (Bonni et al., 1999; Riccio et al., 1999). More importantly, Bcl-2 expression is regulated by CREB activity in NGF-induced survival of sympathetic neurons, suggesting a potential MAPK-CREB-Bcl-2 pathway (Riccio et al., 1999). 26

32 Besides the MAPK signaling pathway, PI-3K/Akt pathway activated by neurotrophins has an essential role in supporting neuronal survival as well. PI-3K was first identified as a regulator involved in the NGF-promoted PC12 cell survival (Yao and Cooper, 1995). The activation of PI-3K occurs through either Ras-dependent or Ras-independent pathways (Huang and Reichardt, 2001). To date plenty of evidence has shown the intimate connection between Ras and PI-3K: Ras directly interacted with PI-3K and the inhibition of Ras knocked down the PI-3K activity induced by neurotrophins (Rodriguez-Viciana et al., 1994); moreover, introduction of Ras mutants, which selectively activate the PI-3K pathway, induced neuronal survival in the sympathetic system while Ras-mediated survival was blocked by the PI-3K inhibitor, LY (Klesse and Parada, 1998; Mazzoni et al., 1999). In addition the PI-3K pathway was activated by a Ras-independent pathway, which involves a Shc-Grb2 complex containing insulin receptor substrates 1 (IRS-1), IRS-2 and Grb-associated binder-1 (Gab-1) (Nguyen et al., 1997; Yamada et al., 1997). The complex induces the association and activation of PI-3K that in turn stimulates downstream molecules at the inner membrane as a result of ligand-regulated protein-protein interaction. Within this complex, Gab-1 as an adapter protein binds and activates PI-3K (Holgado-Madruga et al., 1997) and overexpression of Gab-1 potently stimulated the cell survival independent of NGF (Korhonen et al., 1999). Phospholipids generated by active PI-3K recruits serine/threonine kinases 3-phosphoinositide-dependent kinase-1 (PDK1) (Alessi et al., 1997) and a region of protein kinase C-related kinase-2 (PRK-2) (Balendran et al., 1999) to the plasma membrane, which phosphorylates and activates downstream protein kinase B (PKB, i.e., Akt) (Bellacosa et al., 1991; Jones et al., 27

33 1991). Active Akt, in turn, phosphorylates substrates that regulate neuronal survival, such as Bcl-2 antagonist of cell death (BAD), caspase 9, IκB kinase, glycogen synthase kinase 3-β (GSK3β), and forkhead transcription factor (FKHRL1) (Datta et al., 1997; del Peso et al., 1997; Cardone et al., 1998; Brunet et al., 1999; Kane et al., 1999; Hetman et al., 2000; Brunet et al., 2002). For example, phosphorylation on BAD by Akt disrupts the original interaction between BAD and Bcl-XL and the release of Bcl-XL suppresses the activity of Bax, a proapoptotic protein. The phosphorylation of IκB releases active NF-κB, which forms a complex with IκB in the basal condition, and in turn activates the expression of genes responsible for supporting the cell survival (Foehr et al., 2000; Wooten et al., 2001). Phosphorylation of FKHRL1 by Akt forms a complex with , which is exported from the nucleus to the cytoplasm and suppresses the ability of FKHRL1 to promote the expression of proapoptotic proteins. Although both MAPK/ERK and PI-3K/Akt pathways are involved in supporting the neuronal survival, it is believed that the activation of PI-3K is required for the basal survival while the MAPK pathway is involved in neuroprotections under insults (Hetman et al., 1999). As the major signaling pathway responsible for supporting the neuronal survival, PI-3K/Akt activation has been implicated in supporting as much as 80% of neurotrophin-regulated neuronal survival in cerebellar, cortical, sympathetic and sensory systems (D'Mello et al., 1997; Dudek et al., 1997; Crowder and Freeman, 1998; Klesse and Parada, 1998; Hetman et al., 1999; Vaillant et al., 1999). Moreover, some additional signaling molecules are activated by PI-3K/PDK1, such as p70, an enzyme critical for the cell-cycle progression through the G1 phase, implying that it 28

34 regulates other cellular events besides merely supporting the neuronal survival (Alessi et al., 1998). The phosphorylation and activation of PLC-γ1 has been reported following the neurotrophin treatment on PC12 cells and primary neuronal culture in the early 1990s (Vetter et al., 1991; Widmer et al., 1993). PLC-γ1 was found to bind at phospho-tyrosine residue 785 or 490 of TrkA receptor (Obermeier et al., 1993; Stephens et al., 1994; Yamashita et al., 1999a). and phospho-tyrosine residue 816 in the juxtamembrane domain of TrkB receptor (Middlemas et al., 1994; Minichiello et al., 1998). Active PLC-γ1 is known to increase the production of inositol tris-phosphate (IP3) and DAG. Binding of IP3 to IP3 receptors induces calcium release from the endoplasmic reticulum (ER), the internal calcium store, to the cytoplasm, which initiates a series of calcium-dependent signaling cascades, such as activation of CaMK and camodulin; while DAG activates PKC signaling pathways (Patapoutian and Reichardt, 2001). Both calcium/calmodulin and Ras/MAPK pathways are able to activate the transcription factor CREB (Bito et al., 1996; Deisseroth et al., 1996; Finkbeiner et al., 1997), CREB has been implicated in the gene expression and long lasting regulation of synapses (Silva et al., 1998; West et al., 2001). PLC-γ1 itself has been implicated in quite a few areas as well, such as neurotrophin-mediated neurotrophin release, depolarization-evoked glutamate release (Canossa et al., 1997; Matsumoto et al., 2001), growth cone guidance (Ming et al., 1999) and synaptic plasticity (Minichiello et al., 2002) 29

35 Besides its crucial role in mammalians, BDNF has been implicated in a variety of developmental process in chickens as well. For example, BDNF/TrkB signaling is essential for the survival of embryonic motorneurons and sensory neurons (Lindsay et al., 1985b; Kalcheim et al., 1987; Oppenheim et al., 1992; Becker et al., 1998) and the maturation of sensory neurons (Wright et al., 1992). However, few lines of evidence has elucidated the specific downstream molecules involved in the chicken BDNF/TrkB signaling (Borasio et al., 1993; Becker et al., 1998; Dolcet et al., 1999), especially in the parasympathetic system. Thus it is interesting to explore more into this unknown area in avians for better understanding of BDNF signaling cascade and the regular development of chicken embryoes. Neurotrophin Function Neuronal Survival Sympathetic Ganglia Neurotrophins were named after their effects in promoting the neuronal survival. Cohen and colleagues first demonstrated that the application of NGF antibody impaired the survival of sympathetic neurons (Cohen, 1960), and subsequent studies in vitro further demonstrated the essential role of NGF in the survival, development and differentiation of sympathetic neurons (Chun and Patterson, 1977; Coughlin et al., 1977). Knockout of either NGF or TrkA genes in mice confirmed the survival-promoting effects of NGF/TrkA signalings on sympathetic neurons in vivo (Crowley et al., 1994; Smeyne et al., 1994; Fagan et al., 1996). The NGF was believed to be synthesized in target sites and 30

36 retrogradely transported back the cell body to exert its neurotrophic effects, in both rodents (Hendry et al., 1974; Stockel et al., 1974; Claude et al., 1982) and avian (Brunso-Bechtold and Hamburger, 1979). Interestingly at early stages of the embryogenesis, only TrkC is expressed in sympathetic ganglions, while at later stages, postmitotic neurons express TrkA and require NGF to support the neuronal survival (Fagan et al., 1996). Consistent with the finding that TrkA and TrkC expression are reciprocally regulated, it is not surprising that NT-3 rather than NGF was able to rescue about half of the cell loss of sympathetic neurons in culture, possibly through TrkC receptors, before they became NGF-dependent (Birren et al., 1993; Dechant et al., 1993c). In accord with in vitro evidence, the removal of NT3 gene function by either the knockout technique or the application of NT3 antisera caused the significant cell loss of symapathetic neurons, indicating the requirement of endogenous NT-3 to support the neuronal survival in vivo (Ernfors et al., 1994b; Farinas et al., 1994; Zhou and Rush, 1995; Francis et al., 1999). Thus, these data above indicate that NT-3 and NGF are both required for the survival of sympathetic neurons. Surprisingly TrkC-/- mice displayed no significant changes in cell numbers of sympathetic ganglia, possibly under the mechanism that NT3 initiates its signaling cascade mediated by TrkA and/or TrkB receptors (Fagan et al., 1996; Tessarollo et al., 1997). The CNTF and GDNF, two other members of the neurotrophic factor family, both support sympathetic neuronal survival in vitro (Barbin et al., 1984; Saadat et al., 1989; Eckenstein et al., 1990; Buj-Bello et al., 1995; Trupp et al., 1995) but display very different functions in vivo. For example, the injection of CNTF directly into animals had no effects on rescuing sympathetic neuron loss, while 31

37 GDNF-deficient mice had 35% fewer neurons present in sympathetic ganglia at birth (Oppenheim et al., 1991; Moore et al., 1996). Consistenly mice lacking GDNF receptor Ret nearly lost all the neurons of superior cervical ganglion (SCG) (Durbec et al., 1996b). Sensory Ganglia As one of the extensively studied neuron populations regarding the survival-promoting effects of neurotrophins, sensory neurons contain different subtypes of cells that display a specific neurotrophin-dependency. Among them DRG have been very useful in correlating different neurotrophins to subpopulations of neurons based on their physiological properties and connections. The application of NGF supported chick DRG and trigeminal (neural crest-derived) sensory neurons in culture (Davies and Lindsay, 1984). Consistently the disruption of NGF or TrkA gene functions in the animal models caused severe deficiency in both of these neuron populations. In DRG neurons, the injection of NGF antibody induced major cell death in small diameter neurons that presumably serve in the nociception and thermoreception (Ruit et al., 1992). This was confirmed by the findings that both trka-/- and ngf-/- mice showed severe cell loss of same subpopulations of DRG neurons, lacked afferents to both peripheral and central targets, and were insensitive to pain (Crowley et al., 1994; Smeyne et al., 1994; Indo et al., 1996). The BDNF was first identified by its survival-promoting effects on subpopulations of sensory neurons which did not respond to NGF (Barde et al., 1982). It has been demonstrated that neurons derived from neural placodes (neurons of the ventrolateral portion of the trigeminal ganglion and the entire neuronal population of the vestibular, 32

38 geniculate, petrosal and nodose ganglia) are largely unresponsive to NGF throughout the embryogenesis (Lindsay et al., 1985a). Knockout mice carrying mutations in the BDNF or TrkB gene showed different extents of cell loss in such neuronal subpopulations (Ernfors et al., 1994a; Jones et al., 1994), in accord with the findings in vitro (Lindsay et al., 1985b; Davies et al., 1986a; Avila et al., 1993). Neurotrophin-4, which shares the same Trk receptor with BDNF, was suggested to support the survival of some types of the sensory ganglia (nodose-petrosal and geniculate ganglia) (Conover et al., 1995; Liu et al., 1995). The BDNF and TrkB null mutations are lethal, whereas NT4-/- animals are viable, implying the distinct physiological roles of BDNF and NT4 in vivo. In accordance with such an idea, bdnf-/- animals lacked slow adapting mechanoreceptors while nt4-/- mice demonstrated severe impairments in down-hair receptors on cutaneous sensory neurons (Carroll et al., 1998; Stucky et al., 1998). The neurotrophin-dependency switch also occurs in trigeminal sensory ganglia, similar to that in sympathetic ganglia. Neurons were transiently dependent on BDNF and NT-3 for the survival before they switched to NGF-dependent (Buchman and Davies, 1993; Buj-Bello et al., 1994). The application of NT3 rescued some types of primary sensory neurons in vitro (Hohn et al., 1990; Maisonpierre et al., 1990a; Rosenthal et al., 1990; Hory-Lee et al., 1993). The mutation in NT-3 gene demonstrated dramatic cell loss in sensory neuron populations, largely in cochlear ganglia, trigeminal ganglia, and DRG (Farinas et al., 1994; Liebl et al., 1997), most of which, except for cochlear ganglia, demonstrated severe cell loss in bdnf-/- and trkb-/- mice as well. Neurons missing in DRG were mostly proprioceptive neurons expressing TrkC receptors, and it is not surprising that NT3 mutants had abnormal limb 33

39 postures showing the apparent deficiency in the sense of position. Mice mutated in the TrkC gene, however, showed less severe impairments in sensory ganglia compared with NT-3 mutants (Liebl et al., 1997), possibly due to compensatory signaling pathways mediated by TrkA and/or TrkB receptors (Davies et al., 1995; Farinas et al., 1998). Motor Neurons Both BDNF and NT3 are expressed in the developing motor muscles. Motor neurons express both TrkB and TrkC receptors, suggesting the potential role of both neurotrophins in the developing motor system (Maisonpierre et al., 1990b; Henderson et al., 1993; Koliatsos et al., 1993; Yan et al., 1993). The survival of motor neurons was supported by BDNF, NT4/5 and NT3 in culture (Henderson et al., 1993), and the application of BDNF was able to rescue avian and rat motor neurons from the cell death after the axotomy in vivo (Oppenheim et al., 1992; Sendtner et al., 1992a; Koliatsos et al., 1993). In knockout mice, BDNF and TrkB mutants displayed distinct phenotypes: no difference was shown in the motor neuron number and muscle innervation between wild-type animals and bdnf-/- animals. On the other hand, TrkB mutation caused dramatic cell loss in the facial motor nucleus and spinal cord, and severe deficiency in the feeding activity (Klein et al., 1993; Jones et al., 1994), suggesting that TrkB may act as a receptor for neurotrophins other than BDNF in the regulation of motor neurons in vivo. The mutation in NT4 gene displayed no significant decrease in the cell number of motor neurons (Conover et al., 1995; Liu et al., 1995), as well as the mutation in NT3 gene (Farinas et al., 1994), which may be explained as the functional redundancy of neurotrophins on this single neuron population. In 34

40 addition, most homozygous mutants in NT3 or TrkC gene lacked Ia afferents projections from sensory ganglia to spinal motor neurons (Ernfors et al., 1994b; Klein et al., 1994; Tessarollo et al., 1994), indicating that sensory ganglia dependent on NT3/TrkC may play the role in proprioception, the sense of position and movements of limbs. Further study supported this idea by demonstrating that following the limb bud deletion at the embryonic stage, the application of NT3 exogenously rescued some of DRG neurons from the cell death, the subpopulation having central projections characteristic of muscle spindle afferents (Oakley et al., 1997). The injection of CNTF, considered as a physiological neurotrophic factor, supported the survival of spinal motor neurons compared with no effects on any of the sensory or sympathetic neurons in vivo (Oppenheim et al., 1991). Parasympathetic Ganglia Most of the previous studies demonstrated that neurotrophins such as NGF and BDNF had no survival-promoting effects on parasympathetic neurons in vitro (Collins and Dawson, 1983; Rohrer and Sommer, 1983; Lindsay et al., 1985b) and these neurons were not affected by mutations in any of the neurotrophin or Trk genes. Instead, CNTF and GDNF have both been implicated in supporting the survival of chicken CG neurons. The CNTF messager RNA and protein are present in the target tissues during the period when ciliary neurons are dependent on target inputs for the survival (Leung et al., 1992a; Finn and Nishi, 1996), and high-affinity CNTF receptors are expressed on the surface of CG neurons (Heller et al., 1995; Koshlukova et al., 1996). The application of CNTF in vitro 35

41 rescued parasympathetic neurons from the cell death. The overexpression of chick CNTF gene at CG target tissues supported the neuronal survival, further indicating the essential role of CNTF in vivo (Barbin et al., 1984; Stockli et al., 1989; Finn et al., 1998a). The GFRα2 subunit and c-ret of GDNF receptors are both expressed in the developing parasympathetic neurons (Widenfalk et al., 1997; Hashino et al., 1999). Consistent with their expression pattern, mutations in either Ret or GFRα2 lead to the severe deficiency in the development of parasympathetic neurons (Durbec et al., 1996a; Rossi et al., 1999) whereas the mutation in GFRα1 gene did not (Cacalano et al., 1998; Enomoto et al., 1998). Neuronal Populations in the CNS Studies of CNS neurons have generally been more problematic compared with those of PNS neurons, because for the most part, results can be only obtained from heterogeneous cultures of neurons and non-neuronal cells, which made it difficult when the potential effects of neurotrophins on one specific population of CNS neurons need to be identified. Although TrkA receptors are abundantly expressed in basal forebrain cholinergic neurons (Holtzman et al., 1992), and both exogenous application of NGF in culture and NGF injection intraventricularly supported the survival of such neuronal population (Hefti, 1986; Hartikka and Hefti, 1988), ngf-/- and trka-/- mice surprisingly had normal differentiated basal cholinergic neurons with similar cell numbers to those in the wild-type animals prenatally (Crowley et al., 1994; Smeyne et al., 1994). However, decreased staining in cholinergic fibers projecting out from these neurons suggested a role of 36

42 NGF/TrkA signaling either in fiber outgrowth or in the maintenance of the cholinergic phenotype. Accordingly, postnatal atrophy of NGF-dependent cholinergic neurons in the basal forebrain area of heterozygous knockout mice (ngf+/-), associated with measurable deficits in the learning and memory, suggested some dependence on this neurotrophin molecule in the adult stage (Chen et al., 1997). The application of BDNF or NT3, but not NGF, supported the survival of hippocampal neurons in cultures (Ip et al., 1993a). In particular, granule neurons in the dentate gyrus of the hippocampal formation became dependent on TrkB and TrkC receptors shortly after the natural cell death period, suggesting their important roles in supporting postmitotic neurons. This idea is further verified by the evidence that there was an increase in the postnatal apoptosis of hippocampal neurons and cerebellar granule cells in TrkB and TrkC knockout mice (Minichiello and Klein, 1996; Alcantara et al., 1997). These results strongly suggest that the survival supports from neurotrophins are more postnatal in the CNS compared to prenatal in the PNS, although it is not clear yet whether the cell death directly results from the knockout of neurotrophins/trk receptors or is sequentially caused by severe deficiencies present in the peripheral system. The above results clearly indicate that neurotrophins are required for the survival of sympathetic, sensory, parasympathetic ganglia and motor neurons in the PNS and some types of neurons in the CNS. The presence of neurotrophins and their respective receptors are essential for the normal development and maturation of a variety of neuronal populations. It is speculated that the convergence of different neurotrophins on TrkC 37

