Molecular Diagnostics in the Workup of Lymphomas for the General Pathologist. Outline. Role of Molecular Testing in Lymphoma Diagnosis
|
|
- Charles Sims
- 6 years ago
- Views:
Transcription
1 Molecular Diagnostics in the Workup of Lymphomas for the General Pathologist L. Jeffrey Medeiros, M.D. M.D. Anderson Cancer Center Outline Gene rearrangement studies / Clonality Translocations / mutations Molecular tests in specific lymphoma types Mantle cell lymphoma Follicular lymphoma Anaplastic large cell lymphoma Chronic lymphocytic leukemia/sll Diffuse large B-cell lymphoma What we can do to prepare for molecular testing in the near future Role of Molecular Testing in Lymphoma Diagnosis Biopsy Morphologic assessment Immunophenotype Benign vs. Malignant Classification Molecular Testing Prognosis Specific targets Pathways Therapy 1
2 B and T Lymphocytes Express Antigen Receptors B-cells IgH 100% Ig kappa 70% Ig lambda 30% T-cells TCR / 95% TCR / 5% Antigen Receptors (Proteins) Immunoglobulin T-cell receptor Anatomy of Ig Genes IGH IGK IGL 2
3 Anatomy of TCR Genes TCRB TCRA, TCRD TCRG Immunoglobulin Heavy Chain Gene Rearrangement Germline V 1 V 2 V n D 1-5 J 1-6 C D-J Joining V 1 V 2 V n D 3 J 3-6 C V-DJ Joining V 1 D 3 J 3-6 C mrna VDJC Occurs in bone marrow VDJ Rearrangement Generates Diversity > 5 x 10 6 different antibodies 3
4 Ig Variable Region is the Result of Gene Rearrangement FR, framework region; CDR, complimentary-determining region Walsh and Rosenquist, Medical Oncology 22:327, 2005 General Principles NHLs are monoclonal Lymphoid cells rearrange their antigen receptor genes Rearrangements occur prior to neoplastic transformation Rearrangements play no role in neoplastic transformation Clonality does not equal malignancy Methods for Detecting Ig and T-cell Gene Rearrangements Southern Blot Detects almost all gene rearrangements Requires ~ 30 ug high mol. wt. DNA Laborious and long turnaround time Edwin Southern 4
5 Methods for Detecting Ig and T-cell Gene Rearrangements Southern Blot Detects almost all gene rearrangements Requires ~ 30 ug high mol. wt. DNA Laborious and long turnaround time PCR Requires approximately 2 ug of DNA Can perform on paraffin tissue Easy and short turnaround time Almost every lab does PCR very few do Southern blot PCR to Detect Gene Rearrangements Why it Works V V V D D D J J J VDJ Rearrangement Primers Polymerase Chain Reaction General Principle Denature DNA sample to separate DNA strands (94ºC, 5 min) Primers bind to DNA strands (30-65º C, 30 sec Denature to separate DNA strands (94ºC, 30 sec) Polymerase synthesizes new DNA strands (65-75ºC, 2-5 min) 5
6 PCR Amplification is Exponential , ,388, ,435, ,073,741,824 Results in high sensitivity Traditional Gel-Based Detection of Gene Rearrangements Gel stained with ethidium bromide Capillary Gel Electrophoresis for Gene Rearrangements 1-5% sensitivity FRI FRII FRIII 6
7 Antigen Receptor Gene Rearrangements False Negative Results by PCR Ig genes Somatic mutations in V genes Use of consensus V and J primers TCR genes No somatic mutations Use of consensus V and J primers TCR beta Mutations prevent primers from annealing to DNA Antigen Receptor Gene Rearrangements False Negative Results by PCR IgH CLL/SLL <5% Mantle cell lymphoma <5% Follicular lymphoma 30-40% Marginal zone lymphoma 30-40% DLBCL 30-40% TCR genes All T-cell lymphoma ~10% The results are worse in paraffin embedded tissue Antigen Receptor Gene Rearrangements False Positive Results by PCR Monoclonal gene rearrangements can be detected in benign lesions Examples Autoimmune lymphoproliferations Immunodeficiency Helicobacter pylori gastritis Lymphoid lesions of skin May be true (but small) rearrangements that are not clinically significant 7
