Molecular Diagnostics in the Workup of Lymphomas for the General Pathologist. Outline. Role of Molecular Testing in Lymphoma Diagnosis

Transcription

1 Molecular Diagnostics in the Workup of Lymphomas for the General Pathologist L. Jeffrey Medeiros, M.D. M.D. Anderson Cancer Center Outline Gene rearrangement studies / Clonality Translocations / mutations Molecular tests in specific lymphoma types Mantle cell lymphoma Follicular lymphoma Anaplastic large cell lymphoma Chronic lymphocytic leukemia/sll Diffuse large B-cell lymphoma What we can do to prepare for molecular testing in the near future Role of Molecular Testing in Lymphoma Diagnosis Biopsy Morphologic assessment Immunophenotype Benign vs. Malignant Classification Molecular Testing Prognosis Specific targets Pathways Therapy 1

2 B and T Lymphocytes Express Antigen Receptors B-cells IgH 100% Ig kappa 70% Ig lambda 30% T-cells TCR / 95% TCR / 5% Antigen Receptors (Proteins) Immunoglobulin T-cell receptor Anatomy of Ig Genes IGH IGK IGL 2

3 Anatomy of TCR Genes TCRB TCRA, TCRD TCRG Immunoglobulin Heavy Chain Gene Rearrangement Germline V 1 V 2 V n D 1-5 J 1-6 C D-J Joining V 1 V 2 V n D 3 J 3-6 C V-DJ Joining V 1 D 3 J 3-6 C mrna VDJC Occurs in bone marrow VDJ Rearrangement Generates Diversity > 5 x 10 6 different antibodies 3

4 Ig Variable Region is the Result of Gene Rearrangement FR, framework region; CDR, complimentary-determining region Walsh and Rosenquist, Medical Oncology 22:327, 2005 General Principles NHLs are monoclonal Lymphoid cells rearrange their antigen receptor genes Rearrangements occur prior to neoplastic transformation Rearrangements play no role in neoplastic transformation Clonality does not equal malignancy Methods for Detecting Ig and T-cell Gene Rearrangements Southern Blot Detects almost all gene rearrangements Requires ~ 30 ug high mol. wt. DNA Laborious and long turnaround time Edwin Southern 4

5 Methods for Detecting Ig and T-cell Gene Rearrangements Southern Blot Detects almost all gene rearrangements Requires ~ 30 ug high mol. wt. DNA Laborious and long turnaround time PCR Requires approximately 2 ug of DNA Can perform on paraffin tissue Easy and short turnaround time Almost every lab does PCR very few do Southern blot PCR to Detect Gene Rearrangements Why it Works V V V D D D J J J VDJ Rearrangement Primers Polymerase Chain Reaction General Principle Denature DNA sample to separate DNA strands (94ºC, 5 min) Primers bind to DNA strands (30-65º C, 30 sec Denature to separate DNA strands (94ºC, 30 sec) Polymerase synthesizes new DNA strands (65-75ºC, 2-5 min) 5

6 PCR Amplification is Exponential , ,388, ,435, ,073,741,824 Results in high sensitivity Traditional Gel-Based Detection of Gene Rearrangements Gel stained with ethidium bromide Capillary Gel Electrophoresis for Gene Rearrangements 1-5% sensitivity FRI FRII FRIII 6

7 Antigen Receptor Gene Rearrangements False Negative Results by PCR Ig genes Somatic mutations in V genes Use of consensus V and J primers TCR genes No somatic mutations Use of consensus V and J primers TCR beta Mutations prevent primers from annealing to DNA Antigen Receptor Gene Rearrangements False Negative Results by PCR IgH CLL/SLL <5% Mantle cell lymphoma <5% Follicular lymphoma 30-40% Marginal zone lymphoma 30-40% DLBCL 30-40% TCR genes All T-cell lymphoma ~10% The results are worse in paraffin embedded tissue Antigen Receptor Gene Rearrangements False Positive Results by PCR Monoclonal gene rearrangements can be detected in benign lesions Examples Autoimmune lymphoproliferations Immunodeficiency Helicobacter pylori gastritis Lymphoid lesions of skin May be true (but small) rearrangements that are not clinically significant 7

8 Outline Gene rearrangement studies / Clonality Translocations / mutations Molecular tests in specific lymphoma types Mantle cell lymphoma Follicular lymphoma Anaplastic large cell lymphoma Chronic lymphocytic leukemia/sll Diffuse large B-cell lymphoma What we can do to prepare for molecular testing in the near future General Mechanisms of Lymphomagenesis Activation of proto-oncogenes Chromosomal translocation Gene amplification Gene mutations Inactivation of tumor suppressor genes Gene mutations Infection by oncogenic viruses HTLV-1, EBV, HHV-8 Two Types of Chromosomal Translocations Juxtaposition of intact proto-oncogene with regulatory sequences of the partner chromosome Usually one of the antigen receptor loci. Upregulation of qualitatively normal protein Disruption and recombination of two distinct genes Generates a novel fusion gene Expression of qualitatively abnormal protein 8