43 receptors may account for the less effect of TrkC gene knockout on the sensory and sympathetic neuron survival. The BDNF, our most interested molecule, was demonstrated its essential role in supporting the survival of various neuronal populations; however, it is considered irrevelant to the survival of parasympathetic neurons based on the previous studies. Synaptic Plasticity The neurotrophin expression is upregulated by the increased neuronal activity (Zafra et al., 1990, 1991; Ernfors et al., 1991; Lindvall et al., 1992), and the induction of LTP (Castren et al., 1993; Dragunow et al., 1993; Bramham et al., 1996), Moreover, activity-stimulated release of NGF and BDNF has been demonstrated in both hippocampal slices and primary cultures of hippocampal neurons (Blochl and Thoenen, 1995; Goodman et al., 1996), Those imply that the neurotrophin itself may play an important role in the regulation of synapse plasticities. The pioneering report from Lohof and colleagues demonstrated that the application of NT-3 and BDNF acutely potentiated both spontaneous and impulse-evoked synaptic activity of Xenopus neuromuscular junctions in vitro (Lohof et al., 1993). The application of CNTF increased synaptic activity as well (Stoop and Poo, 1995), and the coapplication of CNTF with BDNF even showed synergistic effects on regulating the neuromuscular synapse function (Stoop and Poo, 1996). The acute effects of neurotrophins on the neuronal activity and synaptic transmission have been observed in various studies. Several groups have demonstrated that the acute application of BDNF was able to induce the enhancement of glutamatergic synaptic transmissions in the embryonic 38

44 rat hippocampal neuron culture (Levine et al., 1995), in different excitatory pathways (CA1, CA3 region and dentate gyrus) of adult hippocampal slices (Kang and Schuman, 1995, 1996; Scharfman, 1997) and in slices of young rat visual cortex (Akaneya et al., 1997; Carmignoto et al., 1997). TrkB-mediated signaling is required and essential for BDNF-induced potentiation in all cases, while the activation of low-affinity neurotrophin receptor p75 is not required. In addition to the acute effects on the excitatory synapse transmission, neurotrophin (BDNF and NT3) application also inhibited GABAergic inhibitory transmission in rodent cortical neurons and cerebellar granule cells (Kim et al., 1994; Tanaka et al., 1997; Cheng and Yeh, 2003). The acute effects of neurotrophins preferentially focus on active synapses (McAllister et al., 1996; Gottschalk et al., 1998), and may be facilitated by the presence of camp or activation of adenosine receptor A2A (Boulanger and Poo, 1999b; Diogenes et al., 2004). Such regulation requires a cascade of protein phosphorylation (Liu et al., 1999; He et al., 2000; Yang et al., 2001) and is independent of new protein synthesis (Stoop and Poo, 1995; Chang and Popov, 1999). The induction of neurotransmitter/neurotrophin release from presynaptic sites may be implicated in the acute effects induced by neurotrophins, due to triggered calcium influx and/or the induced regulation on synaptic vesicle proteins (Kruttgen et al., 1998). In the CNS, Knipper and colleagues showed that NGF and BDNF enhanced high K + -induced release of acetylcholine from hippocampal synaptosomes (Knipper et al., 1994a). Subsequent studies demonstrated that acute neurotrophin application was able to trigger the release of other neurotransmitters such as glutamate and 39

45 dopamine as well (Knipper et al., 1994b; Blochl and Sirrenberg, 1996; Jovanovic et al., 2000). The application of BDNF or NT-3 to hippocampal neurons in culture lead to an acute increase of intracellular Ca 2+ concentration which mainly came from the internal Ca 2+ stores (Berninger et al., 1993; Canossa et al., 1997), and an increase in the presynaptic Ca 2+ concentration was observed in the neuromuscular junction as well (Stoop and Poo, 1996). Such elevation of intracellular Ca 2+ could, in turn, enhance the neurotransmitter release from presynaptic sites. In addition, several lines of evidence also imply that the enhanced secretion resulted from the direct modification on synapse vesicle proteins. Studies have shown the MAPK dependent phosphorylation of synapsin I, a membrane-bound vesicle protein, in hippocampal and cortical neurons after the acute application of neurotrophins (Knipper et al., 1994b; Jovanovic et al., 1996). Mice lacking synapsin I and/or synapsin II displayed the attenuation of glutamate release by BDNF in the preparation of synaptosome (Jovanovic et al., 2000), indicating the indispensable role of synapsins in the BDNF-enhanced neurotransmitter release. In addition to synapsin, the expression level of two other synaptic proteins, synaptobrevin and synaptophysin, increased following the acute treatment of BDNF in the synaptosome preparation from BDNF knockout mice, implying that BDNF may also affect synaptic activity by the enhancement of synaptic protein docking (Pozzo-Miller et al., 1999). Alternatively, neurotrophin-triggered neurotrophin release, which may occur at both dendritic and axonal sites, could be accounted for the activity-dependent neuronal activity (Canossa et al., 1997; Kruttgen et al., 1998). Similar to the activity-dependent expression of neurotrophins, acute effects induced by neurotrophins require an increase in the 40

46 intracellular Ca 2+ concentration from presynaptic sites and may act through an autocrine loop to modulate the synapse efficacy. Judged by the analysis of paired-pulse facilitation, of the amplitude and the frequency of miniature synaptic currents, and of synaptic failure rates, the neurotrophin-induced acute enhancement is originated from presynaptic sites (Lohof et al., 1993; Kang and Schuman, 1995; Carmignoto et al., 1997; Gottschalk et al., 1998). Consistent with such idea, the depolarization on presynaptic sites extensively facilitated the BDNF-induced potentiation, and null mutation of TrkB gene specifically at presynaptic sites but not at postsynaptic sites attenuates the acute effects (Boulanger and Poo, 1999a; Xu et al., 2000). Moreover, BDNF has been shown to enhance not only the neurotransmitter release from presynaptic sites, but also the postsynaptic transmission through NMDA receptors on hippocampal neurons in the culture condition (Levine et al., 1995; Levine et al., 1998). Also BDNF induced the phosphorylation of postsynaptic NMDA receptor subunit 1 and 2B (Suen et al., 1997; Lin et al., 1998). Such results imply that postsynaptic modification may be involved somehow, if at all, in neurotrophin-induced acute effects. Moreover, BDNF has been shown involved in the onset and maintenance of LTP as well. The LTP at hippocampal neuronal synapses was greatly reduced in BDNF homozygous and heterozygous knockout mice although the brain morphology, basal synaptic transmission, and behavior appeared normal in these mice (Korte et al., 1995). In TrkB conditional knockout mice, LTP in hippocampal CA1 region was impaired as well accompanied with learning and memory defects (Minichiello et al., 1999). The defective 41

47 LTP could be rescued by the prolonged application of BDNF (2-4 hr) exogenously on hippocampal slices (Patterson et al., 1996) or by the overexpression of BDNF gene in the hippocampal CA1 region (Korte et al., 1996), suggesting that the absence of BDNF rather than cumulative developmental defects is responsible for the LTP impairment in BDNF-knockout mice. Consistent with these results, the application of TrkB-IgG fusion protein, anti-trkb antisera or BDNF function-blocking antibody lead to impaired theta-burst stimulated LTP in hippocampal slices (Figurov et al., 1996; Kang et al., 1997; Chen et al., 1999). The incubation with TrkB-IgG fusion protein prior to and 30 min after the induction of LTP both showed defective LTP, indicating that BDNF/TrkB signaling is required for the initiation and maintenance of such events in a time-dependent manner (Kang et al., 1997). Acute application of BDNF enhanced the tetanus-induced LTP in hippocampal and cortical slices (Figurov et al., 1996; Akaneya et al., 1997), and attenuated the long-term depression (LTD) in both hippocampus and visual cortex regions (Akaneya et al., 1996; Huber et al., 1998; Ikegaya et al., 2002). Interestingly, microinfusion of BDNF directly into dentate gyrus of adult rats in vivo triggered a robust and lasting strengthening of synaptic transmission (termed BDNF-LTP) at perforant path to granule cell synapses (Messaoudi et al., 1998; Ying et al., 2002). In contrast to previous results that BDNF triggered the new protein synthesis from existing mrnas located at dendritic sites (Kang and Schuman, 1996; Aakalu et al., 2001), BDNF-LTP requires the protein synthesis as well as mrna transcription (Messaoudi et al., 2002; Ying et al., 2002). 42

48 In addition to their acute enhancement of synaptic activity and transmission, neurotrophins also exert long-term regulation on synapse development and function. The BDNF and other neurotrophins have been shown to modulate the axon and dendritic branching in the brain such as in the visual and sensory system (Cohen-Cory and Fraser, 1995; McAllister et al., 1995, 1996; Lentz et al., 1999). TrkB receptor signaling is responsible for dendritic growth in vivo and in vitro (Lom and Cohen-Cory, 1999; Yacoubian and Lo, 2000), indicating an essential role in the formation of synaptic network. Long-term application of BDNF and NT-3 (2-3 d) resulted in a sustained increase in quantal size, synaptic protein expression and a more reliable impulse-evoked synaptic transmission in Xenopus nerve-muscle culture (Wang et al., 1995). The application of CNTF along with BDNF or NT3 had synergistic effects on the neurotrophin-induced modification on synapses, as it did in the manner of short-term (Liou et al., 1997). In addition, postsynaptic receptor clusters in muscle fibers were disrupted in TrkB knockout mice, indicating an important role of BDNF/TrkB signaling in the formation and maturation of functional synapses at neuromuscular junctions both in vitro and in vivo (Gonzalez et al., 1999). Besides in PNS, neurotrophins are essential for establishing neuronal connectivity in the CNS as well. Neurotrophins were demonstrated to be involved in activity-dependent synaptic competition and formation of ocular dominance columns in the visual cortex. The infusion of NT-4/5 or BDNF into cat primary visual cortex inhibited the column formation within the immediate vicinity of the infusion site but not other neurotrophins (Cabelli et al., 1995). Interestingly, an earlier expression of BDNF in rat visual cortex accelerated the column maturation and induced an early 43

49 termination of the critical period responsible for the ocular dominance plasticity (Huang et al., 1999b). Compared with in vivo effects, BDNF was able to influence the maturation of both glutamatergic and GABAergic synapses in an activity-dependent manner in vitro. The BDNF application induced an increased synapse formation for both excitatory and inhibitory transmission in hippocampal neuronal cultures (Vicario-Abejon et al., 1998; Elmariah et al., 2004) while it inhibited inhibitory synapse formation and function in cortical and cerebellar neuron cultures (Rutherford et al., 1998; Seil and Drake-Baumann, 2000). Furthermore, synaptic vesicle protein expression and the density of synaptic innervations were regulated by chronic BDNF application, e.g., increased expression of synaptic proteins such as synaptophysin and synapsin-i (Wang et al., 1995) and an elevation in vesicle numbers were observed in the presynaptic sites (Tyler and Pozzo-Miller, 2001). Long-term treatment of neurotrophins also can alter the synaptic transmission indirectly by regulating the neuronal excitability (Gonzalez and Collins, 1997; Lesser et al., 1997) and/or directly by modulating unitary synaptic properties (Wang et al., 1995; Rutherford et al., 1998). Enhancements of both excitatory synaptic transmission mediated by non-nmda receptors and inhibitory transmission occurred after the chronic treatment without affecting synapse numbers and cell excitabilities (Sherwood and Lo, 1999; McLean Bolton et al., 2000). Interestingly, it is reported that long-term treatment of BDNF induced the modification of synapse transmission by protein-independent or -dependent signaling pathways (Tartaglia et al., 2001). Treatment of BDNF on hippocampal slice cultures increased the vesicle protein expression, some of which could not be blocked by the application of protein synthesis inhibitor. The above 44

50 results support the idea that neurotrophins are required for the synapse formation and stabilization (Katz and Shatz, 1996; Snider and Lichtman, 1996), and may modulate synapses at multiple levels. In summary, neurotrophins exert their regulatory effects on synapses in the manner of both short term and long term. The mechanism underlying such regulation process is quite complicated, for example, acute effects on the synapse plasticity caused by neurotrophins may result from the induced neurotransmitter release and phosphorylation of synapse vesicle proteins in the presynaptic sites, and/or the regulation on neurotransmitter receptors located at postsynaptic sites. It should be noted that neurotrophins require the functional Trk receptors but not p75 receptors for such effect. The involvement of BDNF in the LTP, which usually occurs in the hippocampal area, makes it a potential key player in learning and memory, in addition to the regulation of synaptic functions and maintanence of existing synapses in other regions of the brain and the peripheral system. Although the identification of chicken TrkB and BDNF was reported a long time ago (Isackson et al., 1991; Dechant et al., 1993b), and BDNF has been shown to have the survival-supporting effects on chicken sensory neurons and motorneurons by several groups (Lindsay et al., 1985b; Kalcheim et al., 1987; Oppenheim et al., 1992; Borasio et al., 1993; Yin et al., 1994; Dolcet et al., 1999), it indicates that BDNF/Trk signaling is not related to the chicken parasympathetic system. Previous wisdom believes that there was no expression of TrkB in chick CGs (Dechant et al., 1993b; Hallbook et al., 1995), and 45

51 BDNF was shown unable to support the survival of parasympathetic neurons (Lindsay et al., 1985b; Krieglstein et al., 1998). However, several lines of evidence suggest the potential relationship between BDNF and AChRs, the major excitatory receptors present on the surface of CG neurons. It has been reported that the acute application of BDNF upregulated the synaptic activity in the AChR-containing synapses at neuromuscular junctions (Lohof et al., 1993; Boulanger and Poo, 1999a); the exposure to BDNF in the long term significantly increased the immunoreactivities of AChR clusters on the interneurons in the hippocampal area (Kawai et al., 2002). Moreover, the disruption of TrkB signaling abolished the AChR clusters located at neuromuscular junctions, which further supported the idea that BDNF/TrkB signaling may be required in the regulation and maintenance of functional synapses containing AChRs (Gonzalez et al., 1999). In addition, the application of NGF supported the expression and regulated the function of AChRs in the sympathetic system (Henderson et al., 1994b; Yeh et al., 2001). Thus, it is reasonable to speculate that BDNF/TrkB may play a key role in the regulation of functions and expression of AChRs in chicken parasympathetic system. In order to get a better understanding of the potential role of BDNF in chick CGs, we carefully examined the expression pattern of BDNF and TrkB receptors, and explored the relationship between BDNF and AChRs in the first manuscript. 46

52 BDNF and trkb signaling in parasympathetic neurons: relevance to regulating α7-containing nicotinic receptors and synaptic function 47

53 Title: BDNF and trkb signaling in parasympathetic neurons: relevance to regulating α7-containing nicotinic receptors and synaptic function. Abbreviated Title: BDNF signaling in ciliary ganglion neurons Authors: Xiangdong Zhou, Qiang Nai 1,2, Min Chen 1,3, Jason D. Dittus, Marthe J. Howard, and Joseph F. Margiotta Project Address: Medical College of Ohio Department of Anatomy & Neurobiology Block HS, 3035 Arlington Ave. Toledo, OH Correspond. Auth: Joseph F. Margiotta, Ph.D., Medical College of Ohio, Department of Anatomy & Neurobiology, BHS 108, 3035 Arlington Avenue, Toledo, OH Tel: ; Fax: ; Numbers: Key Words: 42 pages, 7 Figures, 0 Tables Ciliary ganglion, nicotinic, acetylcholine receptor, BDNF, trkb, patch-clamp, neurotrophin, bungarotoxin, EPSC, CREB, PACAP Acknowledgments: Support was provided by National Institutes of Health grants R01-DA15536 (to J.F.M.) and R01-NS40644 (to M.J.H.). We thank Mr. Wei Han for technical assistance, Drs. Frances Lefcort and Louis Reichardt for providing trkb and p75 NTR antisera, and 48

54 Drs. Darwin Berg, Leslie Henderson, and Phyllis Pugh for helpful comments on the manuscript. Notes: 1 These authors contributed equally. 2, 3 Current Addresses: 2 Dept. of Biology 0357, University of California, San Diego, 9500 Gilman Drive., La Jolla, CA Behavioral Medicine Research Institute. Ohio State University, 2187 Graves Hall, 333 W. 10 th Ave., Columbus, OH

55 Abstract Parasympathetic neurons do not require neurotrophins for survival, and are thought to lack high-affinity neurotrophin receptors (i.e. trks). We report here, however, that mrnas encoding both brain derived neurotrophic factor (BDNF) and its high-affinity receptor (trkb) are expressed in the parasympathetic chick ciliary ganglion (CG), and that BDNF-like protein is present in the ganglion and in the iris, an important peripheral target of ciliary neurons. Moreover, CG neurons express surface trkb and exogenous BDNF not only initiates trk-dependent signaling, but also alters nicotinic acetylcholine receptor (nachr) expression and synaptic transmission. In particular, BDNF applied to CG neurons rapidly activates cyclic AMP dependent response element binding protein (CREB) and over the long-term selectively up-regulates expression of α7-subunit-containing, homomeric nachrs (α7-nachrs), increasing α7-subunit mrna levels, α7-nachr surface sites and α7-nachr-mediated whole-cell currents. At nicotinic synapses formed on CG neurons in culture, brief and long-term BDNF treatments also increase the frequency of spontaneous excitatory postsynaptic currents, most of which are mediated by heteromeric nachrs containing α3, α5, β4, and β2 subunits (α3*-nachrs) with a minor contribution from α7-nachrs. Our findings demonstrate unexpected roles for BDNF-induced, trk-dependent signaling in CG neurons, both in regulating expression of α7-nachrs and in enhancing transmission at α3*-nachr-mediated synapses. The presence of BDNF-like protein in CG and iris target coupled with that of functional trkb on CG neurons raise the possibility that signals 50

56 generated by endogenous BDNF similarly influence α7-nachrs and nicotinic synapses in vivo. 51

57 Neurotrophins (NGF, BDNF, NT-3) act via high-affinity tyrosine kinase-containing receptors (trka, trkb and trkc, respectively) to support the survival and growth of diverse neuron populations, and influence the form and function of chemical synapses (Lewin and Barde, 1996; Kaplan and Miller, 2000; Huang and Reichardt, 2001). In particular, BDNF and sometimes NT-3, exert rapid, largely presynaptic effects at central, autonomic, and neuromuscular synapses, and produce long-term pre- and postsynaptic changes consistent with altered gene expression (Reviewed in (Lewin and Barde, 1996; Schuman, 1999; Poo, 2001). Thus in addition to providing trophic support, neurotrophins also induce trk-dependent acute and long-term changes that coordinately influence synaptic interactions. Parasympathetic neurons typified by those in the chicken CG do not require neurotrophins for survival (Helfand et al., 1976; Rohrer and Sommer, 1982; Lindsay et al., 1985b; Krieglstein et al., 1998). Instead, CG neurons rely on other growth factors, notably ciliary neurotrophic factor (CNTF) (Leung et al., 1992b; Finn et al., 1998b) and glial derived neurotrophic factor (GDNF) (Hashino et al., 2001) for trophic support. Moreover, studies employing Nothern and RNAse protection assays failed to detect trk mrna in ciliary ganglia (Dechant et al., 1993a; Hallbook et al., 1995). These observations have led to the presumption that CG neurons lack trks (e.g. (Huang and Reichardt, 2001). 52