8 Outline Gene rearrangement studies / Clonality Translocations / mutations Molecular tests in specific lymphoma types Mantle cell lymphoma Follicular lymphoma Anaplastic large cell lymphoma Chronic lymphocytic leukemia/sll Diffuse large B-cell lymphoma What we can do to prepare for molecular testing in the near future General Mechanisms of Lymphomagenesis Activation of proto-oncogenes Chromosomal translocation Gene amplification Gene mutations Inactivation of tumor suppressor genes Gene mutations Infection by oncogenic viruses HTLV-1, EBV, HHV-8 Two Types of Chromosomal Translocations Juxtaposition of intact proto-oncogene with regulatory sequences of the partner chromosome Usually one of the antigen receptor loci. Upregulation of qualitatively normal protein Disruption and recombination of two distinct genes Generates a novel fusion gene Expression of qualitatively abnormal protein 8
9 Common Chromosomal Translocations B-cell NHL Translocation NHL type Genes t(14;18)(q32;q21) Follicular IgH and BCL2 t(8;14)(q24;q32) Burkitt MYC and IgH t(11;14)(q13;q32) Mantle cell CCND1 and IgH t(3;var)(q27;var) DLBCL BCL6 and partners t(11;18)(q21;q21) MALT API2 and MALT1 T-cell NHL Translocation NHL type Genes t(2;5)(p23;q35) ALCL ALK and NPM1 inv (14)(q11q32) T-PLL TCL-1 and TCR / Techniques Commonly Used to Detect Chromosomal Translocations Conventional cytogenetics t(8;14)(q24;q32) Need viable cells Cells die in transit Long TAT Techniques Commonly Used to Detect Chromosomal Translocations PCR IgH VVV DDD JJJJ C Must know sequence 1 partner BCL2 Need clusters OK in paraffin Most sensitive Ex1 Ex2 Ex 3 MBR t(14;18) JJ C Ex 1 Ex 2 Ex 3 Primers 9
10 Techniques Commonly Used to Detect Chromosomal Translocations In situ hybridization OK in paraffin Large probes Not great sensitivity Outline Gene rearrangement studies / Clonality Translocations / mutations Molecular tests in specific lymphoma types Mantle cell lymphoma Follicular lymphoma Anaplastic large cell lymphoma Chronic lymphocytic leukemia/sll Diffuse large B-cell lymphoma What we can do to prepare for molecular testing in the near future Mantle Cell Lymphoma Definition A B-cell neoplasm generally composed of monomorphic small to medium-sized lymphoid cells with irregular nuclear contours and a CCND1 translocation WHO book, p
11 11q13 in Mantle Cell Lymphoma Breakpoint Detection Telomere ccnd-1 90kb 20kb Centromere Detection Rate % % % % mtc2 mtc1 MTC PCR SB FISH CG Mantle Cell Lymphoma Cyclin D1 is a surrogate for the t(11;14) Not specific for MCL Other tumors that can be cyclin D1 + Hairy cell leukemia Myeloma CLL/SLL +/- (PCs) DLBCL (~5%) Ki-67 Index Predicts Survival in High-stage MCL patients CHOP R-CHOP Determann, O. et al. Blood 111:2385,
12 Follicular Lymphoma Definition A neoplasm composed of follicle center B-cells (typically both centrocytes and centroblasts) which usually has at least a partially follicular pattern Lymphomas composed of centrocytes and centroblasts with an entirely diffuse pattern in the sampled tissue may be included in the category. Essentially the definition is cytology + immunophenotype WHO book p. 220 t(14;18) is not included Follicular Lymphoma t(14;18)(q32;q21) BCL-2 IgH Frequency Chromosome 18q21 Inhibits apoptosis Chromosome 14q % of follicular lymphomas BCL2 is translocated to chromosome 14 and comes under influence of IgH enhancer - leads to overexpression of BCL2 BCL2 at CHROMOSOME 18q21 Detection of t(14;18) exon II exon III Detection Rate % % % % mbr mcr PCR SB FISH CG 12
