Phylogeography of red muntjacs reveals three distinct mitochondrial lineages
|
|
- Judith Henry
- 6 years ago
- Views:
Transcription
1 1 Phylogeography of red muntjacs reveals three distinct mitochondrial lineages Renata F. Martins, Jörns Fickel, Minh Le, Thanh van Nguyen, Ha M. Nguyen, Robert Timmins, Han Ming Gan, Jeffrine J. Rovie-Ryan, Dorina Lenz, Daniel W. Förster, Andreas Wilting Additional file 1 Table S1. Comparison of number of accepted red muntjac species and subspecies among three different recent publications. Number of recognized species range from 1 to 6 and number of recognized subspecies range from none to 10. Mattioli (2011)[10] Grubb and Groves (2011)[13] Timmins et al. (2016)[7] Species M. muntjak M. muntjak M. muntjak M. vaginalis M. vaginalis M. malabaricus M. aureus M. nigripes M. guongdongensis * Subspecies M. m. muntjak M. v. vaginalis not applicable M. m. annamensis M. v. curvostylis M. m. aureus M. m. curvostylis M. m. malabaricus M. m. mengalis M. m. montanus M. m. nigripes M. m. vaginalis M. m. yunnanensis * Identified as Incertae sedis, but referring to the different form described by Li J-x &Xu, 1996
2 2 Table S2. Complete dataset used for analyses, with information on origin, location and contact. Collection ID Sample name Name in Figures Genbank Source material Geographic origin Geographic origin MMU1 BAL1 KY nasal bone West Bali West Bali MMU2 JAV13 KY nasal bone West Java Java MMU3 THA2 KY nasal bone Thailand Thailand MMU6 IND5 KY nasal bone and tissue from India India MMU8 IND2 KY nasal bone India India MMU10 CHI3 KY nasal bone Yunnan 4837 MMU12 IND10 KY nasal bone East India East India MMU16 BOR2 KY nasal bone MMU17 LOM2 KY bone from MMU18 SRI1 KY nasal bone MMU20 CHI1 KY nasal bone MMU21 LSI1 KY Southeast Lombok East Sri Lanka Yunnan Lesser Sunda Islands Lombok Sri Lanka Lesser Sunda Islands MMU22 BOR7 KY nasal bone ZMA ZMA MMU24 SUM6 KY nasal bone Sumatra Sumatra 1950 MMU25 SUM1 KY nasal bone Sumatra Sumatra MMU27 JAV17 KY nasal bone and tissue from Year Java Java MMU28 JAV15 KY nasal bone Java Java MMU29 JAV5 KY nasal bone East Java Java MMU30 BOR5 KY antler drill MMU31 BOR6 KY antler drill 1902 Contact
3 MMU32 BOR4 KY antler drill MMU34 THA6 KY nasal bone Thailand Thailand MMU35 JAV6 KY nasal bone West Java Java MMU36 JAV11 KY nasal bone West Java Java MMU38 SUM4 KY nasal bone Sumatra Sumatra MMU40 SUM2 KY nasal bone Sumatra Sumatra MMU41 JAV14 KY nasal bone West Java Java MMU42 JAV1 KY nasal bone West Java Java MMU43 JAV16 KY nasal bone West Java Java MMU44 JAV3 KY nasal bone West Java Java MMU46 JAV8 KY nasal bone West Java Java MMU48 SUM5 KY tissue Sumatra Sumatra 1886 B3399 MMU49 JAV7 KY skin Java Java 1919 B3400 MMU50 JAV2 KY skin Java Java B3402 MMU51 JAV4 KY skin Java Java 1497 MMU53 SUM3 KY bone drill Sumatra Sumatra MMU59 LOM1 KY tissue Lombok Lombok MMU60 LOM3 KY tissue Lombok Lombok MMU62 IND6 KY tissue India India M122 MMU64 JAV9 KY skeleton Java Java Dr. Rainer Hutterer, Zoologisches Forschungsmuseum Alexander Koenig Bonn Dr. Irina Ruf, Senckenberg Forschungsinstitut Mammalogie Frankfurt Dr. Irina Ruf, Senckenberg Forschungsinstitut Mammalogie Frankfurt Dr. Irina Ruf, Senckenberg Forschungsinstitut Mammalogie Frankfurt M123 MMU65 NEP1 KY nasal bone Nepal Nepal 1838
4 4 M505 MMU67 LSI2 KY nasal bone M537 MMU68 IND7 KY M1267 MMU72 THA4 KY M125 MMU74 THA1 KY nasal bone and tissue from Tissue in alcohol Belitung Island Belitung Island 1887 India India 1887 Thailand Thailand 1926 South Thailand Thailand MMU75 IND9 KY skin South India South India MMU81 IND3 KY skin India India MMU82 IND4 KY nasal bone India India MMU83 SRI2 KY nasal bone Sri Lanka Sri Lanka MMU86 THA5 KY nasal bone Thailand Thailand MMU87 IND8 KY nasal bone India India M M M M.4929 M.4916 M a M a 74035/ MMU90 JAV10 KY nasal bone West Java Java 1930 MMU91 THA3 KY MMU95 LSI3 KY Thailand Bangka Island Thailand 1989 Banka MMU100 JAV12 KY nasal bone Java Java MMU102 IND1 KY nasal bone India India MMU105 BOR3 KY MMU107 BOR1 KY C.2 CHI2 KY nasal bone Central Yunnan 1894 Douglas Yu, The Ecology, Conservation, and Environment Center RJT118 RJT118 LAO1 KY Laos Laos R. J. Timmins M2.3 M2.3 VIE3 KY M2.9 M2.9 VIE7 KY bone C. C. M2.14 M2.14 VIE2 KY bone Central Central