58 As with sympathetic ganglion neurons and skeletal muscle fibers, fast chemical synapses on ciliary and other parasympathetic ganglion neurons are mediated by nachrs. In sympathetic neurons, NGF supports the expression of α3-nachr subunit protein (Yeh et al., 2001), an effect mirrored in PC12 cells where NGF increases α3, α5, α7, β2, and β4 nachr subunit mrnas as well as nachr function (Henderson et al., 1994b; Takahashi et al., 1999). Also, sympathetic neurons overexpressing BDNF display increased preganglionic innervation density (Causing et al., 1997) indicative of long-term presynaptic effects. BDNF acting through trkb also regulates neuromuscular junction form and function. For example, BDNF rapidly enhances presynaptic release to increase the frequency and amplitude of spontaneous nachr-mediated synaptic currents in nerve-muscle cultures (Lohof et al., 1993; Stoop and Poo, 1996; Gonzalez et al., 1999). Over the long term, BDNF restores neuregulin levels, restricts axon sprouting, and maintains postsynaptic architecture in muscle disrupted by activity blockade (Loeb et al., 2002) while sustained trkb-mediated signaling is likely required to maintain postsynaptic nachr clusters (Gonzalez et al., 1999). These findings prompted us to speculate that previous assays were perhaps insufficiently sensitive to detect trks expressed in ciliary ganglia, and that neurotrophin/trk signaling while not required for trophic support, might influence the components and function of nachr-mediated synapses on CG neurons. We focused on BDNF/trkB sigaling, and have demonstrated expression of BDNF-like protein in ciliary ganglia and functional trkb on CG neurons. To explore synaptic relevance, the impact of BDNF/trkB signaling on α7-nachrs and α3*-nachr mediated synapses was assessed using CG neurons grown in cell culture. BDNF treatment 53

59 up-regulated expression of α7-nachrs after several days, and increased the frequency of spontaneous synaptic currents within minutes. The results reveal an unanticipated relevance for BDNF/trkB signaling in parasympathetic CG neurons. 54

60 Methods Neurons. CG neuron cultures were prepared under sterile conditions from embryonic day 8 (E8) chick embryos. Dissociated neurons were plated at 1-2 ganglion equivalents in 15 mm diameter polystyrene tissue culture wells or on 12 mm diameter glass coverslips; both substrates were pre-coated with poly-dl-ornithine and laminin (Pugh and Margiotta, 2000; Chen et al., 2001). The standard culture medium consisted of minimum essential medium (MEM) containing 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mm glutamine, and 10% heat inactivated horse serum (MEM hs ; all components from GIBCO-BRL, Rockville, MD) and was supplemented with 3% embryonic eye extract (Nishi and Berg, 1981). Neurons were maintained at 37 C in 95% air, 5% CO 2 for 4-7 d and received fresh culture medium every 2-3 d, conditions that support 100% survival of CG neurons for at least 7 d (Nishi and Berg, 1981). In test cultures the medium was further supplemented with BDNF (50 ng/ml, unless indicated otherwise) sometimes in conjunction with other reagents as described for individual experiments in Results. For some studies, CG neurons were acutely dissociated from E8 or E14 ganglia as previously described (McNerney et al., 2000; Nai et al., 2003). Neurons were plated on acid-washed, poly-d-lysine-coated glass coverslips in electrophysiological recording solution (RS) containing (in mm) NaCl, 5.3 KCl, 5.4 CaCl 2, 0.8 MgSO 4, 5.6 glucose, and 5.0 HEPES, ph 7.4 (Dichter and Fischbach, 1977) that was supplemented with 10% heat inactivated horse serum (RS hs ). Acutely dissociated neurons were maintained in RS hs at 37 C for 2-4 h prior to use. 55

61 Conventional RT- PCR. The presence of mrna encoding chicken trkb, BDNF, α7, and α3-nachr subunits, as well as β-actin (βa) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was assessed by conventional reverse transcriptase-based polymerase chain reaction (RT-PCR) as previously described (Burns et al., 1997). Briefly, RNA was isolated from E8-E15 chick tissues or from CG neuron cultures using a one-step kit (RNAqueous, Ambion, Austin, TX). Total tissue RNA (1 µg) was treated with Amplification Grade RNase-free DNase 1 U/µl, Gibco-BRL), and then ng of DNase-treated RNA used to synthesize cdna using Superscript II reverse transcriptase (RT+; Gibco-BRL). The resulting cdnas were then used as templates for PCR amplifications in 25 µl reaction volumes containing 50 mm KCl, 20 mm Tris-HCl, 2.5 mm MgCl2, 200 µm dntps, 5 U/µl Taq DNA polymerase (Gibco-BRL), and 0.4 µm forward (F) and reverse (R) oligonucleotide primers (synthesized by Marshall University DNA Core Facility, Huntington, WV). The chicken-specific primers used were: trkb (Dechant et al., 1993a) F: C 1156 TTCAGCTGGACAACCCTAC 1175, R K+ : T 1868 GGAAGTCCTTGCGGGCATT 1849 R K- : GCCCCTCTCTCATCTT BDNF (Maisonpierre et al., 1992b) F: G 287 CAGTCAAGTGCCTTTG 303, R: G 748 AGCCCACTATCTTCCCC 731 α7-nachr subunit (Couturier et al., 1990a) 56

62 F: G 1092 GGGAAAAATGCCTAAAT 1109, R: G 1614 ACAGCCTCTACAAAGTT 1597 α3-nachr subunit (Couturier et al., 1990b) F: A 985 TGCCTGTATGGGTGAGAACT 1005, R: T 1226 TGCCACTGAAATCGGAAAAC 1206 GAPDH (Stone et al., 1985) F: G 532 CCATCACAGCCACACAGAA 551, R: A 980 CCATCAAGTCCACAACACG 961 β-actin (Genebank, 1992 #L08165) F: A 860 TCTTTCTTGGGTATGGA 877, R: A 1134 CATCTGCTGGAAGGTCC 1117 The two trkb primer pairs (F/R K+ and F/R K- ) correspond to those shown previously to amplify kinase-containing (full-length) and truncated (kinase-deleted) chicken trkb isoforms, respectively (Garner et al., 1996). The F/R K+ pair is not predicted to hybridize with chicken trka (Schropel et al., 1995) or trkc (Garner and Large, 1994) cdnas. The α7- and α3-nachr subunit primer pairs both amplify products within non-conserved regions of their respective cytoplasmic domains, located between transmembrane segments III and IV (Schoepfer et al., 1990). The trkb and AChR subunit primers were optimized for amplification and the reactions performed in the linear range of the assay (25-29 cycles). PCR products were separated on 1.0% agarose gels stained with ethidium bromide. Identical reactions lacking RT served as controls for possible 57

63 amplification of genomic DNA and were consistently negative. Changes in the levels of α7 and α3 mrnas in response to BDNF treatment were estimated semi-quantitatively after digitizing gel images using Kodak 1D Image Analysis software (Eastman Kodak, Rochester, NY) from the ratio of PCR product intensities to those of βa from the same cultures. Real Time PCR. Changes in α7- and α3-nachr subunit mrna levels induced by BDNF were confirmed using RT-based real time PCR. cdna samples corresponding to 50 ng of input RNA were combined with Taqman universal PCR master mix (Roche, Branchburg, NJ), F and R primers (0.4 µm), and Taqman probe (0.1 µm) [with 6-FAM (carboxyfluorescein, reporter dye) and TAMRA (tetramethylrhodamine, quencher dye) inserted at 5 and 3 ends, respectively]. Selection of the following primers and probes was optimized using Applied Biosystems Primer-Express software, with α7- and α3-nachr subunit primers chosen to amplify regions within transmembrane segments III and IV, and span intron-exon boundaries (Schoepfer et al., 1990): α7-nachr subunit (Couturier et al., 1990a) F: C 1020 CATGATTATTGTTGGCCTCTCT 1042, R: T 1210 CGGCCCTGTTTATGTTGAC 1190 Probe: A 1115 GAGTCATCCTTCTGAATTGGTGTGCTTGGT 1145 α3-nachr subunit (Couturier et al., 1990b) F: G 1178 CAGCTGCTGCCAGTACCA

64 R: A 1398 ATGACCATGGCAACATATTTCC 1376 Probe: T 1216 TCAGTGGCAATCTCACAAGAAGTTCCAGC 1245 GAPDH (Stone et al., 1985) F: C 1795 CGTCCTCTCTGGCAAAGTC 1814 R: A 2374 ACATACTCAGCACCTGCATCTG 2352 Probe: A 2211 TCAATGGGCACGCCATCACTATCTTCC 2228 Twenty five µl PCRs were performed in triplicate using a GeneAmp 5700 sequence detection system (Applied Biosystems, Forster City, CA). This system allows the increase in PCR product to be monitored directly based on the threshold number of cycles (CT) required to produce a detectable change in fluorescence (ΔF) resulting from the release of probe. Relative levels of α7- and α3-nachr cdna (R α7, R α3 ) in control and BDNF-treated cultures were calculated from the difference in CT values (ΔCT = CT control CT BDNF ) for α7 or α3 amplifications (ΔCT α7, ΔCT α3 ) compared with those for the housekeeping gene, GAPDH (ΔCT GAPDH ) using R α = (E α ΔCT α )/(E GAPDH ΔCT GAPDH ) (1). In Equation 1, E α and E GAPDH are the real time PCR amplification efficiencies determined in separate studies from the slope of CT versus input log cdna dilution where E = 10-1/slope. E values for amplifying α7, α3, and GAPDH cdnas were 2.10, 2.10, and 2.23, respectively. 59

65 Immunocytochemistry. A polyclonal antibody generated against the extracellular domain of chicken trkb (#R22781) that does not recognize trka or trkc (von Bartheld et al., 1996) was generously provided by Dr. Frances Lefcort (Montana State University). Polyclonal antibody recognizing Ser 133 -phosphorylated camp response element binding protein (p-creb) was purchased from Cell Signaling Technology (Beverly, MA). Ciliary and dorsal root ganglia (DRG) were fixed for 1-4 h in 4% paraformaldehyde prepared in 0.15 M phosphate buffered saline at ph 7.4 (PBS), washed in PBS, cryoprotected in PBS containing 30% sucrose, embedded in OCT (Miles Laboratories, Elkhardt, IN), cryosectioned at 10 µm, and mounted on glass slides. After rehydration, sections were blocked for 1 h at RT in 30 mm Tris and 150 mm NaCl containing 0.4% Triton X100, 1% glycine, 10% goat serum, and 3% bovine serum albumin. trkb antibody was applied to sections in blocking solution containing 4% goat serum (1:1000, 4 C, 16h), and after washing, secondary antibody (AlexaFluor594-conjugated anti-rabbit IgG, Molecular Probes, Eugene, OR) was applied in the same solution (1:400, 22 C, 1h). Sections were then washed, dipped in distilled water and mounted in Vectashield (Vector Laboratories, Burlingame, CA). Acutely dissociated CG neurons or CG neuron cultures, both on glass coverslips, were fixed for h in 2-4% paraformaldehyde and blocked in PBS containing 10% donkey or goat serum. Coverslips were then incubated in trkb antibody (1:2000, 37 C, 2 h) treated with Cy3-conjugated anti-rabbit IgG (Jackson Biolabs, Bar Harbor, ME; 1:400, 1h, 37 C) in PBS containing 5% serum, washed and mounted. A similar protocol was followed for phospho-creb immunostaining except 60

66 that the block and wash buffers contained 0.1% TritonX-100, p-creb antibody was applied (1:400, 4 C, 16 h) and the secondary antibody was AlexaFluor488-conjugated anti-rabbit IgG (1:400, 22 C, 1 h). Image Analysis. Immunostained preparations were viewed using epifluorescence microscopy (Olympus BX50, UplanFL 40X, 0.75 N.A. objective), and images acquired and processed using a SenSys KAF-1400 cooled digital CCD camera under the control of IP Lab software (Version 3.6 Scanalytics; Reading, PA) as described previously (Chen et al., 2001). Neurons were considered p-creb positive if the mean fluorescence intensity of pixels in an elliptical region of interest (ROI) superimposed over the nucleus exceeded that of the ROI when placed over cytoplasm by >15%. ELISAs. The presence of BDNF in chicken tissue homogenates and tissue culture medium components was assessed using a commercial BDNF sandwich ELISA kit having no significant cross-reactivity with NGF, NT4/5 or NT3 (Chemikine, Chemicon International, Temecula, CA). The ELISA uses rabbit polyclonal antibodies (raised against human BDNF) to capture BDNF from the sample, and a biotinylated mouse monoclonal antibody to detect the captured BDNF. Since mammalian and chicken BDNF share all but 7 amino acids, with the mismatches distributed along the entire length of the peptide (Isackson et al., 1991), the kit antibodies likely recognize chicken BDNF. Nevertheless, we refer here to detection of BDNF-like protein, with levels quantified 61

67 within the linear range of the assay (7.8 to 500 pg/ml) using recombinant human BDNF as standard. α Bungarotoxin (αbgt) Binding. CG neurons were plated at 1-2 ganglion equivalents per well and grown in culture wells for 4-5 d. Neurons in triplicate culture wells were washed twice in MEM hs, incubated in MEM hs containing 10 nm [ 125 I]-αBgt (Specific activity = Ci/mmol, Perkin Elmer, Boston, MA) for 1 h at 37 C, and then washed 3X with MEM hs. We previously showed that these conditions are sufficient to saturate surface αbgt sites on dissociated CG neurons (McNerney et al., 2000). Nonspecific binding was determined in parallel wells by including 100 µm d-tubocurarine with 10 nm [ 125 I]-αBgt. After labeling and washing, the wells were scraped in 500 µl 0.6N NaOH, the solution collected, and [ 125 I]-αBgt radioactivity determined using a Beckman G-5500 gamma counter (Beckman Instruments, Fullerton, CA). Electrophysiology. Whole-cell recordings were obtained at C from CG neurons after 3-5 d in culture. Patch pipettes were fabricated from Corning 8181 glass tubing (WPI, Inc., Sarasota, FL), filled with (in mm) CsCl, 1.2 CaCl 2, 2.0 EGTA, 15.4 glucose, and 5.0 Na-HEPES (ph 7.3) and had tip impedances of 2-3 MΩ. To induce nachr currents, neurons were bathed in RS hs, held at -70 mv, and 20 µm nicotine (Nic) applied in RS by rapid pressure miroperfusion (at psi) from a delivery pipette (4-6 µm tip diameter) positioned 5-10 µm from the neuron soma. We previously showed that fast-onset, rapidly-desensitizing α7-nachr-mediated whole-cell currents induced by 62

68 20 µm Nic in this manner are indistinguishable in amplitude from those obtained using fast piezoelectric switching (Nai et al., 2003). The fast (α7-nachr-mediated) and slower (α3*-nachr-mediated) decaying current components induced by 20 µm Nic were identified and analyzed using Clampfit (pclamp 6.0 or 8.0, Axon Instruments, Burlingame, CA) as previously described (Nai et al., 2003). For analysis, peak Nic-induced response component amplitudes (pa) were normalized to neuron soma membrane capacitance (pf). To quantify BDNF effects, whole-cell Nic responses (pa/pf) obtained from treated neurons were normalized to those for control neurons from the same cultures. To assess synaptic function, sepscs were acquired at -70 mv for 2-5 min, without stimulation, as previously described (Chen et al., 2001). For these experiments, horse serum was sometimes omitted from the recording solution, without discernable effect on the results. Synaptic current frequency and amplitude analyses were subsequently performed using either BASIC-23 programs written in-house, or commercially available software (Mini Analysis , Synaptsoft Inc., Decatur, GA). Briefly, sepsc frequency values obtained from BDNF-treated neurons were normalized to those from control neurons from the same culture platings. In addition, sepscs were extracted from selected records displaying >50 non-overlapping events, and the component amplitude and decay time constant values pooled for control and BDNF-treated neurons. 63

69 Statistics. All parameter values are expressed as mean ± S.E.M. Unless indicated otherwise, the statistical significance of paired and unpaired numerical comparisons was determined using the appropriate two-tailed t-test (p<0.05). Results Expression of trkb mrna and protein. PCR primers specific for kinase-containing (K+) full-length trkb (Garner et al., 1996) amplified a 700 bp product from both E8 and E14 CG cdna templates (Fig. 1a, b). The CG product size was consistent with that predicted for chicken trkb (713 bp) (Garner et al., 1996) and indistinguishable from that obtained in amplifications from E15 DRG, previously shown to express abundant trkb mrna (Hallbook et al., 1995) and protein (Anderson, 1999; Rifkin et al., 2000). In addition, trkb products from E14 CG and E15 DRG yielded identical restriction profiles after digestion with BamHI (not shown) or HbaII (Fig. 1c) with fragment sizes as predicted for digestion of K+ trkb cdna (Dechant et al., 1993a). Truncated trkb isoforms lacking the kinase domain (K-) but containing variable juxtamembrane insertions are also expressed in the chicken nervous system (Garner et al., 1996), and K- specific primers amplified products of expected sizes ( 400, 500, and 600 bp) from both DRG and CG (Fig. 1a, b). In each case, the PCR amplifications from DRG and CG sources were specific for cdna in the sense that they were absent when the synthesis reaction lacked RT (not shown). While the significance of the truncated trkb transcripts was not studied here, the results demonstrate that both truncated and full-length trkb transcripts are expressed in CG during E8-E14, a developmental window when nicotinic synapses 64