9 Common Chromosomal Translocations B-cell NHL Translocation NHL type Genes t(14;18)(q32;q21) Follicular IgH and BCL2 t(8;14)(q24;q32) Burkitt MYC and IgH t(11;14)(q13;q32) Mantle cell CCND1 and IgH t(3;var)(q27;var) DLBCL BCL6 and partners t(11;18)(q21;q21) MALT API2 and MALT1 T-cell NHL Translocation NHL type Genes t(2;5)(p23;q35) ALCL ALK and NPM1 inv (14)(q11q32) T-PLL TCL-1 and TCR / Techniques Commonly Used to Detect Chromosomal Translocations Conventional cytogenetics t(8;14)(q24;q32) Need viable cells Cells die in transit Long TAT Techniques Commonly Used to Detect Chromosomal Translocations PCR IgH VVV DDD JJJJ C Must know sequence 1 partner BCL2 Need clusters OK in paraffin Most sensitive Ex1 Ex2 Ex 3 MBR t(14;18) JJ C Ex 1 Ex 2 Ex 3 Primers 9

10 Techniques Commonly Used to Detect Chromosomal Translocations In situ hybridization OK in paraffin Large probes Not great sensitivity Outline Gene rearrangement studies / Clonality Translocations / mutations Molecular tests in specific lymphoma types Mantle cell lymphoma Follicular lymphoma Anaplastic large cell lymphoma Chronic lymphocytic leukemia/sll Diffuse large B-cell lymphoma What we can do to prepare for molecular testing in the near future Mantle Cell Lymphoma Definition A B-cell neoplasm generally composed of monomorphic small to medium-sized lymphoid cells with irregular nuclear contours and a CCND1 translocation WHO book, p

11 11q13 in Mantle Cell Lymphoma Breakpoint Detection Telomere ccnd-1 90kb 20kb Centromere Detection Rate % % % % mtc2 mtc1 MTC PCR SB FISH CG Mantle Cell Lymphoma Cyclin D1 is a surrogate for the t(11;14) Not specific for MCL Other tumors that can be cyclin D1 + Hairy cell leukemia Myeloma CLL/SLL +/- (PCs) DLBCL (~5%) Ki-67 Index Predicts Survival in High-stage MCL patients CHOP R-CHOP Determann, O. et al. Blood 111:2385,

12 Follicular Lymphoma Definition A neoplasm composed of follicle center B-cells (typically both centrocytes and centroblasts) which usually has at least a partially follicular pattern Lymphomas composed of centrocytes and centroblasts with an entirely diffuse pattern in the sampled tissue may be included in the category. Essentially the definition is cytology + immunophenotype WHO book p. 220 t(14;18) is not included Follicular Lymphoma t(14;18)(q32;q21) BCL-2 IgH Frequency Chromosome 18q21 Inhibits apoptosis Chromosome 14q % of follicular lymphomas BCL2 is translocated to chromosome 14 and comes under influence of IgH enhancer - leads to overexpression of BCL2 BCL2 at CHROMOSOME 18q21 Detection of t(14;18) exon II exon III Detection Rate % % % % mbr mcr PCR SB FISH CG 12

13 ALK+ Anaplastic Large Cell Lymphoma Definition A T-cell tumor composed of lymphoid cells that are usually large with abundant cytoplasm and pleomorphic often horseshoe-shaped nuclei, with translocations involving ALK and ALK protein expression WHO book, p. 312 ALK+ Anaplastic Large Cell Lymphoma NPM-ALK 80% of ALK+ ALCL Falini, Br J Haematol 2001 ALK Fusion Proteins in ALCL Translocation Partner t(2;5)(p23;q35) Nucleophosmin 1 t(1;2)(p25;p23) Tropomyosin 3 t(2;3)(p23;q21) TRK-fused gene inv(2)(p23q35) ATIC t(2;17)(p23;q23) Clathrin heavy chain t(2;x)(p23;q11-12) Moesin t(2;17)(p23;q25) ALO17 t(2;22)(p23;q11.2) MYH9 t(2;19)(p23;q13.1) Tropomyosin 4 13