13 ALK+ Anaplastic Large Cell Lymphoma Definition A T-cell tumor composed of lymphoid cells that are usually large with abundant cytoplasm and pleomorphic often horseshoe-shaped nuclei, with translocations involving ALK and ALK protein expression WHO book, p. 312 ALK+ Anaplastic Large Cell Lymphoma NPM-ALK 80% of ALK+ ALCL Falini, Br J Haematol 2001 ALK Fusion Proteins in ALCL Translocation Partner t(2;5)(p23;q35) Nucleophosmin 1 t(1;2)(p25;p23) Tropomyosin 3 t(2;3)(p23;q21) TRK-fused gene inv(2)(p23q35) ATIC t(2;17)(p23;q23) Clathrin heavy chain t(2;x)(p23;q11-12) Moesin t(2;17)(p23;q25) ALO17 t(2;22)(p23;q11.2) MYH9 t(2;19)(p23;q13.1) Tropomyosin 4 13
14 ALK Fusion Proteins Common Characteristics of Partners Partner is widely expressed Subcellular distribution of ALK is determined by partner Most have oligomerization domains Activate downstream signaling pathways neoplastic transformation Common Methods for Detecting NPM-ALK Classical cytogenetics FISH breakapart probe RT-PCR Long-range PCR ALK immunostaining Patterns of ALK Staining in ALCL Nuclear and cytoplasmic Membranous Cytoplasmic 14
15 Chronic Lymphocytic Leukemia/SLL Peripheral Blood Lymph node Chronic Lymphocytic Leukemia Prognosis 1/3 patients Indolent disease with no impact on survival 1/3 patients Initially indolent disease that progresses 1/3 patients Aggressive disease Chronic Lymphocytic Leukemia Prognostic Markers Clinical markers Clinical stage (Rai or Binet) Histologic markers Pattern and extent of BM involvement Serum markers 2-microglobulin, lactate dehydrogenase Molecular markers Conventional cytogenetic and FISH abnormalities, Ig somatic mutation 15
16 Cytogenetic Findings in CLL/SLL Fluorescence in situ hybridization ~80% of cases abnormal Del (13q14) Trisomy 12 Del (11q22-23) Del (17p13) Del (6q21) good bad bad bad bad Conventional cytogenetics ~20% of cases abnormal bad Somatic Mutation of IgV Genes Normal - generates antibody diversity in response to antigen Occurs in centroblasts in the germinal center Introduces point mutations into VH and VL, which form the antigen binding site Results in higher affinity antigenbinding IgH Somatic Mutations Impacts Prognosis of CLL Patients Damle R, et al. Blood 1999;94:
17 ZAP70 is a Surrogate of Ig Somatic Mutation N Engl J Med 2003;348: Diffuse Large B-cell Lymphoma Definition DLBCL is a neoplasm of large B lymphoid cells with nuclear size equal to or exceeding normal macrophage nuclei that has a diffuse growth pattern Centroblastic Immunoblastic 2008 WHO book, p. 233 Diffuse Large B-cell Lymphoma Prognosis is Difficult to Predict Groupe d etude des lymphomes de l adulte (GELA) (n=399) 17
18 DLBCL is Highly Heterogeneous De novo Nodal or extranodal Transformation from CLL/SLL, FL, MZL, NLPHL Spectrum of immunophenotypic features GC vs ABC Viral causes EBV, HHV8 Diffuse Large B-cell Lymphoma Gene Expression Profiling 3 types of DLBCL Germinal center-like Activated B lymphocyte-like Poorly defined / PMBCL Basically GC vs. Non GC Nature 403: 503, 2000 Germinal Center Reaction Sem Diagn Pathol 28: 167,
19 Diffuse Large B-cell Lymphoma Gene Expression Shows 2 Types that Correlate with Prognosis CHOP Therapy Nature 403: 503, 2000 Diffuse Large B-cell Lymphoma GEP Data is Valid for R-CHOP Treated Patients N Engl J Med 359: 2317, 2008 Can Immunohistochemistry be used as a Surrogate for GEP in DLBCL? CD GCB MUM1 + - Non-GCB BCL6 Results match gene expression profile in 76% of cases + - Chris Hans, MD GCB Non-GCB Blood 106: 275,