70 formed on the neurons undergo substantial structural and functional maturation (Landmesser and Pilar, 1972, 1974a). The presence of trkb protein on CG neurons was demonstrated by fluorescence immunolabeling (Fig. 2) using an antibody that recognizes the extracellular domain of chicken trkb (but not trka or trkc; (von Bartheld et al., 1996). Specific trkb labeling, similar to but somewhat less intense than that seen for E15 DRG sections, was evident in both E8 and E14 CG sections (Fig. 2a, b, c, f) and was localized to the neuron surface where it increased between the two developmental ages. In CG neuron cultures, the somata and processes of neurons displayed specific trkb labeling that became more extensive and intense between 8 h and 4 d in culture (Fig. 2d, e, g) a period when functional synapses are formed and increase in activity (Chen et al., 2001). At 4 d in culture, about 80% of CG neurons scored positive for trkb immunoreactivity. These findings demonstrate that trkb protein is expressed by CG neurons and, because dissociated neurons in acute and culture preparations were not permeablized, indicate that a substantial fraction is localized on the cell surface. Taken together, the mrna and protein studies further suggest that catalytically-competent, high-affinity BDNF receptors are present in the ganglion, and that their expression on CG neurons increases during periods of synaptic differentiation both in vivo and in cell culture. Functional relevance of BDNF and trkb. In order to be relevant in vivo, endogenous BDNF should both be present in the CG and be able to elicit trk-dependent signaling in the 65

71 neurons. Since BDNF detected in spinal cord ventral horn results from both local synthesis and retrograde transport to motor neurons from striated muscle (Koliastsos et al., 1993) we tested for the presence of BDNF both in CG and in the iris, a ciliary neuron target which like the ciliary body is largely striated muscle in birds (Marwitt et al., 1971). Using a commercial ELISA, we detected BDNF-like protein in E14 iris muscle as well as in E14 and in E8 CG (Fig. 3a). The assay failed to detect BDNF in 10% heat inactivated horse serum or whole eye extract, routinely used at 10% and 3%, respectively, as supplements to CG culture medium. The assay also failed to detect BDNF-like protein in intact chicken serum. Relevant to our culture experiments, we presume that dilution of BDNF derived from the iris and ciliary muscle during eye extract preparation reduces its concentration below the detection limit of the assay (7.8 pg/ml). BDNF-like protein present in E8 and E14 CG may be the source of the strong BDNF immunoreactivity previously reported at the same developmental ages for accessory occulomotor neurons (Steljes et al., 1999) which provide preganglionic input to the CG. In addition to arriving by retrograde transport from the intraocular muscle targets, however, the BDNF-like protein present in the CG may also result from local synthesis, since BDNF mrna was detectable by RT-PCR in E8 and E14 ganglia and in CG neurons maintained in standard culture medium for 4 d (Fig. 3b). To determine if the trkb protein expressed on CG neurons represents functional receptor, we tested the ability of applied BDNF to cause phosphorylation of CREB, a camp- and Ca 2+ -regulated transcription factor (reviewed in (Impey et al., 1996); (Greenberg and Ziff, 66

72 2001; Deisseroth et al., 2003) whose activation is a hallmark of trk-dependent neurotrophin signaling (Finkbeiner et al., 1997) (Fig. 4). For this purpose, CG neurons grown in culture for 4-5 d were challenged with BDNF ( ng/ml, min) or, as a positive control, with pituitary adenylate cyclase activating polypeptide (PACAP, 100 nm, min) previously shown to cause robust increases in intracellular camp and Ca 2+ (Margiotta and Pardi, 1995; Pardi and Margiotta, 1999) and then tested the cultures for p-creb immunoreactivity. A similar immunocytochemical approach was previously shown to provide a convenient all-or-none assay for CREB activation in single hippocampal neurons (Hu et al., 2002). After treatment with BDNF 49 ± 6% of 321 CG neurons from 18 fields (N=321, 18) scored as p-creb positive, compared with 99 ± 2% (N=132, 9) after PACAP treatment, and 3 ± 2% (N=179, 10) in untreated control cultures assayed in parallel (Fig. 4a-d, g). Consistent with a requirement for trkb signaling, the proportion of p-creb positive neurons induced by BDNF dropped to control levels (1 ± 1%, N=114, 6) following 1 h preincubation and 15 min co-treatment with K252a (Fig. 4e, g), a trk-selective tyrosine kinase inhibitor (Pizzorusso et al., 2000). Preincubation (1 h) and 15 min co-treatment with PD98059, a MEK1 inhibitor that blocks the neurotrophin-activated, RAS-dependent signaling pathway leading to CREB activation (Ying et al., 2002) similarly reduced the proportion of p-creb positive neurons induced by BDNF to 3 ± 2% (N=85, 6) (Fig. 4f, g). The observation that 51% of neurons showed no detectable response to BDNF in this assay cannot be explained by limited CREB availability since nearly all nuclei were immunoreactive following PACAP treatment. The difference might instead reflect suboptimal BDNF treatment times or heterogeneity of 67

73 functional trkb expression levels. In either case, the protein and p-creb assays (Figs. 3 and 4) demonstrate that an endogenous source of BDNF-like protein is present in the parasympathetic CG where it is poised to activate functionally competent trkb receptors present on the neurons and thereby recruit appropriate signal pathways leading to CREB activation. BDNF upregulates α7-nachrs. Since neurotrophins are not required for full survival of CG neurons, we examined possible roles for BDNF/trkB signaling in regulating the components and function of nicotinic synapses on the neurons. α7-nachrs were assessed as potential targets of BDNF/trkB signaling because they can rapidly modulate transmission (McGehee et al., 1995; Gray et al., 1996; Wonnacott, 1997; Margiotta and Pugh, 2004), an action resembling the increased synaptic efficacy produced by BDNF (reviewed by (McAllister et al., 1999; Schnider and Poo, 2000; Poo, 2001). αbgt binds with high affinity to α7-nachrs (Couturier et al., 1990a) and [ 125 I]-αBgt was therefore used to quantify numbers of surface α7-nachrs on CG neurons (Fig. 5a) as previously described (McNerney et al., 2000). In CG neuron cultures grown with BDNF for varying times prior to assay at 5 d, [ 125 I]-αBgt binding was unchanged relative to control cultures after 4 h exposure, but increased nominally (24%) after 16 h. Extending the treatment time to the full 5 day culture period resulted in levels of αbgt binding that were significantly higher (62 ± 10%, p<0.01) in CG cultures exposed to BDNF relative to control cultures assayed in parallel (N=10 for both). Actual levels of [ 125 I]-αBgt bound in control cultures and cultures treated with BDNF for 5 d were 3.9 ± 0.2 and 6.0 ±

74 fmol per CG equivalent, respectively. In principle, the increased levels of α7-nachrs seen after exposure to BDNF could have been caused by activation of either trkb or the low-affinity neurotrophin receptor (p75 NTR ) that is also present on CG neurons (Lee et al., 2002). The latter possibility is unlikely, however, since an identical elevation (62 ± 14%, N=3) was observed when BDNF was co-applied for 5 d with ChEX, a polyclonal antibody that recognizes and blocks chicken p75 NTR but not trk function (Wescamp and Reichardt, 1991). The ability of long-term BDNF exposure to up-regulate α7-nachrs may reflect increased α7-nachr subunit gene expression since levels of α7-nachr subunit relative to βa mrna, determined by semi-quantitative RT-PCR, were elevated significantly (by 53 ± 10%) in cultures treated with BDNF for 4-5 d compared to untreated control cultures, tested in parallel (N=6 each, Fig. 5b). As with the protein assays, BDNF also increased α7-nachr subunit mrna in cultures with p75 NTR blocked by co-application with ChEX (41 ± 15%, N=3). Using real time PCR a similar 98 ± 26% (N=5) increase in α7-nachr subunit relative to GAPDH mrna was observed (Fig. 5c). In both cases, the BDNF-induced increases in α7-nachr subunit mrna were selective in the sense that identical treatments failed to significantly alter α3-nachr subunit mrna levels (Fig 5b and c). Having demonstrated that BDNF induces trk-dependent increases in levels of α7-nachr protein and mrna in CG neurons, we next sought to determine if the same treatments also enhanced α7-nachr-mediated currents. Rapid application of nicotine (Nic, 20 µm) to CG neurons grown in culture induces a whole-cell current response featuring an initial 69

75 fast-desensitizing component that is blocked by αbgt (Fig. 6a) and hence mediated by α7-nachrs (Pardi and Margiotta, 1999; McNerney et al., 2000; Nai et al., 2003). While 65 ± 5% (N=80 neurons, 5 platings) of CG neurons grown in standard culture medium displayed rapidly-decaying, α7-nachr mediated currents, BDNF treatment for 3-4 d increased the proportion to 83 ± 4% (N=76, 5). In such cases, the peak α7-nachr current values relative to membrane capacitance (I fast /C m, pa/pf) were 49 ± 14% (N=63, 5) larger for neurons from cultures treated with BDNF compared to untreated controls (N=52, 5) tested in parallel (Fig. 6b, c). Consistent with the time course for up-regulation of surface α7-nachrs seen in the [ 125 I]-αBgt binding studies, BDNF treatments for min or h produced only nominal increases in I fast /C m relative to untreated controls tested in parallel (Fig. 6c and data not shown, p>0.05 for both). The slowly decaying component of the Nic-induced current is mediated largely by heteromeric α3*-nachrs (Nai et al., 2003) that contain α3, α5, β4, and occasionally β2 subunits, but lack α7 subunits (Vernallis et al., 1993; Conroy and Berg, 1995) and are insensitive to αbgt (Fig. 6a). The ability of BDNF to increase I fast /C m was specific for α7-nachrs since slow currents (I slow /C m ) attributable to α3*-nachrs and present in all neurons, were unchanged following exposure to BDNF for min, h or 4-5 d (Fig. 6c and data not shown). In addition, the 4-5 d BDNF treatments had no discernable effects on membrane capacitance or the voltage sensitivity or maximal values of voltage-activated Na + or Ca 2+ currents (data not shown). In summary, the size, latency, and specificity of the increased α7-nachr current responses seen after chronic BDNF treatment are consistent with the 70

76 BDNF-activated trkb dependent up-regulation of α7-nachr mrna and protein that occur over a similar time course. BDNF increases activity at nicotinic synapses. Functional synapses form between CG neurons in culture (Margiotta and Berg, 1982) and display spontaneous, impulse-driven nicotinic EPSCs (sepscs, e.g. Fig. 7). We previously demonstrated that while α7-nachrs contribute to the sepscs, the vast majority require α3*-achrs since αconotoxin-mii, which blocks α3*- but not α7-nachrs on CG neurons (Nai et al., 2003) reduced sepsc frequency by 95% (Chen et al., 2001). Exposure to BDNF substantially increased the overall frequency of sepscs (Fig. 7), most of which display slow decay kinetics indicative of a major contribution from α3*-nachrs (Chen et al., 2001). After h BDNF treatment, sepsc frequency increased nearly 3-fold (2.69 ± 0.35, N=46) relative to untreated control neurons from the same five cultures tested in parallel (1.00 ± 0.17, N=39), with a smaller yet significant increase seen after 4-5 d treatment (Fig. 7a, b). This effect is reminiscent of that seen at other synapses where BDNF increases EPSC frequency by a presumed presynaptic mechanism (McAllister et al., 1999; Schnider and Poo, 2000; Poo, 2001) (See below). To determine if BDNF also altered sepsc amplitudes, well-separated individual synaptic currents were extracted from selected records and components mediated by α7- and α3*-nachrs identified by their diagnostic fast and slow decay kinetics, as previously described (Chen et al., 2001). The amplitudes of fast, α7-nachr-mediated sepscs identified in this manner increased following h BDNF treatment (Fig. 7d), shifting by 32% from a median value of -9.6 pa in controls to 71

77 -12.7 pa in BDNF-treated cultures (N=4 neurons each, p<0.0004, Mann-Whitney and Kolmogorov-Smirnov tests). The effect was selective for α7-nachr mediated sepscs since, despite increasing in frequency, slow α3*-nachr-mediated sepscs displayed amplitudes that were unchanged by BDNF treatment (Fig. 7e). Recent studies indicate that chronic exposure to BDNF increases the proportion of postsynaptic α7-nachr clusters on hippocampal neurons (Kawai et al., 2002). Since α3*-nachr mediated sepsc amplitudes were unchanged, a similar postsynaptic accumulation of α7-nachrs may also explain the larger amplitude fast sepscs seen here after h exposure to BDNF. While significant and α7-nachr-selective, the changes in fast sepsc amplitudes following h BDNF treatment were small in comparison to the accompanying 3-fold increase in the frequency of (largely) α3*-nachr mediated sepscs. Studies in other systems suggest that this latter, more dramatic effect is likely to be presynaptic in origin, possibly resulting from changes in intracellular Ca 2+ dynamics that alter quantal release (Pozzo-Miller et al., 1999; Tyler et al., 2002). Interestingly, presynaptic α7-nachrs enhance neurotransmitter release, and are known to do so by elevating terminal Ca 2+ levels (Gray et al., 1996; Coggan et al., 1997) possibly through Ca 2+ -induced Ca 2+ -release (CICR) recently shown to increase EPSC frequency (Sharma and Vijayaraghavan, 2003). Since CG neurons in culture express Ca 2+ -permeable α7-nachrs on neurite tips (Pugh and Berg, 1994) and activation of CICR markedly enhances sepsc frequency (Chen and Margiotta, unpublished) we wondered if up-regulation of presynaptic α7-nachrs might 72

78 underlie the ability of BDNF to increase sepsc frequency. This hypothesis predicts that BDNF applied for min should not increase sepsc frequency since brief exposures were insufficient to increase surface α7-nachr levels or somatic α7-nachr currents (Figs. 5 and 6). In accord with results from other systems (McAllister et al., 1999; Schnider and Poo, 2000; Poo, 2001) however, brief exposure to BDNF induced a significant, K252a-sensitive increase in sepsc frequency (Fig. 7c, left), thereby demonstrating an expected trk dependence, but arguing against a requirement for rapid α7-nachr modulation. Because α7-nachrs at somatic and presynaptic sites could differ in their acute responsiveness to BDNF, we devised a more direct test, blocking α7-nachrs with αbgt and comparing sepscs in cultures treated with or without co-applied BDNF. Even with αbgt present to block α7-nachrs, however, BDNF applied for h was still able to increase sepsc frequency (Fig. 7c, right), with all events now displaying slow decay kinetics indicative of α3*-nachrs. These results indicate that brief- (10-30 min) and intermediate-duration exposures to BDNF (16-24 h) can increase sepsc frequency and do so without a requirement for α7-nachrs. Nevertheless, α7-nachrs are strongly implicated in long-term synaptic regulation (Role and Berg, 1996; MacDermott et al., 1999; Liu et al., 2001; Kawai et al., 2002). Thus since 4-5 d BDNF treatments also increased sepsc frequency and were required to detect significant changes in α7-nachrs, we cannot exclude the possibility that chronic neurotrophin exposure sustains the long-term function of neuronal nicotinic synapses in ways that somehow depend on α7-nachrs. 73

79 Discussion Detection of trkb and BDNF We have shown that trkb and BDNF-like proteins are present in the chick CG, a model parasympathetic system, where both trks and neurotrophins were presumed irrelevant. No other studies have attempted to detect trkb protein in CG, however, previous Northern and ribonuclease protection analyses failed to detect trkb mrna (Dechant et al., 1993a; Hallbook et al., 1995) possibly because of the lower sensitivity of these assays compared to RT-PCR. Standard criteria for trkb primer (Garner and Large, 1994); (Garner et al., 1996) and antiserum specificity (von Bartheld et al., 1996), as well as controls involving primer and primary antiserum omission (this study) support our detection of trkb mrna in CG, and cell surface trkb protein on CG neurons. In addition, the observations that BDNF elicits trk-dependent signaling leading to CREB activation and trk-dependent changes in α7-nachrs and synaptic function further indicate that CG neurons express functional trkb. Since the trkb antiserum used recognizes an extracellular epitope (von Bartheld et al., 1996), and PCR amplifications using F/R K- primers revealed the presence of isoforms lacking an intracellular kinase domain, however, some trkb immunoreactivity may represent truncated receptor. While the role of kinase-deficient trk isoforms is poorly understood, the notion they are expressed on CG neurons is strengthened by the observation that in 50% of neurons BDNF application failed to induce pcreb, a process expected to require trkb kinase activity (Finkbeiner et al., 1997; Huang and Reichardt, 2003). In such cases, full-length trkb receptors may still be present but either rendered functionally incompetent or expressed at levels insufficient to activate CREB since 74

80 truncated trk isoforms have been reported to inhibit both the function and expression of full-length receptors (reviewed by (Huang and Reichardt, 2003). BNDF/trkB signaling up-regulates α7-nachrs BDNF treatment for 4-5 d induced trk-dependent increases in α7 subunit mrna, and surface α7-nachrs, and enhanced α7-nachr-mediated whole-cell currents, all without changing levels of α3 subunit mrna or α3*-nachr-mediated currents. Similarly, NGF has been shown to selectively increase expression of α7- over α3-nachr subunit mrna in sympathetic neuron-like PC12 cells (Takahashi et al., 1999). Although alterations in receptor turnover rates and mrna stability may contribute, a straightforward interpretation of our results is that BDNF activation of trkb leads to increased α7-nachr subunit transcription and protein synthesis, thereby increasing levels of assembled cell-surface receptor. One way BDNF/trkB signaling may influence α7-nachr subunit transcription is through activation of transcription factors including not only CREB (Finkbeiner et al., 1997), but also AP-1, or NF-κB, which like CREB are reported to be stimulated by BDNF/trkB signaling (Gaiddon et al., 1996; Lipsky et al., 2001). CRE binding sites are present in promoter-containing regions of human and bovine α7-nachr subunit genes, although in the chicken gene a 1298 bp 5 segment with a basal promoter at -406 to -230 was previously reported to lack a strong consensus CRE binding site (Matter-Sadzinski et al., 1992; Gault et al., 1998). Within this same 5 region, however, a new search of two transcription factor databases (TRANSFAC; (Heinemeyer et al., 1998), and Matinspector, did reveal a potential (-) 75

81 strand CRE binding site (T GACcTAA ) upstream from the basal promoter. Potential binding sites for AP-1 (T -715 TcACTCAG -708 ) and NF-kappaB (G -176 GGGgcTCCC -167 ) were also predicted in the 5 -flanking and basal promoter regions, respectively. These considerations suggest that BDNF/trkB signaling can regulate the chicken α7-nachr subunit gene via CRE, AP-1, or NF-κB. Without experimental data, however, it is difficult to judge the significance of these transcription factors as direct regulators. Here, it should be noted that binding sites for Egr-1, Sp1, and Sp3, transcription factors not associated with BDNF/trkB signaling, are thought to regulate the activity of the rat α7-nachr promoter (Nagavarapu et al., 2001). BNDF increases activity at nicotinic synapses on CG neurons BDNF increased sepsc frequency after acute (10-30 min), intermediate (16-24 h) or long-term (4-5 d) treatments. The increased sepsc frequency following acute BDNF exposure depended on trkb activation, and resembled that seen at other peripheral and central synapses, where enhanced transmitter release from presynaptic terminals is implicated (McAllister et al., 1999; Schnider and Poo, 2000; Poo, 2001). The basis of the acute synaptic effects seen here and in these other systems is unknown, but seems likely to reflect BDNF actions on Ca 2+ (Berninger et al., 1993; Stoop and Poo, 1996); (Li et al., 1998) and vesicular dynamics (Pozzo-Miller et al., 1999); Tyler et al., 2002) in presynaptic terminals that enhance neurotransmission reliability. The compelling possibility that Ca 2+ -permeable, presynaptic α7-nachrs underlie these effects (e.g. (Gray et al., 1996; Coggan et al., 1997; Sharma and Vijayaraghavan, 2003) is unlikely, however, 76