14 ALK Fusion Proteins Common Characteristics of Partners Partner is widely expressed Subcellular distribution of ALK is determined by partner Most have oligomerization domains Activate downstream signaling pathways neoplastic transformation Common Methods for Detecting NPM-ALK Classical cytogenetics FISH breakapart probe RT-PCR Long-range PCR ALK immunostaining Patterns of ALK Staining in ALCL Nuclear and cytoplasmic Membranous Cytoplasmic 14

15 Chronic Lymphocytic Leukemia/SLL Peripheral Blood Lymph node Chronic Lymphocytic Leukemia Prognosis 1/3 patients Indolent disease with no impact on survival 1/3 patients Initially indolent disease that progresses 1/3 patients Aggressive disease Chronic Lymphocytic Leukemia Prognostic Markers Clinical markers Clinical stage (Rai or Binet) Histologic markers Pattern and extent of BM involvement Serum markers 2-microglobulin, lactate dehydrogenase Molecular markers Conventional cytogenetic and FISH abnormalities, Ig somatic mutation 15

16 Cytogenetic Findings in CLL/SLL Fluorescence in situ hybridization ~80% of cases abnormal Del (13q14) Trisomy 12 Del (11q22-23) Del (17p13) Del (6q21) good bad bad bad bad Conventional cytogenetics ~20% of cases abnormal bad Somatic Mutation of IgV Genes Normal - generates antibody diversity in response to antigen Occurs in centroblasts in the germinal center Introduces point mutations into VH and VL, which form the antigen binding site Results in higher affinity antigenbinding IgH Somatic Mutations Impacts Prognosis of CLL Patients Damle R, et al. Blood 1999;94:

17 ZAP70 is a Surrogate of Ig Somatic Mutation N Engl J Med 2003;348: Diffuse Large B-cell Lymphoma Definition DLBCL is a neoplasm of large B lymphoid cells with nuclear size equal to or exceeding normal macrophage nuclei that has a diffuse growth pattern Centroblastic Immunoblastic 2008 WHO book, p. 233 Diffuse Large B-cell Lymphoma Prognosis is Difficult to Predict Groupe d etude des lymphomes de l adulte (GELA) (n=399) 17

18 DLBCL is Highly Heterogeneous De novo Nodal or extranodal Transformation from CLL/SLL, FL, MZL, NLPHL Spectrum of immunophenotypic features GC vs ABC Viral causes EBV, HHV8 Diffuse Large B-cell Lymphoma Gene Expression Profiling 3 types of DLBCL Germinal center-like Activated B lymphocyte-like Poorly defined / PMBCL Basically GC vs. Non GC Nature 403: 503, 2000 Germinal Center Reaction Sem Diagn Pathol 28: 167,

19 Diffuse Large B-cell Lymphoma Gene Expression Shows 2 Types that Correlate with Prognosis CHOP Therapy Nature 403: 503, 2000 Diffuse Large B-cell Lymphoma GEP Data is Valid for R-CHOP Treated Patients N Engl J Med 359: 2317, 2008 Can Immunohistochemistry be used as a Surrogate for GEP in DLBCL? CD GCB MUM1 + - Non-GCB BCL6 Results match gene expression profile in 76% of cases + - Chris Hans, MD GCB Non-GCB Blood 106: 275,

20 Choi IHC The Algorithm new algorithm and the Hans' as algorithm. a Surrogate for GEP in DLBCL? 5 antibodies GCET 1 CD10 BCL6 MUM1 FOXP1 93% concordance with GEP Clin Cancer Res15:5494, 2009 MYC Outcomes is of patients Prognostic with MYC+ DLBCL treated in with DLBCL R-CHOP. R-CHOP Therapy t(8;14)(q24;q32) - IgH (80%) t(8;22)(q24;q11) - Ig (15%) t(2;8)(p11;q24) - Ig (5%) Diagnostic tests Conventional cytogenetics Need viable cells FISH Use breakapart probe Blood 114: , 2009 Double Hit B-cell Lymphoma Definition Lymphomas with recurrent chromosomal breakpoints activating multiple oncogenes - one of which is MYC MYC + BCL-2 MYC + BCL-6 MYC + BCL-2 + BCL-6 (triple hit) MYC + BCL-3 MYC + CCND1 Blood 117: 2319,

21 MYC/BCL2 Double Hit Lymphoma Starry sky pattern High mitotic rate High apoptotic rate GCB immunophenotype FISH/CC evidence of breaks BCL2 Ki-67 MYC BCL2 J Clin Oncol 30: 3452, 2012 CD30 in Diffuse Large B-cell Lymphoma Ken Young, MD, PhD CD % of DLBCL are CD30+ Blood 2013 [Epub] 21