5 5 M3.8 M3.8 VIE11 KY bone E. M5.11 M5.11 VIE13 KY dry skin M6.5 M6.5 VIE8 KY bone M6.12 M6.12 VIE1 KY bone M6.17 M6.17 VIE4 KY bone x15 x15 VIE9 KY bone x17 x17 VIE12 KY bone x19 x19 VIE10 KY bone x20 x20 VIE6 KY bone x39 x39 VIE5 KY bone mm13 mm13 MAL1 KY mm20 mm20 MAL2 KY C. Central South C. C. C. C. C. Peninsular Peninsular Central South Peninsular Peninsular 2012 Monash University, Monash University, Table S3. Long-range PCR primer sequences and annealing temperatures used for bait development. Fragment 1 Fragment 2 Fragment 3 Position on ref. Sequence 5'-3' 2478 F: CGATTAAAGTCCTACGTGATCTGAG 6926 R: GTTATGATGTTGGCTTGAAACCAG 6506 F: GCTATYATRGGAGGATTTGTTCAC R: GATTAGGGCTGTTGTRGTAAATG F: TTACAAATCTTAACGCCTGAGACTTC 2548 R: TAGATAGAAACCGACCTGGATTACTC Annealing Temp. a 58 ⁰C 58 ⁰C 58 ⁰C a PCR was done with MyFi Mix (Bioline GmbH, Germany) with 1x MyFi Mix, 0.4 µm each primer and water to the final volume of 50 µl for each of the fragments separately, in a total of 35 amplification cycles.
6 6 Table S4. Sequencing results from all samples used in this study, with indication of sequencing platform, percentage of reads on target, average base coverage depth and percentage of reference genome covered with at least 3x coverage. Sample Sequencing Reads on Average read % genome Captured Name platform target depth covered 3x BAL1 yes PGM 53.65% JAV13 yes PGM 45.29% THA2 yes PGM 20.92% IND5 no Illumina 0.54% IND2 yes PGM 18.15% CHI3 no Illumina 0.06% IND10 yes PGM 46.65% BOR2 yes Illumina 2.21% LOM2 yes Illumina 36.22% SRI1 yes PGM 20.46% CHI1 yes PGM 4.30% LSI1 yes Illumina 45.26% BOR7 yes PGM 10.17% SUM6 yes PGM 36.05% SUM1 yes PGM 47.57% JAV17 yes PGM 71.62% JAV15 yes PGM 65.44% JAV5 yes PGM 55.88% BOR5 yes PGM 6.24% BOR6 yes PGM 31.17% BOR4 yes PGM 18.20% THA6 yes PGM 26.33% JAV6 yes PGM 6.35% JAV11 yes PGM 40.60% SUM4 yes PGM 44.44% SUM2 yes PGM 61.77% JAV14 yes PGM 30.97% JAV1 no Illumina 0.92% JAV16 yes PGM 30.47% JAV3 no Illumina 0.18% JAV8 yes Illumina 4.88% SUM5 no Illumina 0.05% JAV7 yes Illumina 3.88% JAV2 yes Illumina 9.26% JAV4 yes PGM 50.03% SUM3 yes PGM 24.66% LOM1 yes PGM 28.73% LOM3 yes PGM 33.09% IND6 yes PGM 50.73% JAV9 yes PGM 27.96% NEP1 yes PGM 59.64% LSI2 yes PGM 16.87% IND7 yes PGM 47.52% THA4 no Illumina 0.03% THA1 yes Illumina 14.59% IND9 yes PGM 33.76% IND3 yes Illumina 1.76% IND4 yes Illumina 8.41% SRI2 yes PGM 61.03% THA5 yes Illumina 29.52%
7 7 IND8 yes Illumina 64% JAV10 no Illumina 0.07% THA3 yes PGM 39.65% LSI3 yes Illumina 18.50% JAV12 yes Illumina 3.52% IND1 yes PGM 74.84% BOR3 yes Illumina 19.56% BOR1 yes Illumina 39.98% CHI2 no Illumina 0.19% LAO1 no Illumina 0.18% VIE3 no Illumina 0.04% VIE7 no Illumina 0.03% VIE2 no Illumina 0.07% VIE11 no Illumina 0.06% VIE13 no Illumina 0.08% VIE8 no Illumina 0.10% VIE1 no Illumina 0.03% VIE4 no Illumina 0.03% VIE9 no Illumina 0.12% VIE12 no Illumina 0.20% VIE10 no Illumina 0.07% VIE6 no Illumina 0.03% VIE5 no Illumina 0.06% MAL1 no Illumina 0.93% MAL2 no Illumina 0.58% Table S5: Number of Variable sites (V) and Parsimony informative sites (Pi) per coding gene, throughout the full mitogenomes obtained. ND1 ND2 Cox1 Cox2 Cox3 ND3 ND4L ND4 ND5 ND6 Cytb D-loop V Pi
8 8 SRI2 SRI1 * * BOR1 BOR2 BOR3 MAL1 MAL2 BOR7 SUM4 SUM5 SUM6 SUM3 LSI3 JAV17 JAV6 JAV5 JAV2 JAV4 JAV3 JAV1 BAL1 BOR5 BOR4 LOM3 LOM1 * LOM2 LSI1 BOR6 JAV15 JAV16 LSI2 JAV14 JAV13 * JAV12 JAV11 SUM2 JAV9 JAV10 SUM1 JAV7 JAV8 VIE1 VIE2 VIE12 THA1 VIE3 VIE4 THA6 THA4 THA5 THA3 CHI1 CHI2 CHI3 VIE13 THA2 VIE8 VIE7 VIE6 IND3 VIE5 IND4 IND5 IND2 IND6 IND7 IND8 IND10 NEP1 IND9 VIE9 VIE10 VIE11 LAO1 IND Figure S1. Best tree obtained with Maximum Likelihood analyses with RAxML. The same topology is recovered as with Bayesian inferences, with three distinct mitochondrial clades. All branches are supported with at least 90% bootstrap support, except when indicated otherwise with *.