82 because acute BDNF exposure failed to modulate somatic α7-nachr currents and, more telling, because co-incubation with αbgt failed to block the ability of BDNF to increase sepsc frequency. Also unlikely are general effects on membrane excitability as seen for PC12 cells (e.g. (Rudy et al., 1987; Lesser et al., 1997) because BDNF treatments failed to detectably change the amplitude or voltage-sensitivity of somatic Na + or Ca 2+ currents. In addition to increasing overall sepsc frequency 3-fold, h BDNF treatments specifically increased the amplitude of α7-nachr-mediated sepscs. While we cannot exclude increased quantal release at presynaptic nerve terminals that contact only α7-nachr clusters, this effect seems more likely to be postsynaptic in origin. Unlike currents induced by rapid nicotine microperfusion, which represent nachr function integrated over the entire soma and report only a nominal increase, sepscs are focal events and an increase in their amplitude would be expected even after adding a few functional receptors in the postsynaptic membrane. The increase in α7-nachr-mediated sepsc amplitudes agrees well with the increased postsynaptic α7-nachr clusters previously observed in hippocampal neuron cultures (Kawai et al., 2002) and with the nominal increase in [ 125 I]-αBgt binding seen here after h exposure to BDNF and the significant increase seen after 5 d. The elevated sepsc amplitude could reflect increased α7-nachr synthesis, and/or preferential insertion at existing postsynaptic sites, but we cannot presently distinguish between these possibilities. 77

83 Long-term synaptic enhancement Our findings indicate that acute- and intermediate-term BDNF treatments increased synaptic activity without a requirement for α7-nachrs. Chronic (4-5 d) BDNF treatments continued to enhance synaptic activity, however, and, in parallel, significantly increased α7-nachr levels and whole-cell currents. α7-nachrs have been linked to activity-dependent neurite outgrowth and other developmental processes (reviewed by (Margiotta and Pugh, 2004) that may normally help ensure appropriate synaptogenesis or sustain existing functional synapses once formed (reviewed by (Role and Berg, 1996; Broide and Leslie, 1999; Jones et al., 1999). In addition, BDNF has been shown to have potent long-term effects on synaptic development and maintenance in other systems (reviewed by (Poo, 2001). Thus while further experiments are needed, it remains possible that, in contrast to short- and intermediate-term α7-nachr-independent effects, the ability of BDNF/signaling to sustain long-term synaptic function is related somehow to coincident regulation of α7-nachrs. In-vivo relevance? Our results do not directly address the relevance of signals generated by BDNF through trkb for CG neurons in vivo. That targets and target-derived factors influence the survival, growth and differentiation of input neurons, however, has been recognized for decades (Berg, 1984; Levi-Montalcini, 1987). Specific to this report, previous studies demonstrated that synapses on CG neurons undergo patterned maturation between E8 and 78

84 E18, and that normal neuron survival and ganglionic transmission require connection to the intraocular muscle targets (Landmesser and Pilar, 1974a, b). More recent experiments indicate that α7-subunit mrna, and α7-nachr protein and currents all increase during the same developmental period (Corriveau and Berg, 1993; Blumenthal et al., 1999) and that severing peripheral target connections reduces levels of α7-mrna and protein (Brumwell et al., 2002). Given the importance of target connections in sustaining α7-nachrs and synapses, the presence of BDNF-like protein in the iris target suggests it may influence synaptic properties of CG neurons during development in vivo. The precise spatial and temporal patterns of BDNF and trkb expression still need to be determined. Our PCR and ELISA results suggest, however, that BDNF is both synthesized within the CG, perhaps by the neurons themselves, and transported to the ganglion from the iris muscle. Such local BDNF expression and retrograde transport from the target are consistent with the arrangement in spinal cord (Koliastsos et al., 1993) and would concentrate BDNF in the iris and CG relative to its levels in eye extract, as was observed here. In addition to BDNF, NGF and NT-3 signaling may also be important in the CG system since recent findings indicate mrnas for trka and trkc are expressed in the ganglion, and CG neurons express trka and trkc immunoreactivity (Dittus et al., 2002). Experiments are in progress to reassess the ability of NGF, NT-3, and BDNF to promote CG neuronal survival, and to identify their respective roles in regulating nachr expression and nicotinic synaptic differentiation on these parasympathetic neurons. 79

85 References Anderson DJ (1999) Lineages and transcription factors in the specification of vertebrate primary sensory neurons. Current Opinion in Neurobiology 9: Berg DK (1984) New neuronal growth factors. Annu Rev Neurosci 7. Berninger B, Garda DE, Inagaki N, Hahnel C, Lindholm D (1993) BDNF and NT-3 induce intracellular Ca 2+ -elevation in hippocampal neurons. Neuroreport 4: Blumenthal EM, Shoop RD, Berg DK (1999) Developmental changes in the nicotinic responses of ciliary ganglion neurons. J Neurophysiol 81: Broide RS, Leslie FM (1999) The a7 nicotinic receptor in neuronal plasticity. Molecular Neurobiology 20:1-16. Brumwell CL, Johnson JL, Jacob MH (2002) Extrasynaptic a7-nicotinic acetylcholine receptor expression in developing neurons is regulated by inputs, targets, and activity. J Neuroscience 22: Burns AL, Benson D, Howard MJ, Margiotta JF (1997) Chick ciliary ganglion neurons contain transcripts coding for acetylcholine receptor-associated protein at synapses (Rapsyn). J Neurosci 17: Causing CG, Gloster A, Aloyz R, Bamji SX, Chang E, Fawcett J, Kuchel G, Miller FD (1997) Synaptic innervation density is regulated by neuron-derived BDNF. Neuron 18:

86 Chen M, Pugh P, Margiotta J (2001) Nicotinic synapses formed between chick ciliary ganglion neurons in culture resemble those present on the neurons in vivo. J Neurobiol 47: Coggan JS, Paysan J, Conroy WG, Berg DK (1997) Direct recording of nicotinic responses in presynaptic nerve terminals. J Neurosci 17: Conroy WG, Berg DK (1995) Neurons can maintain multiple classes of nicotinic acetylcholine receptors distinguished by different subunit compositions. J Biol Chem 270: Corriveau RA, Berg DK (1993) Coexpression of multiple acetylcholine receptor genes in neurons: quantification of transcripts during development. J Neurosci 13: Couturier S, Erkman L, Valera S, Rungger D, Bertrand S, Boulter J, Ballivet M, Bertrand D (1990a) a5, a3, and non-a3: three clustered avian genes encoding nicotinic acetylcholine receptor-related subunits. JBC 265: Couturier S, Bertrand D, Matter J-M, Hernandez M-C, Bertrand S, Millar N, Valera S, Barkas T, Ballivet M (1990b) A neuronal nicotinic acetylcholine receptor subunit (a7) is developmentally regulated and forms a homo-oligomeric channel blocked by a-btx. Neuron 5: Dechant G, Biffo S, Okazawa H, Kolbeck R, Pottgiesser J, Barde YA (1993) Expression and binding characteristics of the BDNF receptor chick trkb. Development 119:

87 Deisseroth K, Mermelstein PG, Xia H, Tsien RW (2003) Signaling from synapse to nucleus: the logic behind the mechanisms. Current Opinion in Neurobiology 13: Dichter MA, Fischbach GD (1977) The action potential of chick dorsal root ganglion neurones maintained in cell culture. J Physiol 267: Dittus JJ, Pugh PC, Howard MJ, Margiotta JF (2002) Parasympathetic ciliary ganglion neurons express trks but neurotrophins fail to fully support their survival. Society for Neuroscience Abstracts 28. Finkbeiner S, Tavazoie SF, Maloratsky A, Jacobs KM, Harris KM, Greenberg ME (1997) CREB: A major mediator of neuronal neurotrophin responses. Neuron 19: Finn TP, Kim S, Nishi R (1998) Overexpression of ciliary neurotrophic factor in vivo rescues chick ciliary ganglion neurons from cell death. Journal of Neurobiology 34: Gaiddon C, Loeffler JP, Larmet Y (1996) Brain-derived neurotrophic factor stimulates AP-1 and cyclic AMP-responsive element dependent transcriptional activity in central nervous system neurons. J Neurochemistry 66: Garner AS, Large TH (1994) Isoforms of the avian TrkC receptor: a novel kinase insertin dissociates transformation and process outgrowth from survival. Neuron 13:

88 Garner AS, Menegay HJ, Boeshore KL, Xie X-Y, Voci JM, Johnson JE, Large TH (1996) Expression of TrkB receptor isoforms in the developing avian visual system. J Neuroscience 16: Gault J, Robinson M, Berger R, Drebing C, Logel J, Hopkins J, Moore T, Jacobs X, Merriwether J, Choi MJ, Kim EJ, Walton K, Buiting K, Davis A, Breese C, Freedman r, Leonard S (1998) Genomic organization and partial duplication of the human a7 neuronal nicotinic acetylcholine receptor gene (CHRNA7). Genomics 52: Gonzalez M, Ruggiero FP, Chang Q, Shi YJ, Rich MM, Kraner S, Balice-Gordon RJ (1999) Disruption of Trkb-mediated signaling induces dissasembly of postsynaptic receptor complexes at nueromuscular junctions. Neuron 24: Gray R, Rajan A, Radcliffe K, Yakehiro M, Dani J (1996) Hippocampal synaptic transmission enhanced by low concentrations of nicotine. Nature 383: Greenberg ME, Ziff EB (2001) Signal transduction in the postsynaptic neuron. Activity dependent regulation of gene expression. In: Synapses, pp Baltimore, MD: Johns Hopkins University Press. Hallbook F, Backstrom A, Kullander K, Kylberg A, Williams R, Ebendal T (1995) Neurotrophins and their receptors in chicken neuronal development. Int J Dev Biol 39: Hashino E, Shero M, Junghans D, Rohrer H, Milbrandt J, Johnson EM, Jr. (2001) GDNF and neurturin are target-derived factors essential for cranial parasympathetic neuron development. Development 128:

89 Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolony NL, Kolchanov NA (1998) Databases on transcriptional regulation: TRANSFAC, TRRD, and COMPEL. Nucleic Acids Res 26: Helfand SL, Smith GA, Wessells NK (1976) Survival and development of dissociated parasympathetic neurons from ciliary ganglia. Developmental Biology 50: Henderson LP, Gdovin MJ, Liu C, Gardner PD, Maue RA (1994) Nerve growth factor increases nicotinic ACh receptor gene expression and current density in wild-type and kinase A-deficient PC12 cells. J Neuroscience 14: Hu M, Liu Q-s, Chang KT, Berg DK (2002) Nicotinic regulation of CREB activation in hippocampal neurons by glutamatergic and nonglutamatergic pathways. Molecular and Cellular Neuroscience 21: Huang EJ, Reichardt LF (2001) Neurotrophins: Roles in neuronal development and function. Annual Review of Neuroscience 24: Huang EJ, Reichardt LF (2003) Trk receptors: roles in neuronal signal transduction. Annu Rev Biochem 72: Impey S, Mark M, Villacres EC, Poser S, Chvkin C, Storm DR (1996) Induction of CRE-mediated gene expression by stimuli that generate long-lasting LTP in area CA1 of the hippocampus. Neuron 16:

90 Isackson PJ, Towner MD, Huntsman MM (1991) Comparison of mammalian, chicken and Xenopus brain-derived neurotrophic factor coding sequences. FEBS Lett 285: Jones S, Sudweeks S, Yakel JL (1999) Nicotinic receptors in the brain: correlating physiology with function. Trends Neurosci 22. Kaplan DR, Miller FD (2000) Neurotrophin signal transduction in the nervous system. Current Opinion in Neurobiology 10: Kawai H, Zago W, Berg DK (2002) Nicotinic alpha 7 receptor clusters on hippocampal GABAergic neurons: regulation by synaptic activity and neurotrophins. J Neuroscience 22: Koliastsos VE, Clatterbuck RE, Winslow JW, Cayouette MH, Price DL (1993) Evidence that brain-derived neurotrophic factor is a trophic factor for motor neurons in vivo. Neuron 10: Krieglstein K, Farkas L, Unsicker K (1998) TGF-beta regulates the survival of ciliary ganglionic neurons synergistically with ciliary neurotrophic factor and neurotrophins. Journal of Neurobiology 37: Landmesser L, Pilar G (1972) The onset and development of transmission in the chick ciliary ganglion. J Physiol 222: Landmesser L, Pilar G (1974a) Synaptic transmission and cell death during normal ganglionic development. J Physiol 241: Landmesser L, Pilar G (1974b) Synapse formation during embryogenesis on ganglion cells lacking a periphery. J Physiol 241:

91 Lee VM, Sechrist JW, Bronner-Fraser M, Nishi R (2002) Neuronal differentiation from postmitotic precursors in the ciliary ganglion. Dev Biology 252: Lesser SS, Sherwood NT, Lo DC (1997) Neurotrophins differentially regulate voltage-gated ion channels. Mol Cell Neurosci 10: Leung DW, Parent AS, Cachianes G, Esch F, Coulombe JN, Nickolies D, Eckenstein FP, Nishi R (1992) Cloning, expression during development, and evidence for release o a trophic factor for ciliary ganglion neurons. Neuron 8: Levi-Montalcini R (1987) The nerve growth factor: thirty-five years later. EMBO J 6: Lewin GR, Barde YA (1996) Physiology of the neurotrophins. Annual Review of Neuroscience 19: Li Y-X, Zhang Y, Lester HA, Schuman EM, Davidson N (1998) Enhancement of Neurotransmitter Release Induced by Brain-Derived Neurotrophic Factor in Cultured Hippocampal Neurons. J Neurosci 18: Lindsay RM, Thoenen H, Barde YA (1985) Placode and neural crest-derived sensory neurons are responsive at early developmental stages to brain-derived neurotrophic factor. Dev Biology 112: Lipsky RH, Xu K, Zhu D, Kelly C, Terhakopian A, Novelli A, Marini AM (2001) Nuclear factor kappab is a critical determinant in N-methyl-D-aspartate receptor mediated neuroprotection. J Neurochemistry 78:

92 Liu Y, Ford B, Mann MA, Fischbach GD (2001) Neuregulins Increase a7 Nicotinic Acetylcholine Receptors and Enhance Excitatory Synaptic Transmission in GABAergic Interneurons of the Hippocampus. J Neurosci 21: Loeb JA, Hmadcha A, Fischbach GD, Land SJ, Zakarian VL (2002) Neuregulin expression at neuromuscular synapses is modulated by synaptic activity and neurotrophic factors. Journal of Neuroscience 22: Lohof AM, Ip NY, Poo M-m (1993) Potentiation of developing neuromuscular synapses by the neurotrophins NT-3 and BDNF. Nature 363: MacDermott AB, Role LW, Siegelbaum SA (1999) Presynaptic ionotropic receptors and the control of transmitter release. Annu Rev Neurosci 22: Maisonpierre PC, Belluscio L, Conover JC, Yancopoulos GD (1992) Gene sequences of chicken BDNF and NT-3. DNA Seq 3: Margiotta J, Pardi D (1995) Pituitary adenylate cyclase-activating polypeptide type I receptors mediate cyclic AMP-dependent enhancement of neuronal acetylcholine sensitivity. Mol Pharmacol 48: Margiotta J, Pugh P (2004) Nicotinic acetylcholine receptors in the nervous system. In: Molecular and Cellular Insights to Ion Channel Biology (Maue RA, ed), pp Amsterdam: Elsevier B.V. Margiotta JF, Berg DK (1982) Functional synapses are established between ciliary ganglion neurons in dissociated cell culture. Nature 296: Marwitt R, Pilar G, Weakley JN (1971) Characterization of two cell populations in the avian ciliary ganglion. Brain Research 25:

93 Matter-Sadzinski L, Hernandez M, Roztocil T, Ballivet M, Matter J (1992) Neuronal specificity of the a7 nicotinic acetylcholine receptor promoter develops during morphogenesis of the central nervous system. EMBO J 11: McAllister AK, Katz LC, Lo DC (1999) Neurotrophins and synaptic plasticity. Annu Rev Neurosci 22: McGehee D, Heath M, Gelber S, Devay P, Role L (1995) Nicotinic enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science 269: McNerney M, Pardi D, Pugh P, Nai Q, Margiotta J (2000) Expression and channel properties of a-bungarotoxin-sensitive acetylcholine receptors on chick ciliary and choroid neurons. J Neurophysiol 84: Nagavarapu U, Danath S, Boyd RT (2001) Characterization of a rat neuronal nicotinic acetylcholine receptor a7 promoter. J Biological Chemistry 276: Nai Q, Mcintosh JM, Margiotta JF (2003) Relating neuronal nicotinic acetylcholine receptor subtypes defined by subunit composition and channel function. Molecular Pharmacology 63: Nishi R, Berg DK (1981) Two components from eye tissue that differentially stimulate the growth and development of ciliary ganglion neurons in cell culture. Journal of Neuroscience 1: Pardi D, Margiotta JF (1999) Pituitary adenylate cyclase-activating polypeptide activates a phospholipase C-dependent signal pathway in chick ciliary ganglion neurons that selectively inhibits a7-containing nicotinic receptors. J Neurosci 19:

94 Pizzorusso T, Ratto GM, Putignano E, Maffei L (2000) Brain-derived neurotrophic factor causes camp response element-binding protein phoshporylation in absence of calcium increases in slices and cultured neurons from rat visual cortex. J Neuroscience 20: Poo M-m (2001) Neurotrophins as synaptic modulators. Nature Reviews Neuroscience 2: Pozzo-Miller LD, Gottschalk W, Zhang L, McDermott K, Du J, Gopalakrishnan R, Oho C, Sheng Z-H, Lu B (1999) Impairments in High-Frequency Transmission, Synaptic Vesicle Docking, and Synaptic Protein Distribution in the Hippocampus of BDNF Knockout Mice. J Neurosci 19: Pugh P, Margiotta J (2000) Nicotinic acetylcholine receptor agonists promote survival and reduce apoptosis of chick ciliary ganglion neurons. Mol Cell Neurosci 15: Pugh PC, Berg DK (1994) Neuronal acetylcholine receptors that bind a-bungarotoxin mediate neurite retraction in a calcium-dependent manner. J Neurosci 14: Rifkin JT, Todd VJ, Anderson LW, Lefcort F (2000) Dynamic expression of neurotrophin receptors during sensory neuron genesis and differentiation. Developmental Biology 227. Rohrer H, Sommer I (1982) Simultaneous expression of neuronal and glial properties by chick ciliary ganglion cells during development. J Neuroscience 3: Role LW, Berg DK (1996) Nicotinic receptors in the development and modulation of CNS synapses. Neuron 16:

95 Rudy B, Kirschenbaum B, Rukenstein A, Greene LA (1987) Nerve growth factor increases the number of functional Na channels and induced TTX-resistant Na channels in PC12 pheochromocytoma cells. J Neuroscience 7: Schnider AS, Poo M-M (2000) The neurotrophin hypothesis for synaptic plasticity. Trends in Neurosci 23: Schoepfer R, Conroy WG, Whiting P, Gore M, Lindstrom J (1990) Brain a-bungarotoxin binding protein cdnas and MAbs reveal subtypes of this brain of the ligand-gated ion channel gene superfamily. Neuron 5: Schropel A, von Schack D, Dechant G, Barde YA (1995) Early expression of the nerve growth factor receptor ctrka in chick sympathetic and sensory ganglia. Mol Cell Neurosci 6: Schuman EM (1999) Neurotrophin regulation of synaptic transmission. Current Opin in Neurobiol 9: Sharma G, Vijayaraghavan S (2003) Modulation of presynaptic store calcium induces release of glutamate and postsynaptic firing. Neuron 38: Steljes TPV, Kinoshita Y, Wheeler EF, Oppenheim RW, von Bartheld CS (1999) Neurotrophic factor regulation of developing avian occulomotor neurons: differential effects of BDNF and GDNF. J Neurobiology 41: Stone EM, Rothblum KN, Alevy MC, Kuo TM, Schwartz RJ (1985) Complete coding sequence of the chicken glyceraldehyde-3-phosphate dehydrogenase gene. PNAS 82:

96 Stoop R, Poo M-m (1996) Synaptic modulation by neurotrophic factors: differential and synergistic effects of brain-derived neurotrophic factor and ciliary neurtotrophic factor. J Neuroscience 16: Takahashi T, Yamashita H, Nakamura S, Ishiguro H, Nagatsu T, Kawakami H (1999) Effects of nerve growth factor and nicotine on the expression of nicotinic acetylcholine receptor subunits in PC12 cells. Neuroscience Research 35: Tyler WJ, Perrett SP, Pozzo-Miller LD (2002) The role of neurotrophins in neurotransmitter release. Neuroscientist 8: Vernallis AB, Conroy WG, Berg DK (1993) Neurons assemble AChRs with as many as 3 kinds of subunits while maintaining subunit segregation among subtypes. Neuron 10: von Bartheld CS, Williams R, Lefcort F, Clary DO, Reichardt LF, Bothwell M (1996) Retrograde transport of neurotrophins from the eye to the brain in chick embryos: roles of the p75 NTR and trkb receptors. J Neuroscience 16: Wescamp G, Reichardt LF (1991) Evidence that biological activity of NGF is mediated through a novel subclass of high-affinity receptors. Neuron 6: Wonnacott S (1997) Presynaptic nicotinic ACh receptors. Trends Neurosci 20: Yeh JJ, Ferreira M, Ebert S, Yasuda RP, Kellar KJ, Wolfe BB (2001) Axotomy and nerve growth factor regulate levels of neuronal nicotinic acetylcholine receptor a3 subunit protein in the rat superior cervical ganglion. J Neurochemistry 79: Ying SW, Futter M, Rosenblum K, Webber MJ, Hunt SP, Bliss TV, Bramham CR (2002) Brain-derived neurotrophic factor induces long-term potentiation in intact adult 91

97 hippocampus: requirement for ERK activation coupled to CREB upregulation and Arc synthesis. J Neuroscience 22:

98 Figure Legends 1. Detection of trkb transcripts in ciliary ganglia. (a) PCR amplifications were conducted on cdnas from E8 CG, E14 CG and E15 DRG using primer pairs specific for chicken full-length trkb (K+), kinase-deleted trkb (K-), or GAPDH (GAP) and the resulting products separated by gel electrophoresis. Arrowheads at 700 bp and dots at 400, 500, and 600 bp (E14 CG shown) mark product sizes expected for K+ trkb and for the truncated K- trkb isoforms, respectively. (b) Schematics of K+ and K- trkb isoforms showing extracellular (EC), transmembrane (TM), and kinase (K) domains. The striped bar in the lower schematic depicts the variable-length juxtamembrane region responsible for the multiple amplification products found for K- trkb in a. Horizontal lines indicate the trkb products expected for the K+ (713 bp) and largest K- ( 600 bp) trkb isoforms. (c) HpaII digestion (+) of CG and DRG K+ trkb amplification products (site marked by * in b) yielded restriction fragments of identical and predicted sizes (499 and 214 bp). Undigested K+ trkb (-). Lane markers in a and c depict a 100 bp DNA ladder ( bp). 2. Localization of trkb protein to ciliary ganglion neurons. (a-c) Ganglion sections obtained from E8 CG, E14 CG, and E15 DRG, displayed neuronal immunoreactivity after labeling with primary antiserum recognizing an extracellular epitope of chicken trkb. Both intracellular and cell-surface trkb labeling (arrows) was evident. Insets in a and b show freshly-dissociated E8 and E14 CG neurons displaying punctate cell-surface trkb labeling (arrowheads). (d, e) trkb labeling of E8 CG neuron somata and processes after 8h (d) and on day 4 (d4) in culture (e). (f, g) To 93

99 demonstrate specificity, E14 CG sections (f) and d4 CG cultures (g) processed without the trkb primary antiserum were unlabeled, as were E8 CG, E15 DRG, acutely-dissociated CG neurons, and 8h CG cultures (data not shown). Scale bar in g represents 20 µm and applies to all panels. 3. Detection of BDNF protein and mrna. (a) ELISAs demonstrate the presence of BDNF-like protein in tissue homogenates prepared from a ciliary neuron target, the iris constrictor muscle (Iris, black bar), as well as from E8 and E14 CG (gray bars). BDNF was not present at detectable levels (N.D.) in 10% eye extract (10% eye), 10% heat inactivated horse serum (10% hs), or 10% chicken serum (10% cs). (b) PCR primers specific for chicken BDNF (top row) amplified products consistent with the expected size of 462 bp (arrow) from cdna derived from E8 and E14 CG, and in separate experiments from E8 CG neurons after 4 d growth in culture. GAPDH amplifications (bottom row, 449 bp) were performed as positive controls in parallel reactions from paired experiments. 4. BDNF induction of CREB phosphorylation indicates trkb receptors on CG neurons are functional. (a-c) Nearly all CG neuron nuclei (labeled by DAPI staining in a) displayed detectable p-creb immunoreactivity after treatment with 100 nm PACAP (b) whereas p-creb immunoreactive neuronal nuclei were virtually absent in untreated cultures (c). (d-f) After incubation with BDNF, many neuron nuclei displayed detectable p-creb immunoreactivity (d), which was absent in cultures co-treated with 50 ng/ml BDNF and 200 nm K252a (e) or 50 µm PD98059 (f). Scale 94

100 bar indicates 20 µm and applies to all panels. Arrowheads and dots mark neuronal nuclei scoring as p-creb positive and negative, respectively. (g) Summary of treatment results. Bars represent the mean percent of neurons per field with p-creb immunoreactive nuclei following the indicated treatments (N= neurons in 6-18 fields from 2 experiments). Asterisks indicate a significant difference (p<0.001, unpaired t-test) from untreated cultures tested in parallel. 5. BDNF increases α7-nachr surface sites and α7-nachr subunit mrna. (a) α7-nachr levels were determined by quantifying [ 125 I]-αBgt surface binding sites in CG neuron cultures maintained for 5 d. Data points indicate mean (± S.E.M) fmoles [ 125 I]-αBgt bound per ganglion equivalent relative to control cultures after exposure to BDNF for 0h (N=12), 4 h (from day 5, N=3), 16 h (from day 4, N=6) or 5 d (from day 0, N=10). The open circle depicts relative [ 125 I]-αBgt binding levels for cultures treated with both BDNF and ChEX (N=3). Asterisk indicates a significant increase in [ 125 I]-αBgt binding after 5 d exposure compared to untreated control cultures from the same platings (p<0.05) and applies to BDNF incubations with and without ChEX. (b) Separate PCR amplifications were conducted on cdnas isolated from control or BDNF-treated (4-5 d) CG neuron cultures (with or without ChEX) on d 4 or d 5 using primer pairs specific for the indicated chicken nachr subunit or βa. (b, left) The resulting products were separated by gel electrophoresis and had sizes appropriate for and βa (275 bp), α7-nachr subunit (522 bp) (arrows) and α3-nachr subunit (252 bp, not shown). In the example shown note that the intensity of α7-nachr subunit 95

101 relative to βa product was higher for BDNF-treated cultures (with or without ChEX) than for controls. (b, right) Summary of mean (± S.E.M.) relative α7-nachr and α3-nachr subunit product fluorescence intensity under different treatment conditions. In this gel-based assay, the relative levels of α7-nachr subunit mrna were 53 ± 10% higher in BDNF-treated (black bar) compared to control cultures (white bar) within the same experiments (*, p<0.01, N=6, paired t-test) and a similar increase (41 ± 15%) persisted when BDNF was applied in the presence of CHEX (hatched bar) to block p75 NTR (p<0.05, N=3). By contrast, the BDNF treatments failed to significantly change mrna levels for α3-nachr subunit (p>0.05, N=5). (c) For confirmation, real-time PCR amplifications were conducted on cdnas isolated from control or BDNF-treated (4-5 d) CG neuron cultures using primer pairs specific for the indicated chicken nachr subunit or GAPDH. Using this approach, the levels of α7-nachr subunit mrna were 98 ± 26% higher in BDNF-treated (gray bar) compared to control cultures (white bar) (*, p<0.02, N=5, unpaired t-test) while mrna levels for α3-nachr subunit were unchanged (p>0.1, N=4). 6. BDNF enhances α7-nachr currents. CG neurons were held at 70 mv, and whole-cell nachr currents induced by pressure microperfusion with 20 µm Nicotine (2 sec, psi). (a) Example records showing that α7-achrs mediate the initial fast current component (I fast, top trace) since this component was absent in neurons incubated with αbgt (60 nm, 30 min, middle trace). I fast was enhanced after treating CG neuron cultures with BDNF (4 d, 50 ng/ml, lower trace). Calibration: 100 msec 96

102 and 200 pa. (b) Summary of αbgt and BDNF effects on α7-nachr currents. Left: I fast normalized for membrane capacitance (I fast /C m, black bars) was absent, but I slow /C m reduced only slightly (white bars) in cultures treated with αbgt (+, N=8) relative to control neurons tested in parallel (-, N=12). Right: In neurons with detectable I fast, 3-4 d BDNF treatment signifcantly increased I fast /C m by 49 ± 14% (N=63) relative to untreated controls tested in parallel (N=52). In the same records, I slow /C m, the α3*-nachr-mediated current component was not significantly different (p=0.08) for control, and BDNF-treated neurons (N=80 and 76, respectively). Shorter treatment times of min (0.2 h, N=9) or h (not shown) failed to detectably alter either fast, α7- or slow, α3*-nachr mediated currents. (c) 3-4 d exposure to BDNF increased the proportion of neurons with detectable I fast from 65 ± 5% (N=80) in control cultures to 83 ± 4% (N=76) in treated cultures. Asterisks indicate a significant difference from untreated controls tested in parallel (p<0.05). 7. BDNF enhances function at nicotinic synapses. (a) Example records of sepscs obtained on day 5 from control and BDNF-treated (16 h, 50 ng/ml BDNF) CG neurons from the same cultures. Calibrations, 25 pa and 100 ms. (b) BDNF treatment effects on sepsc frequency. Values indicate mean (± S.E.M) sepsc frequency in neurons assessed on day 4 or day 5 after exposure to BDNF (black bars) for min (0.2 h, N=71), h (16 h, N=46), or 4-5 d (80 h, N=29) relative to that for control neurons not exposed to BDNF (white bars, N=74, 37, 21, respectively) tested in parallel. (c) Tests for trk and α7-nachr involvement in BDNF-enhanced synaptic function. The 97

103 ability of BDNF to increase sepsc frequency (black bars) is abolished by min co-incubation with 200 nm K252a to block trks (gray bar, left) but unaffected by h co-incubation with αbgt to block α7-nachrs (hatched bar, right). In both b and c, asterisks indicate a significant increase sepsc frequency for the indicated conditions compared to untreated control cultures from the same platings (p<0.05). (d, e) Summary of BDNF treatment effects on α7- and α3*-nachr mediated sepsc amplitudes. Cumulative amplitude distribution histograms are shown for fast-decaying sepscs mediated by α7-nachrs (d) and slow-decaying sepscs mediated by α3*-nachrs (e) in control neurons (open circles) and in neurons treated with 50 ng/ml BDNF for h (filled circles). BDNF treatment resulted in a significant shift in fast sepsc amplitudes (d) from a median of 9.6 pa (N=137) for control neurons to 12.7 pa (N=139) for BDNF-treated neurons (p<0.0004, Mann-Whitney and Kolmogorov-Smirnov tests). By contrast slow sepsc amplitudes (e) were unaffected by the treatment, with median amplitudes of 15.0 pa (N=220) and 14.5 pa (N=180) for control and BDNF-treated neurons, respectively (p>0.06, same tests). Insets show examples of fast and slow sepscs with amplitudes close to the median values for control (top) and BDNF treatment (bottom, with dot) conditions. Calibration bars indicate 10 pa and 2 msec. 98

104 Figure 1. 99

105 Figure

106 Figure

107 Figure

108 Figure

109 Figure

110 Figure

111 In the previous manuscript, the results that BDNF upregulated the expression and function of neuronal AChRs on chicken CG neurons were discussed. Since both BDNF and TrkB were expressed in chicken CG neurons during the embryogenic stage, BDNF/TrkB signaling may be potentially involved in regulating other cellular process of CG neurons. Although previous evidence demonstrated that the application of BDNF in vitro had no effects on supporting the survival of ciliary ganglion neurons (Rohrer and Sommer, 1983; Lindsay et al., 1985b), it should be noted that neurons in the culture were exposed to a concentration at which both TrkB and p75 receptors, which were also expressed on the surface of CG neurons (Allsopp et al., 1993; Yamashita et al., 1999a), were activated by BDNF based on the knowledge of their binding affinities (Rodriguez-Tebar and Barde, 1988; Dechant et al., 1993b). Since it is well known that the activation of p75 receptors is involved in the apoptosis (Dechant and Barde, 1997), the conclusion that BDNF was irrevelant to the survival of parasympathetic neurons may be incomplete due to the interference of p75 receptors. Interestingly recent work from Dr. Pugh has demonstrated that the exposure to BDNF at low concentration supported partial survival of ciliary ganglion neurons (Pugh et al., submitted), which confirmed our previous concern. Depolarization has been shown to support the full survival of CG neurons (Schmidt and Kater, 1995; Pugh and Margiotta, 2000). It was also well known that depolarization-induced activities upregulated the expression of BDNF in other systems (Zafra et al., 1990; Ernfors et al., 1991; Zafra et al., 1991; Lindvall et al., 1992) and the increased release of BDNF may be responsible for the survival of certain neuronal 106

112 population (Hansen et al., 2001). Considering the recent defined role of BDNF in supporting the CG neuronal survival, we speculate that BDNF, in addition to regulate the AChRs on the CG neurons, may also be involved in the depolarization-induced survival. In the following manuscript we explored the expression pattern of BDNF in CG neurons and tested such theory. 107

113 Depolarization promotes survival of ciliary ganglion neurons by BDNF-dependent and independent mechanisms 108

114 Title: Depolarization promotes survival of ciliary ganglion neurons by BDNF-dependent and independent mechanisms Authors: Xiangdong Zhou*, Phyllis C. Pugh, and Joseph F. Margiotta Project Address: Medical University of Ohio Department of Neurosciences Block HS 108, 3035 Arlington Ave. Toledo, OH Corresponding Author: Joseph F. Margiotta, Ph.D., Medical University of Ohio, Department of Neurosciences, BHS 108, 3035 Arlington Avenue, Toledo, OH Tel: ; Fax: *Present Address: Lerner Research Institute, Cleveland Clinic Foundation, 9500 Euclid Ave., NC-30, Cleveland OH

115 ABSTRACT Membrane activity upregulates brain derived neurotrophic factor (BDNF) expression and coordinately supports neuronal survival in many systems. In parasympathetic ciliary ganglion (CG) neurons, activity mimicked by KCl-depolarization supports nearly full survival. BDNF had been considered unable to support CG neuronal survival, but we recently found conditions that unmask its trophic actions. Here we show that BDNF is expressed during CG development and participates in activity-induced neuronal survival. KCl-depolarization increased BDNF mrna and protein in CG neurons. Moreover, application of anti-bdnf blocking antibody or mitogen activated protein kinase (MAPK) kinase inhibitor, attenuated depolarization-supported survival, implicating canonical BDNF signaling. Ca 2+ -Calmodulin kinase II (CaMKII) was also required since CaMKII inhibition combined with anti-bdnf or MAPK kinase inhibitor abolished or greatly reduced the trophic effects of depolarization. Membrane activity may support CG neuronal survival both by inducing BDNF release to activate MAPK and by recruiting CaMKII. This mechanism could have relevance late in development in vivo as ganglionic transmission becomes reliable and the effectiveness of other growth factors has diminished. Key Words: TrkB, neurotrophin, CREB, MAPK, CaMKII, synapse, p75 NTR 110