22 General Mechanisms of Lymphomagenesis Activation of proto-oncogenes Chromosomal translocation Gene amplification Gene mutations Inactivation of tumor suppressor genes Gene mutations Infection by oncogenic viruses HTLV-1, EBV, HHV-8 Sanger Sequencing Traditional (dideoxy) Method Fred Sanger Walter Gilbert 1 gene or 1 exon at a time Need relatively large quantity of DNA Labor intensive Sequencing on Illumina MiSeq: Overview and Update HiSeq MiSeq Flowcell (8 Lanes) Flowcell (Single Lane) Multiple/all genes simultaneously Need only amount of DNA Bioinformatics is difficult 22

23 UEP Mapping and comparison of multiple reads to a reference genome Individual reads mapped to reference genome Reference ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGA CGGTGAACGTTATCGACGATCCGATCGAACTGTCAGC GGTGAACGTTATCGACGTTCCGATCGAACTGTCAGCG TGAACGTTATCGACGATCCGATCGAACTGTCAGCGGC TGAACGTTATCGACGTTCCGATCGAACTGTCAGCGGC TGAACGTTATCGACGATCCGATCGAACTGTCAGCGGC GTTATCGACGTTCCGATCGAACTGTCAGCGGCAAGCT TTATCGACGATCCGATCGAACTGTCAGCGGCAAGCT ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGAACTGTCAGCGGCAAGCTGATCGATCGATCGATGCTAGTG In clinical tumor samples, DNA is derived from a mixture of neoplastic and non-neoplastic cells Challenges of Next Gen Sequencing Low tumor percentage and high error rate KRAS12-2 C A G T Patient Sample 40% Tumor Nat Genet 43: 830, 2011 Nature 476: 298,

24 Whole exome sequencing of 6 cases of DLBCL Copy number analysis using SNP arrays DLBCL carry ~ 30 gene mutations New abnormalities identified in: Chromatin methylation (MLL) Immune surveillance Nature Genetics 43: 830, 2011 Gene Mutations in DLBCL Potential Impairment of Many Cellular Processes Transcriptional regulation Lymphocyte activation Lymphocyte differentiation Histone methylation Histone acetylation Immune surveillance B-cell receptor signaling (p53) (STAT6, BCL10) (NF-kB, PRDM1) (EZH2, MLL2) (CREBBP, MEF2B) (B2M, CD58) (CD79B, CD79A) Nat Genet 43: 830, 2011 Nature 476: 298, 2011 Genetic Profile of GC and ABC DLBCL GC ABC 5-year OS 59% 30% Cytogenetics Gene mutations Mechanisms t(14;18)/igh-bcl2 MYC translocations MLL2, EZH2 CREBBP/EP300 MEF2B, BCL6 PTEN, PIK3CA BCL-2/apoptosis Chromatin modulation PI3K/AKT activation t(3q27)/bcl6 Trisomy 3, del(6q) A20/TNFAIP3 CARD11, MYD88 CD79B, CD79A PRDM1/BLIMP1 NF- B activation B-cell receptor signaling Nature Genetics 43: 830,

25 Outline Gene rearrangement studies / Clonality Translocations / mutations Molecular tests in specific lymphoma types Mantle cell lymphoma Follicular lymphoma Anaplastic large cell lymphoma Chronic lymphocytic leukemia/sll Diffuse large B-cell lymphoma What we can do to prepare for molecular testing in the near future The CML Story is the Poster Child For Personalized Cancer Therapy A Wave of High Throughput Molecular Testing is Coming Whole genome sequencing Total exon sequencing RNA sequencing Epigenomic profiling Methylation Histone modification 25

26 We Can Surf or Wipeout Genomics-Informed Pathology What we can do Need adequate tissue for molecular testing Excisional bx versus FNA/needle biopsy? Frozen/fresh is optimal Need to conserve paraffin-embedded tissue for molecular testing Optimize fixation and processing for paraffinbased testing This is pathology s time to seize the initiative and get in step with modern genomics 26

27 MYD88 - New Gene Detected by NGS Mutated in WM/LPL (~90%) and rare in nodal and extranodal marginal zone lymphomas (0-7%) N Engl J Med 367:826, 2012 Diffuse Large B-cell Lymphoma 12 types in WHO Primary mediastinal B-cell lymphoma Primary DLBCL of the CNS Primary cutaneous DLBCL, leg type T cell/histiocyte-rich large B-cell lymphoma Plasmablastic lymphoma Intravascular large B-cell lymphoma 27

28 Diffuse Large B-cell Lymphoma 12 types in WHO ALK+ large B-cell lymphoma Primary effusion lymphoma Lymphomatoid granulomatosis DLBCL associated with chronic inflammation DLBCL in HHV8+ multicentric Castleman disease EBV+ DLBCL of the elderly 28