9 9 IND1 LAO1 VIE1 VIE2 VIE12 THA1 THA6 THA3 THA4 THA5 VIE3 VIE4 THA2 CHI2 VIE13 CHI1 CHI3 VIE8 VIE6 VIE5 VIE11 VIE7 VIE9 VIE10 NEP1 IND10 IND9 IND2 IND6 IND4 IND3 IND5 IND8 IND7 BOR3 BOR1 JAV7 BOR2 SUM5 SUM4 MAL1 BOR7 MAL2 BOR6 LSI3 SUM3 SUM6 BOR5 BOR4 LOM1 LOM2 LOM3 LSI1 BAL1 JAV6 JAV1-5 Muntiacus reevesi JAV9 JAV10 JAV15 JAV16 SUM2 JAV13 JAV14 LSI2 JAV12 JAV11 JAV7 JAV8 SUM1 WG4 WG5 SRI2 SRI1 WG2 WG3 WG Figure S2. Best tree obtained with Maximum Likelihood analyses of the Cytochrome B gene of all red muntjac samples included in this study and five additional Genbank sequences from the Western Ghats. This tree was obtained with RAxML and shows similar topology as the trees with full mitogenome, although bootstrap values are generally lower. This result shows the relationship between Sri Lanka and Western Ghats populations, as they cluster together in the same clade.
Indonesia Situation Assessment on Amphetamine-Type Stimulants
Indonesia Situation Assessment on Amphetamine-Type Stimulants Tun Nay Soe Programme Coordinator, Global SMART Programme (East Asia) UNODC Regional Office for Southeast Asia and the Pacific 20 February
More informationHepatitis B prevention in Indonesia
Hepatitis B prevention in Indonesia Maisuri T. Chalid Hasanuddin University, Makassar Prevalence of HBsAg in Indonesia: 3-9.4% # # NAD 12.8% RIAU 2.4% JAMBI 8.3% BANGKA BELITUNG 4.4% E. KALIMANTAN 6.4%
More informationIndonesian Pediatric Society: Contributions to Immunizations in Indonesia
Indonesian Pediatric Society: Contributions to Immunizations in Indonesia Aman B.Pulungan Indonesian Pediatric Society Geneva, 23 May 2018 Indonesian Pediatric Society National Congress of Pediatric (KONIKA)
More informationPublications on Asian Elephants in Gajah and Other Scientific Journals
Gajah 35 (2011) 10-14 Publications on Asian Elephants in Gajah and Other Scientific Journals Jennifer Pastorini 1,2 * and Prithiviraj Fernando 1 1 Centre for Conservation and Research, Rajagiriya, Sri
More informationExploring the evolution of MRSA with Whole Genome Sequencing
Exploring the evolution of MRSA with Whole Genome Sequencing PhD student: Zheng WANG Supervisor: Professor Margaret IP Department of Microbiology, CUHK Joint Graduate Seminar Department of Microbiology,
More informationPrinciples of phylogenetic analysis
Principles of phylogenetic analysis Arne Holst-Jensen, NVI, Norway. Fusarium course, Ås, Norway, June 22 nd 2008 Distance based methods Compare C OTUs and characters X A + D = Pairwise: A and B; X characters
More informationEmerging Infectious Diseases Australia is not an Island
Emerging Infectious Diseases Australia is not an Island Bart Currie Global and Tropical Health Division Menzies School of Health Research, Darwin Infectious Diseases Department, Royal Darwin Hospital Borneo
More informationChikungunya virus infection in Indonesia: a systematic review and evolutionary analysis
Harapan et al. BMC Infectious Diseases (2019) 19:243 https://doi.org/10.1186/s12879-019-3857-y RESEARCH ARTICLE Chikungunya virus infection in Indonesia: a systematic review and evolutionary analysis Open
More informationMeasles and Rubella Fact Sheet SEAR #
and Fact Sheet SEAR 8-9 Table : South-East Asia Regional (SEAR) Strategic Plan 7- Goal: To reduce the number of measles deaths by 9 in relative to estimates. Objectives: Achieve at least 9 national Containing
More information6/10/2015. Background. Background. Background. Background. Methods
/1/1 The challenges of diversity: HIV-1 subtype distribution and transmission s within the Australian Molecular Epidemiology Network-HIV -1 Castley A, Sawleshwarkar S, Varma R, Herring B, Thapa K, Chibo
More informationGene duplication and loss Part II
Gene duplication and loss Part II Matthew Hahn Indiana University mwh@indiana.edu When genomes go bad When genomes go bad At least 113 genes entered the vertebrate (or pre-vertebrate) lineage by horizontal
More informationAPPENDIX 1 DATA COLLECTION AND DISSEMINATION STEPS
APPENDIX 1 DATA COLLECTION AND DISSEMINATION STEPS 97 Country/ area APPENDIX 2a DRUG REGIMENS SEA REGION, 2001 (dosage for adults) : P. falciparum Lab confirmed Treatment failure Severe malaria Pregnancy
More informationPhylogenomics. Antonis Rokas Department of Biological Sciences Vanderbilt University.