20 Choi IHC The Algorithm new algorithm and the Hans' as algorithm. a Surrogate for GEP in DLBCL? 5 antibodies GCET 1 CD10 BCL6 MUM1 FOXP1 93% concordance with GEP Clin Cancer Res15:5494, 2009 MYC Outcomes is of patients Prognostic with MYC+ DLBCL treated in with DLBCL R-CHOP. R-CHOP Therapy t(8;14)(q24;q32) - IgH (80%) t(8;22)(q24;q11) - Ig (15%) t(2;8)(p11;q24) - Ig (5%) Diagnostic tests Conventional cytogenetics Need viable cells FISH Use breakapart probe Blood 114: , 2009 Double Hit B-cell Lymphoma Definition Lymphomas with recurrent chromosomal breakpoints activating multiple oncogenes - one of which is MYC MYC + BCL-2 MYC + BCL-6 MYC + BCL-2 + BCL-6 (triple hit) MYC + BCL-3 MYC + CCND1 Blood 117: 2319,
21 MYC/BCL2 Double Hit Lymphoma Starry sky pattern High mitotic rate High apoptotic rate GCB immunophenotype FISH/CC evidence of breaks BCL2 Ki-67 MYC BCL2 J Clin Oncol 30: 3452, 2012 CD30 in Diffuse Large B-cell Lymphoma Ken Young, MD, PhD CD % of DLBCL are CD30+ Blood 2013 [Epub] 21
22 General Mechanisms of Lymphomagenesis Activation of proto-oncogenes Chromosomal translocation Gene amplification Gene mutations Inactivation of tumor suppressor genes Gene mutations Infection by oncogenic viruses HTLV-1, EBV, HHV-8 Sanger Sequencing Traditional (dideoxy) Method Fred Sanger Walter Gilbert 1 gene or 1 exon at a time Need relatively large quantity of DNA Labor intensive Sequencing on Illumina MiSeq: Overview and Update HiSeq MiSeq Flowcell (8 Lanes) Flowcell (Single Lane) Multiple/all genes simultaneously Need only amount of DNA Bioinformatics is difficult 22
23 UEP Mapping and comparison of multiple reads to a reference genome Individual reads mapped to reference genome Reference ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGA CGGTGAACGTTATCGACGATCCGATCGAACTGTCAGC GGTGAACGTTATCGACGTTCCGATCGAACTGTCAGCG TGAACGTTATCGACGATCCGATCGAACTGTCAGCGGC TGAACGTTATCGACGTTCCGATCGAACTGTCAGCGGC TGAACGTTATCGACGATCCGATCGAACTGTCAGCGGC GTTATCGACGTTCCGATCGAACTGTCAGCGGCAAGCT TTATCGACGATCCGATCGAACTGTCAGCGGCAAGCT ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGAACTGTCAGCGGCAAGCTGATCGATCGATCGATGCTAGTG In clinical tumor samples, DNA is derived from a mixture of neoplastic and non-neoplastic cells Challenges of Next Gen Sequencing Low tumor percentage and high error rate KRAS12-2 C A G T Patient Sample 40% Tumor Nat Genet 43: 830, 2011 Nature 476: 298,
24 Whole exome sequencing of 6 cases of DLBCL Copy number analysis using SNP arrays DLBCL carry ~ 30 gene mutations New abnormalities identified in: Chromatin methylation (MLL) Immune surveillance Nature Genetics 43: 830, 2011 Gene Mutations in DLBCL Potential Impairment of Many Cellular Processes Transcriptional regulation Lymphocyte activation Lymphocyte differentiation Histone methylation Histone acetylation Immune surveillance B-cell receptor signaling (p53) (STAT6, BCL10) (NF-kB, PRDM1) (EZH2, MLL2) (CREBBP, MEF2B) (B2M, CD58) (CD79B, CD79A) Nat Genet 43: 830, 2011 Nature 476: 298, 2011 Genetic Profile of GC and ABC DLBCL GC ABC 5-year OS 59% 30% Cytogenetics Gene mutations Mechanisms t(14;18)/igh-bcl2 MYC translocations MLL2, EZH2 CREBBP/EP300 MEF2B, BCL6 PTEN, PIK3CA BCL-2/apoptosis Chromatin modulation PI3K/AKT activation t(3q27)/bcl6 Trisomy 3, del(6q) A20/TNFAIP3 CARD11, MYD88 CD79B, CD79A PRDM1/BLIMP1 NF- B activation B-cell receptor signaling Nature Genetics 43: 830,
25 Outline Gene rearrangement studies / Clonality Translocations / mutations Molecular tests in specific lymphoma types Mantle cell lymphoma Follicular lymphoma Anaplastic large cell lymphoma Chronic lymphocytic leukemia/sll Diffuse large B-cell lymphoma What we can do to prepare for molecular testing in the near future The CML Story is the Poster Child For Personalized Cancer Therapy A Wave of High Throughput Molecular Testing is Coming Whole genome sequencing Total exon sequencing RNA sequencing Epigenomic profiling Methylation Histone modification 25