116 INTRODUCTION Neuronal survival involves integration of signals produced by membrane electrical activity and trophic molecules from target, autocrine, and input sources. Activity is crucial since silencing neurons reduces survival (Lipton, 1986; Furber et al., 1987; Meriney et al., 1987; Catsicas et al., 1992; Galli-Resta et al., 1993) and since KCl-depolarization can support survival without added neurotrophic factors (Scott and Fisher, 1970; Gallo et al., 1987). Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) provides a critical messenger for depolarization-induced survival (Scott and Fisher, 1970; Gallo et al., 1987; Franklin et al., 1995) by activating downstream signaling effectors such as mitogen activated protein kinase (MAPK) and Ca 2+ -Calmodulin kinase II (CaMKII) (Hanson and Schulman, 1992; Hack et al., 1993; Rosen et al., 1994; Farnsworth et al., 1995; Hansen et al., 2001; Borodinsky et al., 2002). In conjunction with activity, protein growth factors, including neurotrophins (NTs, i.e. nerve growth factor, NGF; brain derived neurotrophic factor, BDNF; and neurotrophin-3, NT3), ciliary neurotrophic factor (CNTF) and glial cell line derived neurotrophic factor (GDNF) promote neuronal survival through their high-affinity receptors (Trks, CNTFα/gp130/LIFR, and GFRα1/Ret for NTs, CNTF, and GDNF, respectively) (Huang and Reichardt, 2001; Segal, 2003). NTs, as well as GDNF, promote neuronal survival through MAPK and PI3-K/Akt signaling pathways (Yao and Cooper, 1995; Dudek et al., 1997; Bonni et al., 1999; Airaksinen and Saarma, 2002), while CNTF promotes neuronal survival through activation of JAK/STAT signaling (Ip and Yancopoulos, 1996; Segal and Greenberg, 1996a). 111

117 Chick ciliary ganglion (CG) neurons are a useful model for identifying requirements for parasympathetic neuron survival. Normally, 50% of CG neurons die between E8 and E14 in vivo (Landmesser and Pilar, 1974a). Removing peripheral targets prior to innervation increases neuronal death, indicating that developmental interactions with peripheral targets are necessary for survival (Landmesser and Pilar, 1974b, 1978; Wright, 1981). In cell culture, nearly all CG neurons can survive in media supplemented with neurotrophic factors, such as CNTF (or its avian orthologue, growth promoting activity, GPA), GDNF, or with elevated [KCl] (Nishi and Berg, 1981; Eckenstein et al., 1990; Leung et al., 1992a; Buj-Bello et al., 1995; Pugh and Margiotta, 2000). While CNTF, GPA and GDNF are expressed in CG target tissue (Barbin et al., 1984; Leung et al., 1992a; Buj-Bello et al., 1995; Hashino et al., 2001) they are unlikely to support full CG neuronal survival throughout development in vivo. First, although GPA receptors (GPARα) mediating the effects of GPA and CNTF are present throughout CG development (Heller et al., 1995), the ability of CNTF to promote survival is substantially reduced for neurons at stages later than E12 (Buj-Bello et al., 1995) (PC Pugh and JF Margiotta, unpublished results). Similarly, GDNF potency and efficacy drop significantly for neurons after E10, and expression of GDNF and its high affinity receptor, GFRα1/Ret, decline in parallel well before the end of CG neuron cell death at E14 (Buj-Bello et al., 1995; Hashino et al., 2001). These findings suggest that neurotrophic factors other than CNTF, GPA or GDNF may protect CG neurons during and after the period of programmed ganglionic cell death in vivo. 112

118 Despite previous reports discounting a relevance for NT signaling in CG neurons (Rohrer and Sommer, 1983; Lindsay et al., 1985b; Dechant et al., 1993b; Hallbook et al., 1995), we recently detected BDNF in the CG, and found that the neurons express TrkB receptors that trigger signals able to modulate nicotinic synapses and alter nicotinic receptor expression (Zhou et al., 2004). Ongoing studies further indicate that BDNF supports long-term survival of most CG neurons in culture when applied at sufficiently low concentration to preferentially activate TrkB (Pugh et al., 2005). In other systems depolarization rapidly stimulates NT release, and increases both NT synthesis (Zafra et al., 1990; Castren et al., 1993; Balkowiec and Katz, 2000) and expression levels of catalytically active Trks (Meyer-Franke et al., 1998; Kingsbury et al., 2003). In cortical and spiral ganglion neurons, the increased synthesis and release of BDNF following chronic KCl-depolarization and VDCC activation, indicates that activity enhances neuronal survival, possibly by autocrine regulation of BDNF expression (Ghosh et al., 1994; Hansen et al., 2001). Other studies indicate that depolarization and NTs converge on the same MAPK and PI3-K/Akt pathways to regulate neuron survival (Vaillant et al., 1999). These considerations, and the developmental appearance of BDNF in CG suggest a causal relationship between depolarization and BDNF expression/release that could provide trophic support to the neurons. In testing this hypothesis we found that chronic KCl depolarization dramatically increased both BDNF mrna and protein levels in CG cultures. Moreover, depolarization-induced survival utilized both TrkB-dependent (MAPK) and -independent (CaMKII) signaling effectors. The results suggest that 113

119 activity-regulated BDNF expression and release participates with BDNF-independent processes to promote CG neuronal survival during embryogenesis in vivo. 114

120 Methods Cell Culture CG neuron cultures were prepared under sterile conditions as previously described (Pugh and Margiotta, 2000; Chen et al., 2001; Zhou et al., 2004). Briefly, CG were dissected from embryonic day 8 (E8) chicken embryos, digested with trypsin (0.025%, 15 min) and dissociated by mechanical trituration. Dissociated neurons were plated at 2 ganglion equivalents per 12-mm-diameter glass coverslip (in 15 mm diameter multiwell plates) or 35 mm-diameter polystyrene tissue culture dish; both surfaces were precoated with poly-dl-ornithine and laminin (Pugh and Margiotta, 2000; Chen et al., 2001). The basal culture medium consisted of minimum essential medium containing 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mm glutamine, and 10% heat inactivated horse serum (MEM hs ; all components from Invitrogen, Rockville, MD). Depending on the experiment, MEM hs was supplemented with one or more of the following: KCl (10-20 mm; final KCl concentration mm), BDNF (5 ng/ml), anti-bdnf (10 µg/ml, mab , EMD Biosciences, San Diego, CA), PD98059 (7 µm, EMD Biosciences), or embryonic eye extract (3% v/v). MEM hs containing 3% eye extract (MEM hs/eye ) or 25 mm KCl (MEM hs/k ) was previously shown to support 100% and % survival of CG neurons for at least 7 d in culture (Nishi and Berg, 1981). In all cases, neurons were maintained at 37 C in 95% air and 5% CO 2 for 4-7 d and received fresh culture medium every 2-3 d (Nishi and Berg, 1981). Survival Assay 115

121 Neuronal survival was determined by established morphological criteria, with CG neurons scoring as alive if they displayed large, phase-bright somata that extended processes 2-3 h after plating (Pugh and Margiotta, 2000). For each growth condition, 9-12 fields on 2-3 coverslips were evaluated at 200X magnification using an inverted phase-contrast microscope (Axiovert 10, Zeiss, Thornwood, NY) and the average number of neurons per field per coverslip determined. Neuron counts were repeated at 1, 2 and 4 d after plating and survival expressed as percent of the initial number of neurons present per field per coverslip 2-3h after plating (D0). Real-Time RT-PCR Changes in BDNF mrna levels induced by depolarization were measured using RT-based real-time PCR. cdna samples corresponding to ng of input RNA were combined with Taqman universal PCR master mix (Roche, Branchburg, NJ), forward (F) and reverse (R) primers (0.4 µm), and Taqman probe (0.1 µm) [with 6-FAM (carboxyfluorescein, reporter dye) and TAMRA (tetramethylrhodamine, quencher dye) inserted at 5' and 3' ends, respectively]. Selection of the following primers and probes was optimized using Applied Biosystems (Foster City, CA) Primer-Express software: BDNF (Genbank, M83377): F,: G 290 TCAAGTGCCTTTGGAACCC 309 ; R,: A 420 CAGACGCTCAGTTCCCCAC 401 ; Probe: C 325 TCGAGGAGTACAAAAACTACCTGGATGCTGC 356 ; GAPDH (Stone et al., 1985): 116

122 B F,: C 1795 CGTCCTCTCTGGCAAAGTC 1814 ; R,: A 2374 ACATACTCAGCACCTGCATCTG 2352 ; Probe: A 2211 TCAATGGGCACGCCATCACTATCTTCC 2228 Twenty-five microliter PCRs were performed in triplicate using a GeneAmp 5700 sequence detection system (Applied Biosystems). This system allows the increase in PCR product to be monitored directly based on the threshold number of cycles (C) required to produce a detectable change in fluorescence (ΔF) resulting from the release of probe. Relative levels of BDNF (R B ) in control and KCl-treated cultures were calculated from the difference in C values (ΔC = CControl - C KCl ) for BDNF amplification (ΔC B ) compared with those for the housekeeping gene, GAPDH (ΔC G ) using R B = (E B ΔC B )/(E G ΔC G ) (1). In Equation 1, E B B and EG are the BDNF and GAPDH cdna amplification efficiencies determined in separate studies from the slope of C versus input log cdna dilution where -1/slope E = 10 (Zhou et al., 2004). E and BB E G values obtained in this manner were both 1.8. ELISA The presence of BDNF in ciliary ganglia and neuron cultures was assessed using a commercial BDNF sandwich ELISA kit having no significant cross-reactivity with NGF, NT4/5, or NT3 (Chemikine; Chemicon, Temecula, CA) as previously described (Zhou et 117

123 al., 2004). Levels of BDNF-like protein were quantified within the linear range of the assay (7.8 to 500 pg/ml) using recombinant human BDNF as standard. Statistics All parameter values are expressed as mean ± SEM (or SD where noted). Statistical significance was set at p<0.05, and determined by unpaired, two-tailed t-test when comparing two datasets, or by one-way ANOVA combined with Bonferroni post-hoc multiple comparison testing for three or more datasets using Prism 4.0 (GraphPad Software, San Diego, CA). 118

124 Results and Discussion BDNF is expressed during CG development. BDNF protein was detected in ciliary ganglia throughout the developmental period from E8 to E17, with levels (in pg/mg ganglionic wet weight) declining about 50% from E8 to E14 and remaining stable thereafter (Fig. 1). Since 50% of CG neurons normally die between E8 and E14 due to programmed cell death in the ganglion (Landmesser and Pilar, 1974b) levels of BDNF are seen to remain relatively constant on a per neuron basis during the developmental period examined. We recently found that BDNF is present in E14 iris muscle, the in vivo target of ciliary neurons (Zhou et al., 2004) such that a loss of peripheral target contacts may contribute to the decline in absolute levels of BDNF. Opposing this loss, however, BDNF levels could be maintained by local ganglionic synthesis since BDNF mrna is present in both E8 and E14 ganglia, as well as in CG neuron cultures (Zhou et al., 2004). Depolarizing activity increases BDNF expression and release. Since BDNF mrna and protein levels are increased by depolarization and subsequent Ca 2+ elevation in neurons that express BDNF (Zafra et al., 1990; Ghosh et al., 1994; Goodman et al., 1996), we reasoned that levels of BDNF might display a similar activity-dependence in CG neurons. This possibility was tested by exposing CG neurons to elevated KCl concentrations in cell culture as a means of mimicking sustained depolarizing activity (Fig. 2). When CG neurons were grown for 3-4 d in MEM hs/eye containing 25 mm KCl, BDNF mrna levels assessed by real-time RT-PCR were 23.4 ± 5.7 fold higher than in parallel control cultures grown in standard MEM hs/eye containing 5 mm KCl (n=3 test and control cultures, 119

125 p<0.05). Shorter exposure times appeared less effective; in two experiments, exposing cultures to 25 mm KCl overnight increased levels of BDNF mrna by 8.3 fold compared to controls maintained in MEM hs/eye containing 5 mm KCl for 4 d (data not shown). Supplementing MEM hs/eye with nicotine (20 µm, 3-4 d) to activate nachrs and depolarize CG neurons also significantly increased BDNF mrna levels. The magnitude of the nicotine effect was much smaller (1.5 ± 0.1 fold, n=4, p<0.05), however, than seen with KCl, presumably because nachrs desensitize thereby limiting the amount of sustained depolarization and subsequent elevation of intracellular Ca 2+. In accord with the upregulation in BDNF mrna, levels of BDNF-like protein were also dramatically increased by chronic depolarization. In cell extracts from two cultures grown in MEM hs/eye containing 25 mm KCl, BDNF levels were 419 ± 3 pg/ml (mean ± SD) compared with nearly undetectable amounts (8 ± 3 pg/ml) seen in control MEM hs/eye (p<0.05). As in other systems (Zafra et al., 1990; Ghosh et al., 1994; Goodman et al., 1996) activity-dependent BDNF release was also demonstrable in CG cultures, with high levels of BDNF-like protein appearing in 25 mm KCl culture media (200 ± 64 pg/ml, n=2) compared with undetectable levels for control cultures maintained in MEM hs/eye. These findings indicate that activity-dependent processes can potently upregulate expression of BDNF mrna and protein in CG neurons, and are consistent with the somewhat smaller 5-10 fold increases in BDNF expression seen for hippocampal neurons following shorter depolarization treatment (Zafra et al., 1990; Goodman et al., 1996). As concluded previously for cortical neurons (Ghosh et al., 1994), depolarization may upregulate BDNF transcription and release from CG neurons themselves, or from adjacent non-neuronal 120

126 cells present in the culutres. Consistent with the former (autocrine) model, other studies have demonstrated that activity- and Ca 2+ -dependent mechanisms activate transcription factors (e.g. CREB, c-fos) in CG neurons (Chang and Berg, 2001). These or other activity-dependent transcription factors could underlie the upregulation of BDNF induced by chronic KCl or nicotine exposure, as seen here. Regardless of its source, release of endogenous BDNF would be expected to activate TrkB receptors, known to be present and functional on CG neruons and thereby able to trigger intracellular signals relevant to regulating nicotinic receptors and synaptic function (Zhou et al., 2004) and supporting survival (Pugh et al., 2005). Depolarization-induced survival of CG neurons is partially BDNF-dependent. KCl depolarization provides significant trophic support to CG neurons in culture. In MEM hs (without eye extract), only 10-20% of neurons survive for 7 d compared with % in MEM hs containing 25 mm KCl (Scott and Fisher, 1970; Nishi and Berg, 1981; Pugh and Margiotta, 2000). Since elevated [KCl] greatly increased BDNF expression and release in CG cultures, we hypothesized a causal connection with depolarization-enhanced survival. This is a reasonable hypothesis because ongoing studies indicate that MEM hs containing BDNF, NT3 or NGF can support the survival of most CG neurons in culture (Pugh et al., 2005). Relevant to the present study, it was found that BDNF provides trophic support only when applied at sufficiently low concentration to minimize activation of low-affinity NT receptors (p75 NTR ) linked to cell death (Huang and Reichardt, 2001; Freidin, 2004) and present on CG neurons (Yamashita et al., 1999b) (Q Nai, XD Zhou, 121

127 and JF Margiotta, unpublished results) or at high concentration in the presence of a p75 NTR blocking antibody (Wescamp and Reichardt, 1991). Presumably BDNF was previously found unable to support CG neuronal survival because it was tested at 50 ng/ml (2 X 10-9 M) (Lindsay et al., 1985b), a sufficiently high concentration to activate p75 NTR (K d 10-9 M) (Rodriguez-Tebar and Barde, 1988). To directly test the hypothesis that BDNF contributes to depolarization-supported survival, we used a BDNF neutralizing antibody (anti-bdnf), which recognizes and binds to free BDNF and blocks the function of endogenous BDNF in culture (unpublished data from EMD Biosciences, Inc., San Diego, CA), and assessed its effects on levels of neuronal survival produced by 10 mm KCl, a concentration supporting submaximal survival (EC 50 = 8 mm, PC Pugh and JF Margiotta, unpublished) (Fig. 3). From D1 to D4 in culture, CG neurons grown in MEM hs containing 10 mm KCl maintained a relatively constant 70% level of neuronal survival that was significantly higher on D4 (72 ± 4%, n=4) than was achieved in the same cultures grown in MEM hs alone (20 ± 3%, p<0.001). When, in the same experiments, KCl and anti-bdnf were coapplied from D1-D4 in culture, however, long-term survival decreased, paralleling that seen in MEM hs and reaching 52 ± 2% (n=4) on D4, significantly lower than that for neurons grown in MEM hs containing 10 mm KCl (p<0.01), but greater than that achieved in MEM hs alone (p<0.001). The antibody treatments were considered specific because, in separate control experiments (data not shown), anti-bdnf significantly reduced survival support provided by 5 ng/ml exogenous BDNF (p<0.05) to levels that were indistinguishable from those seen in MEM hs (p>0.05, n=2) but had no detectable effect on survival supported by exogenous NGF. While 122

128 different culture conditions were used to induce BDNF release than in the survival assays, the BDNF level released by KCl-depolarization (Fig. 2) is about 0.5 ng/ml representing a concentration of 2 X M. Although local, relevant concentrations may be higher, this dose is sufficient for high-affinity BDNF binding to TrkB on chicken neurons (K d M) (Rodriguez-Tebar and Barde, 1988; Dechant et al., 1993b). These results therefore suggest that survival support provided by membrane depolarization is partially attributable to the stimulation of BDNF release from the CG cultures and subsequent activation of TrkB signaling. Depolarization induces survival via MAPK and CaMKII. Previous studies identify MAPK-dependent processes in sequential calcium signaling in the nervous system (Rosen et al., 1994). It is also known that NT activation of MAPK protects neurons from death in various systems (Becker et al., 1998; Bonni et al., 1999; Hetman et al., 1999) including CG neurons (Pugh et al., 2005). Since MAPK would be activated by either KCl-induced membrane depolarization (Rosen et al., 1994) or by the accompanying release of BDNF and TrkB activation (Pugh et al., 2005), we tested its contribution to KCl-induced CG neuron survival using the MAPK kinase (MEK1) inhibitor PD98059, which blocks MEK1-MAPK signaling (Fig. 4A). Coapplication of KCl (10 mm) and PD98059 (7 µm) in MEM hs resulted in 46 ± 4% (n=6) survival on D4, a significantly lower level than that for parallel cultures grown in MEM hs containing 10 mm KCl (75 ± 4, n=6, p<0.001), but higher than that attained in parallel cultures maintained in MEM hs alone (18 ± 1%, n=6, p<0.001). The lowered KCl-supported D4 survival seen with MEK1 inhibitor was 123