Phylogenomics Antonis Rokas Department of Biological Sciences Vanderbilt University http://as.vanderbilt.edu/rokaslab High-Throughput DNA Sequencing Technologies 454 / Roche 450 bp 1.5 Gbp / day Illumina
More informationNational Borders Effectively Halt the Spread of Rabies: The Current Rabies Epidemic in China Is Dislocated from Cases in Neighboring Countries
National Borders Effectively Halt the Spread of Rabies: The Current Rabies Epidemic in China Is Dislocated from Cases in Neighboring Countries Zhenyang Guo 1,2, Xiaoyan Tao 1, Cuiping Yin 1, Na Han 2,
More informationGenomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages
Article DOI: http://dx.doi.org/10.3201/eid2009.131095 Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages Technical Appendix Technical Appendix
More informationSTATUS OF EAR AND HEARING CARE IN SOUTH EAST ASIA REGION
STATUS OF EAR AND HEARING CARE IN SOUTH EAST ASIA REGION Dr. Suneela Garg Director Professor, Department of Community Medicine, Maulana Azad Medical College, New Delhi, India Director - Society for Sound
More informationSingle-Cell Sequencing in Cancer. Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018
Single-Cell Sequencing in Cancer Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018 Lecture will focus on technology for and applications of single-cell RNA-seq
More informationDengue Virus in Sub-tropical Northern and Central Viet Nam: Population Immunity and Climate Shape Patterns of Viral Invasion and Maintenance
Dengue Virus in Sub-tropical Northern and Central Viet Nam: Population Immunity and Climate Shape Patterns of Viral Invasion and Maintenance Maia A. Rabaa 1,2, Cameron P. Simmons 2,3, Annette Fox 3,4,
More informationREGIONAL REFERENCE LABORATORY FOR FMD IN SOUTH EAST ASIA DEPARTMENT OF LIVESTOCK DEVELOPMENT PAKCHONG, NAKHONRATCHASIMA, THAILAND
University of Tokyo, Tokyo, Japan, 9-11 June 2015 REGIONAL REFERENCE LABORATORY FOR FMD IN SOUTH EAST ASIA DEPARTMENT OF LIVESTOCK DEVELOPMENT PAKCHONG, NAKHONRATCHASIMA, THAILAND Activities of FMD Laboratory
More informationMolecular characterization of rabies virus of Nepal
Rabies Virus lineages Molecular characterization of rabies virus of Nepal Pant G R, Bhatta D R Rabies Vaccine laboratory, Tripureshwor, Kathmandu Email: pantganesh@hotmail.com Correspondence to : Dr.Ganesh
More informationPhylogenetic Methods
Phylogenetic Methods Multiple Sequence lignment Pairwise distance matrix lustering algorithms: NJ, UPM - guide trees Phylogenetic trees Nucleotide vs. amino acid sequences for phylogenies ) Nucleotides:
More informationCurrent situation and capacity in the South-East Asia Region
Current situation and capacity in the South-East Asia Region Theme: Diabetes / Obesity Chandrika N Wijeyaratne Sri Lanka Medical Association TWG on Regional Action Plan on NCD Bangkok June 2013 INDICATORS
More informationGinkgo Interactive analysis and quality assessment of single-cell CNV data
Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael
More informationArevir meeting Lize Cuypers
Arevir meeting 2017 Reconstructing the HCV migration history to support public health efforts Lize Cuypers KU Leuven University of Leuven, Department of Microbiology and Immunology, Rega Institute for
More informationTB in the SEA Region. Review Plans and Progress. Dr Md Khurshid Alam Hyder Medical Officer TB SEARO/WHO
TB in the SEA Region Review Plans and Progress Dr Md Khurshid Alam Hyder Medical Officer TB SEARO/WHO The SEA Region: 25% of the world s people, but >33% of TB patients Eastern M editerranean Region 5%
More informationFuture applications of full length virus genome sequencing
Future applications of full length virus genome sequencing Paul Kellam Virus Genomics Revisiting early HIV resistance ideas AIDS 1991 Nature 1993 Virus genome sequencing Population or single genome Whole
More informationInter-country mixing in HIV transmission clusters: A pan-european phylodynamic study
Inter-country mixing in HIV transmission clusters: A pan-european phylodynamic study Prabhav Kalaghatgi Max Planck Institute for Informatics March 20th 2013 HIV epidemic (2009) Prabhav Kalaghatgi 2/18
More informationSupplementary Information
Supplementary Information Methods Growth Characterisation Total Adenosine Triphosphate (ATP) was determined using a Molecular Probes ATP Determination Kit (Life Technologies, USA). 0.5 ml of sample was
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationSUPPLEMENTARY INFORMATION
Testing the accuracy of ancestral state reconstruction The accuracy of the ancestral state reconstruction with maximum likelihood methods can depend on the underlying model used in the reconstruction.