26 We Can Surf or Wipeout Genomics-Informed Pathology What we can do Need adequate tissue for molecular testing Excisional bx versus FNA/needle biopsy? Frozen/fresh is optimal Need to conserve paraffin-embedded tissue for molecular testing Optimize fixation and processing for paraffinbased testing This is pathology s time to seize the initiative and get in step with modern genomics 26
27 MYD88 - New Gene Detected by NGS Mutated in WM/LPL (~90%) and rare in nodal and extranodal marginal zone lymphomas (0-7%) N Engl J Med 367:826, 2012 Diffuse Large B-cell Lymphoma 12 types in WHO Primary mediastinal B-cell lymphoma Primary DLBCL of the CNS Primary cutaneous DLBCL, leg type T cell/histiocyte-rich large B-cell lymphoma Plasmablastic lymphoma Intravascular large B-cell lymphoma 27
28 Diffuse Large B-cell Lymphoma 12 types in WHO ALK+ large B-cell lymphoma Primary effusion lymphoma Lymphomatoid granulomatosis DLBCL associated with chronic inflammation DLBCL in HHV8+ multicentric Castleman disease EBV+ DLBCL of the elderly 28
GENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute
GENETIC MARKERS IN LYMPHOMA a practical overview P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute B and T cell monoclonalities Rearrangement of immunoglobin and TCR genes may help
More informationImmunopathology of Lymphoma
Immunopathology of Lymphoma Noraidah Masir MBBCh, M.Med (Pathology), D.Phil. Department of Pathology Faculty of Medicine Universiti Kebangsaan Malaysia Lymphoma classification has been challenging to pathologists.
More informationDefined lymphoma entities in the current WHO classification
Defined lymphoma entities in the current WHO classification Luca Mazzucchelli Istituto cantonale di patologia, Locarno Bellinzona, January 29-31, 2016 Evolution of lymphoma classification Rappaport Lukes
More informationDiagnostic Molecular Pathology of Lymphoid Neoplasms
Diagnostic Molecular Pathology of Lymphoid Neoplasms (Part II) Rational use of molecular testing in lymphomas Beirut, Lebanon Friday December 2, 2011: Hematopathology Session Adam Bagg University of Pennsylvania
More informationThe next lymphoma classification Luca Mazzucchelli Istituto cantonale di patologia, Locarno
Evolution of classification The next classification Luca Mazzucchelli Istituto cantonale di patologia, Locarno The Lymphoma Forum of Excellence, Bellinzona, January 2011 Rappaport Lukes and Collins (immunophenotype)
More informationAggressive B-cell Lymphomas
Neoplastic Hematopathology Update 2018 Aggressive B-cell Lymphomas Raju K. Pillai City of Hope National Medical Center I do not have any disclosures Disclosures Outline New entities and changes in WHO
More informationThe development of clonality testing for lymphomas in the Bristol Genetics Laboratory. Dr Paula Waits Bristol Genetics Laboratory
The development of clonality testing for lymphomas in the Bristol Genetics Laboratory Dr Paula Waits Bristol Genetics Laboratory Introduction The majority of lymphoid malignancies belong to the B cell
More informationMethods used to diagnose lymphomas
Institut für Pathologie Institut für Pathologie Methods used to diagnose lymphomas Prof. Dr.Med. Leticia Quintanilla-Fend Molecular techniques NGS histology Cytology AS-PCR Sanger seq. MYC Immunohistochemistry
More informationMolecular Diagnosis. Nucleic acid based testing in Oncology
Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,
More informationNucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis
Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor
More informationAggressive B-cell lymphomas and gene expression profiling towards individualized therapy?