129 indistinguishable from that seen with anti-bdnf (Fig. 3) suggesting that any direct contribution of chronic depolarization to MAPK activation (Rosen et al., 1994) is negligible for CG neurons. Taken together, these results indicate that full KCl-supported survival of CG neurons requires activation of MAPK, and in accord with ongoing studies (Pugh et al., 2005) suggest that increased BDNF release supports survival by TrkB signaling mediated via MEK1 and MAPK effectors. The residual KCl-supported survival observed in anti-bdnf (Fig. 3) and MEK1 inhibitor (Fig. 4A) experiments suggest that a second pathway activated by membrane depolarization supports survival in parallel with BDNF/TrkB signaling. We speculated that CaMKII, an effector activated by VDCC-mediated Ca 2+ influx, might also influence the KCl-supported survival of CG neurons, as it does in other systems (Hanson and Schulman, 1992). CaMKII is coupled to changes in gene expression since blocking the enzyme abolishes activation of the transcription factor CREB in CG neurons following depolarization, thereby implicating interruption of CREB-mediated gene regulation (Chang and Berg, 2001) known to have significant effects on neuronal survival (Bito and Takemoto-Kimura, 2003). We therefore blocked CaMKII using KN93 (10 µm) to determine if this effector, like MAPK, is required to support KCl-induced long-term CG neuron survival (Fig. 4B). Inclusion of KN93 in MEM hs containing 10 mm KCl resulted in significantly reduced D4 neuronal survival (43 ± 2%) compared to that for cultures growin in MEM hs containing only 10 mm KCl (80 ± 3%, p<0.001, n=6 and 7, respectively), indicating CaMKII activity is required for full KCl-induced survival 124

130 support. Interestingly, inclusion of both KN93 and anti-bdnf in MEM hs containing 10 mm KCl, abolished the trophic effect of KCl depolarization, resulting in D4 survival levels (13 ± 2%, n=3, p<0.001) that were indistinguishable from that for neurons grown in MEM hs alone (20 ± 2%, n=7, p>0.05). A similar result was obtained by combining KN93 with MEK1 inhibitor (PD98059) to block both CaMKII and MAPK signaling; such treatment decreased D4 KCl-stimulated survival to 30 ± 2% (n=6), a level significantly less than that obtained for MEM hs containing KCl (p<0.001) or KCl plus KN93 (p<0.05), and approaching that seen for MEM hs. These findings indicate that full survival induced by KCl depolarization requires parallel recruitment of both NT-dependent (BDNF, TrkB, MAPK) and independent (CaMKII) signaling pathways. We recently found that KCl depolarization failed to augment CG neuronal survival supported by exogenous 5 ng/ml BDNF (Pugh et al., 2005) as would be expected for a simple additive convergence of CaMKII and TrkB/MAPK pathways. In that case, we note that 5 ng/ml BDNF (2 X M) is 13-fold higher than the K d for binding to TrkB on chicken neurons ( 1.5 X M) (Dechant et al., 1993b) and therefore probably maximal for TrkB binding and subsequent MAPK activation. Under such conditions, any augmentation of survival due to activity-dependent increases in CaMKII are expected to be offset by cell death brought about by accompanying upregulation of BDNF release activating low-affinity p75 NTR (K d 10-9 M). In the present case, however, levels of BDNF produced by depolarization are expected to be quite low (Fig. 2) such that the contributions from MAPK and CaMKII effectors (Figs. 3 and 4) are expected to be additive. Overall, these results support a model where parasympathetic CG neruon survival is influenced by levels of activity impacting 125

131 both CaMKII- and, via BDNF upregulation, MAPK-dependent survival pathways. The trophic effects of sustained activity and BDNF expression could have relevance late in development in vivo, when ganglionic synapses have acquired the ability to transmit reliably at high frequency (Landmesser and Pilar, 1972; Chang and Berg, 1999) and the effectiveness of other ganglionic growth factors (i.e. GNDF and CNTF; (Buj-Bello et al., 1995; Hashino et al., 2001) has diminished. 126

132 FIGURE LEGENDS Figure 1. BDNF expression is sustained during CG development. Levels of BDNF-like protein in CG were determined at the indicated embryonic ages. Results are expressed as picograms BDNF per milligram ganglion wet weight (gray bars, mean ± SD) based on duplicate ELISA measurements from ganglia for each day. The accompanying dashed line indicates the average number of neurons per CG at each day expressed as a percent of the 6300 determined at E8 (adapted from (Landmesser and Pilar, 1974b)). Figure 2. Chronic KCl depolarization increases levels of BDNF mrna and protein in CG neuron cultures. (A) Levels of BDNF relative to GAPDH mrna were assessed using real time RT-PCR for 3-4 d CG neuron cultures grown in normal MEM hs/eye (5 mm KCl, black bar), or in MEM hs/eye supplemented with either 20 mm KCl (25 mm KCl total, gray bar) or 20 µm nicotine (striped bar). Asterisks indicate significantly higher levels of BDNF mrna expression (p<0.05) in cultures maintained in 25 mm KCl (n = 3 cultures) or 20 µm nicotine (n = 4) compared to companion control cultures assayed in parallel. (B) Levels of BDNF-like protein (pg/ml) were determined by ELISA protein assay from 3-4 d CG culture extracts (Cells) and culture media (Media). Levels were compared for cultures grown in MEM hs/eye without supplements (black bars), and in MEM hs/eye containing 25 mm KCl (gray bars). Asterisks indicate significantly higher levels of BDNF-like protein (p<0.05) in cell extracts or released into the media when cultures (n=2 for both) were maintained in 25 mm KCl, as compared to controls. 127

133 Figure 3. BDNF contributes to KCl-supported survival of CG neurons in culture. (A) The mean percent neuronal survival in MEM hs with or without supplements is plotted for day 0 (D0) through D4, relative to the number of neurons present on D0. MEM hs was supplemented with 3% eye extract (Eye), 10 mm KCl (KCl), 10 mm KCl + 10 µg/ml anti-bdnf (KCl + αbdnf) or not supplemented (None), as indicated. Error bars represent S.E.M. (smaller than than the symbol size for KCl + anti-bdnf condition). Results depicted were obtained from 9-12 fields per well in 4 experiments. (B) Summary of the mean ± S.E.M. relative D4 neuronal survival replotted from A. Supplements to MEM hs are indicated as 3% eye extract (Eye, black bar), 10 mm KCl (KCl, gray bar), 10 mm KCl + anti-bdnf (KCl+αBDNF, hatched bar) and MEM hs alone (open bar). Asterisks to right of bars in this and subsequent figures indicate a significant difference in D4 survival for the indicated conditions compared to MEM hs alone. The cross indicates that D4 survival for MEM hs supplemented with KCl was significantly reduced by the inclusion of anti-bdnf. Figure 4. MAPK and CaMKII activation are required for full KCl-supported survival. CG cultures were maintained for 4 d and neuronal survival assayed each day as in Fig. 3. (A) Supplements to MEM hs were Eye, KCl, and None as in Fig. 3B, but also included 10 mm KCl + 7 µm PD98059 (KCl+PD, White striped bar) to block MEK1. The cross indicates that inclusion of PD98059 significantly reduces KCl supported survival. (B) Supplements to MEM hs were Eye, KCl, and None as in Fig. 3B, but also included 10 mm 128

134 KCl + 10 µm KN93 (KCl+KN, black striped bar), 10 mm KCl + 10 µm KN µg/ml anti-bdnf (KCl+KN+αBDNF, gray hatched bar), and 10 mm KCl + 10 µm KN µm PD98059 (KCl+KN+PD). Top dagger (=) indicates that inclusion of KN93 significantly reduces KCl supported survival (p<0.001). Note that combination of KN93 and anti-bdnf abolishes the trophic effect of KCl (p>0.05 relative to MEM hs alone). Lower daggers indicate that combining KN93 with PD98059 significantly reduces KCl supported survival (right, p<0.001) and does so further than combining KN93 with KCl (left, p<0.05). 129

135 ACKNOWLEDGEMENTS Support was provided by NIH R01-DA We thank Drs. Gail Adams for technical assistance, and Marthe Howard for helpful comments on the experiments. REFERENCES Airaksinen M, Saarma M (2002) The GDNF family: signalling, biological functions and therapeutic value. Nature Reviews Neuroscience 3: Balkowiec A, Katz D (2000) Activity-dependent release of endogenous brain-derived neurotrophic factor from primary sensory neurons detected by ELISA in situ. Journal of Neuroscience 20: Barbin G, Manthorpe M, Varon S (1984) Purification of the chick eye ciliary neuronotrophic factor. Journal of Neurochemistry 43: Becker E, Soler R, Yuste V, Gine E, Sanz-Rodriguez C, Egea J, Martin-Zanca D, Comella J (1998) Development of survival responsiveness to brain-derived neurotrophic factor, neurotrophin 3 and neurotrophin 4/5, but not to nerve growth factor, in cultured motoneurons from chick embryo spinal cord. Journal of Neuroscience 18:

136 Bito H, Takemoto-Kimura S (2003) Ca 2+ /CREB/CBP-dependent gene regulation: a shared mechanism critical in long-term synaptic plasticity and neuronal survival. Cell Calcium 34: Bonni A, Brunet A, West A, Datta S, Takasu M, Greenberg M (1999) Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and -independent mechanisms. Science 286: Borodinsky LN, Coso OA, Fiszman ML (2002) Contribution of Ca 2+ /calmodulin-dependent protein kinase II and mitogen-activated protein kinase kinase to neural activity-induced neurite outgrowth and survival of cerebellar granule cells. Journal of Neurochemistry 80: Buj-Bello A, Buchman V, Horton A, Rosenthal A, Davies A (1995) GDNF is an age-specific survival factor for sensory and autonomic neurons. Neuron 15: Castren E, Pitkanen M, Sirvio J, Parsadanian A, Lindholm D, Thoenen H, Riekkinen PJ (1993) The induction of LTP increases BDNF and NGF mrna but decreases NT-3 mrna in the dentate gyrus. Neuroreport 4: Catsicas M, Pequinot Y, Clarke PGH (1992) Rapid onset of neuronal death induced by blockade of either axoplasmic transport or action potentials in afferent fibers during brain development. Journal of Neuroscience 12:

137 Chang K, Berg D (1999) Nicotinic acetylcholine receptors containing a7 subunits are required for reliable synaptic transmission in situ. Journal of Neuroscience 19: Chang K, Berg D (2001) Voltage-gated channels block nicotinic regulation of CREB phosphorylation and gene expression in neurons. Neuron 32: Chen M, Pugh P, Margiotta J (2001) Nicotinic synapses formed between chick ciliary ganglion neurons in culture resemble those present on the neurons in vivo. Journal of Neurobiology 47: Dechant G, Biffo S, Okazawa H, Kolbeck R, Pottgiesser J, Barde YA (1993) Expression and binding characteristics of the BDNF receptor chick trkb. Development 119: Dudek H, Datta S, Franke T, Birnbaum M, Yao R, Cooper G, Segal R, Kaplan D, Greenberg M (1997) Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science 275: Eckenstein F, Esch F, Holbert T, Blacher R, Nishi R (1990) Purification and characterization of a trophic factor for embryonic peripheral neurons: comparison with fibroblast growth factors. Neuron 4:

138 Farnsworth C, Freshney N, Rosen L, Ghosh A, Greenberg ME, Feig L (1995) Calcium activation of Ras mediated by neuronal exchange factor Ras-GRF. Nature 376: Franklin JL, Sanz-Rodriguez C, Juhasz A, Deckwerth TL, Johnson EM, Jr. (1995) Chronic depolarization prevents programmed death of sympathetic neurons in vitro but does not support growth: requirement for Ca 2+ influx but not Trk activation. Journal of Neuroscience 15: Freidin M (2004) Antibody to the extracellular domain of the low affinity NGF receptor stimulates p75 NGFR -mediated apoptosis in cultured sympathetic neurons. Journal of Neuroscience Research 64: Furber S, Oppenheim RW, Prevette D (1987) Naturally-occurring neuron death in the ciliary ganglion of the chick embryo following removal of preganglionic input: evidence for the role of afferents in ganglion cell survival. Journal of Neuroscience 7: Galli-Resta L, Ensini M, Fusco E, Gravina A, Margheritti B (1993) Afferent spontaneous electrical activity promotes the survival of target cells in the developing retinotectal system of the rat. Journal of Neuroscience 13: Gallo V, Kingsbury A, Balazs R, Jorgensen O (1987) The role of depolarization in the survival and differentiation of cerebellar granule cells in culture. Journal of Neuroscience 7:

139 Ghosh A, Carnahan J, Greenberg M (1994) Requirement for BDNF in activity-dependent survival of cortical neurons. Science 263: Goodman L, Valverde J, Lim F, Geschwind M, Federoff H, Geller A, Hefti F (1996) Regulated release and polarized localization of brain-derived neurotrophic factor in hippocampal neurons. Molecular and Cellular Neuroscience 7: Hack N, Hidaka H, Wakefield MJ, Balazs R (1993) Promotion of granule cell survival by high K+ or excitatory amino acid treatment and Ca 2+ /calmodulin-dependent protein kinase activity. Neuroscience 57:9-20. Hallbook F, Backstrom A, Kullander K, Kylberg A, Williams R, Ebendal T (1995) Neurotrophins and their receptors in chicken neuronal development. Int J Dev Biol 39: Hansen MR, Zha X, Bok J, Green SH (2001) Multiple distinct signal pathways, including an autocrine neurotrophic mechanism, contribute to the survival-promoting effect of depolarization on spiral ganglion neurons in vitro. Journal of Neuroscience 21: Hanson PI, Schulman H (1992) Neuronal Ca/calmodulin-dependent protein kinases. Annual Review of Biochemistry 61:

140 Hashino E, Shero M, Junghans D, Rohrer H, Milbrandt J, Johnson EM, Jr. (2001) GDNF and neurturin are target-derived factors essential for cranial parasympathetic neuron development. Development 128: Heller s, Finn TP, Huber J, Nishi R, Geissen M, Puschel AW, Rohrer H (1995) Analysis of function and expression of the chick GPA receptor (GPARa) suggests multiple roles in neuronal development. Development 121: Hetman M, Kanning K, Cavanaugh J, Xia Z (1999) Neuroprotection by brain-derived neurotrophic factor is mediated by extracellular signal-regulated kinase and phosphatidylinositol 3-kinase. Journal of Biological Chemistry 274: Huang EJ, Reichardt LF (2001) Neurotrophins: Roles in neuronal development and function. Annual Review of Neuroscience 24: Ip N, Yancopoulos G (1996) The neurotrophins and CNTF: two families of collaborative neurotrophic factors. Annual Review of Neuroscience 19: Kingsbury T, Murray P, Bambrick L, BK K (2003) Ca 2+ -dependent regulation of TrkB expression in neurons. Journal of Biological Chemistry 278: Landmesser L, Pilar G (1972) The onset and development of transmission in the chick ciliary ganglion. Journal of Physiology 222: Landmesser L, Pilar G (1974a) Synaptic transmission and cell death during normal ganglionic development. Journal of Physiology 241:

141 Landmesser L, Pilar G (1974b) Synapse formation during embryogenesis on ganglion cells lacking a periphery. Journal of Physiology 241: Landmesser L, Pilar G (1978) Interactions between neurons and their targets during in vivo synaptogenesis. Federation Proceedings 37: Leung D, Parent A, Cachianes G, Esch F, Coulombe J, Nikolics K, Eckenstein F, Nishi R (1992) Cloning, expression during development, and evidence for release of a trophic factor for ciliary ganglion neurons. Neuron 8: Lindsay RM, Thoenen H, Barde YA (1985) Placode and neural crest-derived sensory neurons are responsive at early developmental stages to brain-derived neurotrophic factor. Developmental Biology 112: Lipton SA (1986) Blockade of electrical activity promotes the death of mammalian retinal ganglion cells in culture. PNAS 83: Meriney SD, Pilar G, Ogawa M, Nunez R (1987) Differential neuronal survival in the avian ciliary ganglion after chronic acetylcholine receptor blockade. Journal of Neuroscience 7: Meyer-Franke A, Wilkinson G, Kruttgen A, Hu M, Munro E, Jr HM, Reichardt L, Barres B (1998) Depolarization and camp elevation rapidly recruit TrkB to the plasma membrane of CNS neurons. Neuron 21:

142 Nishi R, Berg DK (1981) Two components from eye tissue that differentially stimulate the growth and development of ciliary ganglion neurons in cell culture. Journal of Neuroscience 1: Pugh P, Margiotta J (2000) Nicotinic acetylcholine receptor agonists promote survival and reduce apoptosis of chick ciliary ganglion neurons. Mol Cell Neurosci 15: Pugh P, Zhou X, Nai Q, Margiotta J (2005) PACAP- and neurotrophin-generated signals converge on MAPK to support parasympathetic neuronal survival. Submitted. Rodriguez-Tebar A, Barde Y (1988) Binding characteristics of brain-derived neurotrophic factor to its receptors on neurons from the chick embryo. Journal of Neuroscience 8: Rohrer H, Sommer I (1983) Simultaneous expression of neuronal and glial properties by chick ciliary ganglion cells during development. Journal of Neuroscience 3: Rosen LB, Ginty DD, Weber MJ, Greenberg ME (1994) Membrane depolarizing and calcium influx stimulate MEK and MAP kinase via activation of ras. Neuron 12: Scott BS, Fisher KC (1970) Potassium concentration and number of neurons in cultures of dissociated ganglia. Experimental Neurology 27:

143 Segal R (2003) Selectivity in neurotrophin signaling: theme and variations. Annual Review of Neuroscience 26: Segal R, Greenberg M (1996) Intracellular signaling pathways activated by neurotrophic factors. Annual Review of Neuroscience 19: Vaillant A, Mazzoni I, Tudan C, Boudreau M, Kaplan D, Miller F (1999) Depolarization and neurotrophins converge on the phosphatidylinositol 3-kinase-Akt pathway to synergistically regulate neuronal survival. Journal of Cell Biology 146: Wescamp G, Reichardt LF (1991) Evidence that biological activity of NGF is mediated through a novel subclass of high-affinity receptors. Neuron 6: Wright L (1981) Cell survival in chick embryo ciliary ganglion is reduced by chronic ganglionic blockade. Dev Brain Res 1: Yamashita T, Tucker K, Barde Y (1999) Neurotrophin binding to the p75 receptor modulates Rho activity and axonal growth. Neuron 24: Yao R, Cooper G (1995) Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science 267: Zafra F, Hengerer B, Leibrock J, Thoenen H, Lindholm D (1990) Activity dependent regulation of BDNF and NGF mrnas in the rat hippocampus is mediated by non-nmda glutamate receptor. EMBO Journal 9:

144 Zhou X, Nai Q, Chen M, Dittus J, Howard M, Margiotta J (2004) Brain-derived neurotrophic factor and trkb signaling in parasympathetic neurons: relevance to regulating alpha7-containing nicotinic receptors and synaptic function. Journal of Neuroscience 24:

145 Figure 1. Figure

146 Figure

147 Figure