More informationOverview of ATS trends in East and Southeast Asia
Overview of ATS trends in East and Southeast Asia Presentation to Global SMART Programme Regional Workshop Shawn Kelley Research Analyst Global SMART Programme Phnom Penh, Cambodia 24 July 2012 Structure
More informationThe BLAST search on NCBI ( and GISAID
Supplemental materials and methods The BLAST search on NCBI (http:// www.ncbi.nlm.nih.gov) and GISAID (http://www.platform.gisaid.org) showed that hemagglutinin (HA) gene of North American H5N1, H5N2 and
More informationDownloaded from:
Ruis, C; Roy, S; Brown, JR; Allen, DJ; Goldstein, RA; Breuer, J (2017) The emerging GII.P16-GII.4 Sydney 2012 norovirus lineage is circulating worldwide, arose by late-2014 and contains polymerase changes
More informationDepartment of Forest Ecosystems and Society, Oregon State University
July 4, 2018 Prof. Christopher Still Department of Forest Ecosystems and Society, Oregon State University 321 Richardson Hall, Corvallis OR 97331-5752 Dear Prof. Christopher Still, We would like to thank
More informationMonthly Vaccine Preventable Disease and Immunization Update Published: March 10, 2015 Immunization and Vaccine Development (IVD) SEARO
Monthly Vaccine Preventable Disease and Immunization Update Published: March 10, 2015 Immunization and Vaccine Development (IVD) SEARO Protecting People from Vaccine Preventable Diseases Last wild poliovirus
More informationNew technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
More informationMethods for Species Tree Inference Lab Exercises
Methods for Species Tree Inference Lab Exercises Laura Kubatko Departments of Statistics and Evolution, Ecology, and Organismal Biology The Ohio State University kubatko.2@osu.edu July 31, 2012 Laura Kubatko
More informationHow many species of Paradoxurus civets are there? New insights from India and Sri Lanka
Accepted on 9 September 2014 J Zoolog Syst Evol Res doi: 10.1111/jzs.12085 1 UMR 7205 ISYEB, CNRS MNHN UPMC EPHE, Institut de Systematique, Evolution, Biodiversite, Museum National d Histoire Naturelle,
More informationINFLUENZA IN SWINE HERDS FOLLOWING THE INTRODUCTION OF PANDEMIC 2009 H1N1
INFLUENZA IN SWINE HERDS FOLLOWING THE INTRODUCTION OF PANDEMIC 2009 H1N1 Janice Reis Ciacci Zanella PAHO Webinar December 18, 2015 INFLUENZA IN SWINE IN BRAZIL Janice Reis Ciacci Zanella Brazilian Agricultural
More informationCurrent Status of Starch Factories of Sago Palm and Cassava in Yoshinori Yamamoto 1 and Pranamuda Hardaning 2
20 Information Current Status of Starch Factories of Sago Palm and Cassava in Yoshinori Yamamoto 1 and Pranamuda Hardaning 2 1 Faculty of Agriculture, Kochi University, Nankoku-shi, Kochi 783-8502, Japan
More informationAvian Influenza/Newcastle Disease Virus Subcommittee
Avian Influenza/Newcastle Disease Virus Subcommittee David L. Suarez D.V.M., Ph.D. Patti Miller D.V.M., Ph.D. Claudio Afonso Ph.D. Southeast Poultry Research Laboratory United States National Poultry Research
More informationChallenges Facing Preservation and Conservation of Asian Elephants
Challenges Facing Preservation and Conservation of Asian Elephants Introduction Arundathie Abeysinghe 1 Asian Elephants (Elephas maximus) are the continent s largest terrestrial mammals, although the Asian
More informationWHOLE GENOME SEQUENCING OF MYCOBACTERIUM LEPRAE FROM LEPROSY SKIN BIOPSIES and skeletons
WHOLE GENOME SEQUENCING OF MYCOBACTERIUM LEPRAE FROM LEPROSY SKIN BIOPSIES and skeletons Pushpendra Singh Laboratory of Prof. Stewart Cole Global Health Institute School of Life Sciences Ecole Polytechnique
More informationEvolutionary History and Population Genetic Structure of Asian Elephants in India
Indian Journal of History of Science, 51.2.2 (2016) 391-405 DOI: 10.16943/ijhs/2016/v51i2.2/48453 Evolutionary History and Population Genetic Structure of Asian Elephants in India T N C Vidya* (Received
More informationa) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
1 2 APPENDIX Legends to figures 3 4 5 Figure A1: Distribution of perfect SSR along chromosome 1 of V. cholerae (El-Tor N191). a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
More informationAI surveillance of domestic birds in Vietnam. Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control in Asia,
AI surveillance of domestic birds in Vietnam Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control in Asia, 2008-2012 Kenji Sakurai, OIE Asia-Pacific Tokyo, 13-14 December 2012 Contents
More informationProgress towards achieving Millennium Development Goal 5 in South-East Asia
DOI:.1111/j.1471-528.211.38.x www.bjog.org Commentary Progress towards achieving Millennium Development Goal 5 in South-East Asia M Islam Family Health and Research, World Health Organisation, South East
More informationExploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein
Microbes Count! 137 Video IV: Reading the Code of Life Human Immunodeficiency Virus (HIV), like other retroviruses, has a much higher mutation rate than is typically found in organisms that do not go through
More informationK&C Irrigated Rice Products:
K&C Irrigated Rice Products: Understanding the influence of rice paddies on atmospheric CH 4 Bill Salas Applied Geosolutions, LLC K&C Initiative, 8 th Science Advisory Panel Meeting, June 2007 Assessing
More informationOrigins and evolutionary genomics of the novel avian-origin H7N9 influenza A virus in China: Early findings
Origins and evolutionary genomics of the novel 2013 avian-origin H7N9 influenza A virus in : Early findings Jiankui He*, Luwen Ning, Yin Tong Department of Biology, South University of Science and Technology
More informationEXTREME SLOPE STABILISATION WITH VETIVER SYSTEM (Front Cover) Paul Truong TVNI Technical Director
EXTREME SLOPE STABILISATION WITH VETIVER SYSTEM (Front Cover) Paul Truong TVNI Technical Director EXTREME SLOPE STABILISATION WITH VETIVER SYSTEM Paul Truong TVNI Technical Director www.vetiver.org INTRODUCTION
More informationInternational Health Regulation update and progress in the region
International Health Regulation update and progress in the region 7 th Meeting of CAPSCA Asia Pacific 20-23 May 2014 Colombo, Sri Lanka Dr Bardan Jung Rana International Health Regulation WHO South-East
More informationEnhancing Sequence Coverage in Proteomics Studies by Using a Combination of Proteolytic Enzymes
Enhancing Sequence Coverage in Proteomics Studies by Using a Combination of Proteolytic Enzymes Dominic Baeumlisberger 2, Christopher Kurz 3, Tabiwang N. Arrey, Marion Rohmer 2, Carola Schiller 3, Thomas
More informationUNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA
UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA SITI SHUHADA MOKHTAR Thesis submitted in fulfillment of the requirements for the degree of Master of Science
More informationOverview OIE/JTF project on HPAI control in Asia and other related programs by the OIE Asia-Pacific
Overview OIE/JTF project on HPAI control in Asia and other related programs by the OIE Asia-Pacific The 5 th OIE Regional Expert Group Meeting for Implementation of the Programme on Surveillance of Wild
More informationYale University, New Haven, CT, USA
HEPATITIS C VIRUS INFECTION IS UBIQUITOUS AMONG DRUG INJECTORS IN ST. PETERSBURG, RF Robert Heimer 1, Elijah Paintsil 1, Sergei Verevochkin 2, Russell Barbour 1, Edward d White 1, Olga Toussova 2, Linda
More informationAntimalarial drug resistance
Antimalarial drug resistance Md Mushfiqur Rahman*, Leonard Ortega**, R M Rastogi* and Krongthong Thimasarn* Abstract Antimalarial drug resistance is of great concern in the WHO South-East Asia (SEA) Region.
More informationVoting system questions results
Voting system questions results 19 Nov 2015 11 th NATIONAL SEMINAR IN TRAVEL MEDICINE: 20 YEARS LATER MHQA 1 PROGRAM 1 Introduction 19 Nov 2015 3 Who is attending? 80% 1. Doctors 10% 6% 1% 0% 3% 2. Nurses
More informationViral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in
More informationAAHL s Regional One-Health Activities
International partnerships Disease reservoirs Unique capability AAHL s Regional One-Health Activities Dr. Kurt Zuelke Director, Health & Biosecurity and AAHL 30 October 2015 6 th Asia Pacific Workshop
More informationOrganism Project. Asian Elephant. Abby-Rose Mannes
Organism Project Asian Elephant Abby-Rose Mannes Asian Elephant Introduction I will be doing my Organism research project on the Asian Elephant, the Asian Elephants scientific name is Elephas Maximus.
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationUtilization of NCBI Pathogen Detection Tool in USDA FSIS
Utilization of NCBI Pathogen Detection Tool in USDA FSIS Glenn Tillman, Ph.D. Branch Chief Microbiology: Characterization Branch FSIS Office of Public Health and Science Glenn.tillman@fsis.usda.gov 1 Background
More informationReduction of child and maternal mortality in South-East Asia Region WHO-SEARO. UNESCAP Forum, New Delhi: 17 Feb 2012
Reduction of child and maternal mortality in South-East Asia Region WHO-SEARO 1 1 Progress in MDG 4 in SEAR Country Under 5 Mortality 2010 Target U5MR MDG 4 Status MDG4: Reduction of U5MR by two thirds
More informationOUT-TB Web. Ontario Universal Typing of Tuberculosis: Surveillance and Communication System
OUT-TB Web Ontario Universal Typing of Tuberculosis: Surveillance and Communication System Dr. Frances Jamieson, Ontario Public Health Laboratories November 30 th, 2009 Tuberculosis : A Global Problem
More informationMolecular Discrimination and Morphological Description of Apodemus sylvaticus and A. uralensis from Cefa Nature Reserve (Romania)
ACTA ZOOLOGICA BULGARICA Acta zool. bulg., 64 (3), 2012: 283-288 Molecular Discrimination and Morphological Description of Apodemus sylvaticus and A. uralensis from Cefa Nature Reserve (Romania) Philippe
More informationA new human immunodeficiency virus derived from gorillas
A new human immunodeficiency virus derived from gorillas Jean-Christophe Plantier, Marie Leoz, Jonathan E Dickerson, Fabienne De Oliveira, François Cordonnier, Véronique Lemée, Florence Damond, David L
More informationGenome Sequencing and Analysis of a Porcine Delta Coronavirus from Eastern China
ResearchArticle imedpub Journals http://www.imedpub.com/ DOI: 10.21767/2248-9215.100025 European Journal of Experimental Biology Genome Sequencing and Analysis of a Porcine Delta Coronavirus from Eastern
More informationA Global Overview of the Chikungunya Virus Problem
A Global Overview of the Chikungunya Virus Problem Ann M. Powers, Ph.D. Division of Vector-Borne Infectious Diseases Centers for Disease Control and Prevention Chikungunya Virus Family Togaviridae,, genus
More informationPanama disease on Gros Michel ( )
Panama disease on Gros Michel (1898-1962) Ulua Valley, Honduras, 1994 Not a single Cavendish plant has died in Central America as a result of Fusarium wilt caused by Foc race 1 Panama disease on Cavendish
More informationImmunization and Vaccine Development (IVD) SEARO
Monthly Vaccine Preventable Disease and Immunization Update Published: January 03, 2018 Immunization and Vaccine Development (IVD) SEARO Protecting People from Vaccine Preventable Diseases Last wild poliovirus
More informationEpidemiologia dell HPV e cancro della cervice nel mondo. Silvia Franceschi
Epidemiologia dell HPV e cancro della cervice nel mondo Silvia Franceschi Infezione da HPV: dalla diagnosi precoce alla prevenzione primaria. Roma, 27 Giugno 2012 Cancer incidence 2008 attributable to
More informationPlant roots have Positive Geotropism: roots always grow down Plant shoots have Negative Geotropism: shoots always grow up
GEOTROPISM IN VETIVER Paul Truong TVNI Technical Director Geotropism (also known as Gravitropism) is a growth movement by plants in response to gravity. Charles Darwin was one of the first to scientifically
More informationHIV / AIDS & HUMAN RIGHTS
SIXTH ANNUAL MEETING Asia Pacific Forum of National Human Rights Institutions "A Partnership For Human Rights In Our Region" HIV / AIDS & HUMAN RIGHTS 24 th 27 th September 2001 Colombo, Sri Lanka 1 BACKGROUND
More informationGenome Sequencing and Phylogenetic Analysis of 39 Human Parainfluenza Virus Type 1 Strains Isolated from
Genome Sequencing and Phylogenetic Analysis of 39 Human Parainfluenza Virus Type 1 Strains Isolated from 1997 2010 Eric T. Beck 1,2.,JieHe 1,2., Martha I. Nelson 3, Michael E. Bose 1,2, Jiang Fan 1,2,
More informationUvA-DARE (Digital Academic Repository)
UvA-DARE (Digital Academic Repository) Superinfection with drug-resistant HIV is rare and does not contribute substantially to therapy failure in a large European cohort Bartha, I.; Assel, M.; Sloot, P.M.A.;
More informationSexual Dysfunction and Infertility
Urology Journal UNRC/IUA Vol. 3, No. 2, 87-91 Spring 2006 Printed in IRAN Sexual Dysfunction and Infertility Prevalence of infertility in Tabriz in 2004 Yadollah Ahmadi Asr Badr,* Kazem Madaen, Sakineh
More informationDisparities in access: renewed focus on the underserved. Rick Johnston, WHO UNC Water and Health, Chapel Hill 13 October, 2014
Disparities in access: renewed focus on the underserved Rick Johnston, WHO UNC Water and Health, Chapel Hill 13 October, 2014 Sector proposal for post-2015 targets By 2030: to eliminate open defecation;
More informationBenchmark datasets for phylogenomic pipeline validation
Benchmark datasets for phylogenomic pipeline validation GenomeTrakr Meeting Sept. 2018 Ruth E. Timme, PhD Research Microbiologist GenomeTrakr data coordinator Validation for phylogenomics Phylogenomic
More informationMonthly Vaccine Preventable Disease and Immunization Update Published: May 11, 2018 Immunization and Vaccine Development (IVD) SEARO
Monthly Vaccine Preventable Disease and Immunization Update Published: May 11, 2018 Immunization and Vaccine Development (IVD) SEARO Protecting People from Vaccine Preventable Diseases Last wild poliovirus
More informationSupplementary Online Content
Supplementary Online Content Melo AS, Aguiar RS, Amorim MMR, et al. Congenital Zika virus infection: beyond neonatal microcephaly. JAMA Neurol. Published online October 3, 2016. doi:10.1001/jamaneurol.2016.3720.
More informationSeasonality in the migration and establishment of H3N2 Influenza lineages with epidemic growth and decline
Zinder et al. BMC Evolutionary Biology (2014) 14:3 DOI 10.1186/s12862-014-0272-2 RESEARCH ARTICLE Open Access Seasonality in the migration and establishment of H3N2 Influenza lineages with epidemic growth
More informationNJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Supplementary Materials
NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Supplementary Materials Erin K. Molloy 1[ 1 5553 3312] and Tandy Warnow 1[ 1 7717 3514] Department
More informationRajesh Kannangai Phone: ; Fax: ; *Corresponding author
Amino acid sequence divergence of Tat protein (exon1) of subtype B and C HIV-1 strains: Does it have implications for vaccine development? Abraham Joseph Kandathil 1, Rajesh Kannangai 1, *, Oriapadickal
More informationHEV Assay Development Update
HEV Assay Development Update Jeffrey M. Linnen, Ph.D. Senior Director, Research & Development Hologic Gen-Probe, San Diego, California USA IPFA/PEI 20th International Workshop on Surveillance and Screening
More information(ii) The effective population size may be lower than expected due to variability between individuals in infectiousness.
Supplementary methods Details of timepoints Caió sequences were derived from: HIV-2 gag (n = 86) 16 sequences from 1996, 10 from 2003, 45 from 2006, 13 from 2007 and two from 2008. HIV-2 env (n = 70) 21
More informationCritical to studying caribou antler accumulations is the capacity to confidently identify
Electronic Supplementary Material ESM Text 1.0: Differentiating female and male caribou antlers. Critical to studying caribou antler accumulations is the capacity to confidently identify their gender (thus,
More informationPolio endgame strategy The challenges for Asia Pacific Region
Polio endgame strategy The challenges for Asia Pacific Region Vaccinology 2013 1 st International Symposium for Asia Pacific Experts Bangkok, Thailand November 11-14 th, 2013 May Book-Montellano, MD >
More informationUSDA Influenza A Virus Surveillance Program in Swine
USDA Influenza A Virus Surveillance Program in Swine Presented to: OFFLU SWINE INFLUENZA GROUP ROME APRIL 16, 2013 Sabrina Swenson DVM, PhD USDA-APHIS-VS-NVSL Diagnostic Virology Laboratory & John Korslund
More informationIntegrative Biology 200A PRINCIPLES OF PHYLOGENETICS Spring 2012
Integrative Biology 200A PRINCIPLES OF PHYLOGENETICS Spring 2012 University of California, Berkeley Kipling Will- 1 March Data/Hypothesis Exploration and Support Measures I. Overview. -- Many would agree
More informationA probabilistic method for food web modeling
A probabilistic method for food web modeling Bayesian Networks methodology, challenges, and possibilities Anna Åkesson, Linköping University, Sweden 2 nd international symposium on Ecological Networks,
More informationSTABILISATION AND REHABILITATION OF STEEP SLOPES USING VETIVER SYSTEM TECHNOLOGY
STABILISATION AND REHABILITATION OF STEEP SLOPES USING VETIVER SYSTEM TECHNOLOGY Paul Truong TVNI Technical Director, Brisbane, Australia All materials in this document remain the property of TVNI. Permission
More informationOriginal language: English AC30 Inf. 8 CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA
Original language: English AC30 Inf. 8 CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA Thirtieth meeting of the Animals Committee Geneva (Switzerland), 16-21 July 2018 BLACK
More informationHIV 1 diversity in infected individuals in Suzhou and Suqian, China
DOI 10.1186/s40064-016-2378-z RESEARCH Open Access HIV 1 diversity in infected individuals in Suzhou and Suqian, China Chenhao Qin 1, Ping Zhang 1, Weiguang Zhu 2, Fangyuan Hao 3, Aiping Gu 1, Ping Fen
More informationOFFLU AVIAN INFLUENZA REPORT
OFFLU AVIAN INFLUENZA REPORT Avian Influenza Events in Animals for the period February to September 2017 Scope In this document we present a summary of H5, H7, and H9 avian influenza events that occurred
More informationAdenovirus Type 21 Outbreak among Lung Transplant Patients. at a Large Tertiary Care Hospital. and Gregory C. Gray 1,2,3,6
Adenovirus Type 21 Outbreak among Lung Transplant Patients at a Large Tertiary Care Hospital Sarah E. Philo 1,2, Benjamin D. Anderson 1,2,3, Sylvia F. Costa 1, Nancy Henshaw 4, Sarah S. Lewis 1, John M.
More informationCHAPTER 16 AVAILABILITY OF FAMILY PLANNING AND HEALTH SERVICES
CHAPTER 16 AVAILABILITY OF FAMILY PLANNING AND HEALTH SERVICES Using the Health and Family Planning Service Availability Questionnaire (SDKI 94-KKB), the 1994 Indonesia Demographic and Health Survey (IDHS)
More informationMolecular Diagnostics Market Share, Size, Analysis, Growth, Trends and Forecasts, 2016 to 2024 Hexa Research
Molecular Diagnostics Market Share, Size, Analysis, Growth, Trends and Forecasts, 2016 to 2024 Hexa Research " Projected to grow at a CAGR of almost 9% from 2016 to 2024, the molecular diagnostics market
More informationManuscript Title: Highly divergent dengue virus type 1 genotype sets a new distance
Supplementary Information Manuscript Title: Highly divergent dengue virus type 1 genotype sets a new distance record Author List: Alyssa T. Pyke 1*, Peter R. Moore 1, Carmel T. Taylor 1, Sonja Hall-Mendelin
More information