Aggressive B-cell lymphomas and gene expression profiling towards individualized therapy? Andreas Rosenwald Institute of Pathology, University of Würzburg, Germany Barcelona, June 18, 2010 NEW WHO CLASSIFICATION
More informationAggressive B-Cell Lymphomas
Aggressive B-cell Lymphomas Aggressive B-Cell Lymphomas Stephen Hamilton Dutoit Institute of Pathology Aarhus Kommunehospital B-lymphoblastic lymphoma Diffuse large cell lymphoma, NOS T-cell / histiocyte-rich;
More informationAggressive B-cell Lymphomas Updated WHO classification Elias Campo
Aggressive B-cell Lymphomas Updated WHO classification Elias Campo Hospital Clinic, University of Barcelona Diffuse Large B-cell Lymphoma A Heterogeneous Category Subtypes with differing: Histology and
More informationAggressive B cell Lymphomas
Aggressive B cell Lymphomas I have nothing to disclose. Disclosures Raju K. Pillai City of Hope National Medical Center Outline WHO 2016 Classification Large B cell Lymphomas New entities and changes in
More informationSmall B-cell (Histologically Low Grade) Lymphoma
Frequency of Lymphoid Neoplasms Small B-cell (Histologically Low Grade) Lymphoma Stephen Hamilton-Dutoit Institute of Pathology Aarhus University Hospital B-cell neoplasms 88% Diffuse large B-cell lymphoma
More informationDifferential diagnosis of hematolymphoid tumors composed of medium-sized cells. Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital
Differential diagnosis of hematolymphoid tumors composed of medium-sized cells Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital Lymphoma classification Lymphoma diagnosis starts with morphologic
More informationAggressive B cell Lymphomas
Aggressive B cell Lymphomas Raju K. Pillai City of Hope National Medical Center I have no disclosures Outline What is new in the WHO 2016 classification Insights from genomic studies Double Hit Lymphoma
More informationHigh grade B-cell lymphomas (HGBL): Altered terminology in the 2016 WHO Classification (Update of the 4 th Edition) and practical issues Xiao-Qiu Li,
High grade B-cell lymphomas (HGBL): Altered terminology in the 2016 WHO Classification (Update of the 4 th Edition) and practical issues Xiao-Qiu Li, M.D., Ph.D. Fudan University Shanghai Cancer Center
More informationAggressive B-cell Lymphoma 2013
Aggressive B-cell Lymphoma 2013 Diffuse Large B-Cell Lymphoma Burkitt Lymphoblastic lymphoma Gray zone Intermediate DLBCL/HL Intermediate BL/DLBCL Diffuse Large B-cell lymphoma Common morphology: diffuse
More informationPathology of aggressive lymphomas
Institute of Pathology Pathology of aggressive lymphomas Leticia Quintanilla-Martinez Changes in the new 2016 WHO Aggressive B-cell lymphoid neoplasms Major changes that impact how cases should be evaludated
More informationPathology of aggressive lymphomas
Institute of Pathology Pathology of aggressive lymphomas Leticia Quintanilla-Martinez Changes in the new 2016 WHO Aggressive B-cell lymphoid neoplasms Major changes that impact how cases should be evaludated
More informationFrom Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport
From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology Songlin Zhang, MD, PhD LSUHSC-Shreveport I have no Conflict of Interest. FNA on Lymphoproliferative
More informationHIGH GRADE B-CELL LYMPHOMA DAVID NOLTE, MD (PGY-2) HUSSAM AL-KATEB, PHD, FACMG DEBORAH FUCHS, MD
HIGH GRADE B-CELL LYMPHOMA DAVID NOLTE, MD (PGY-2) HUSSAM AL-KATEB, PHD, FACMG DEBORAH FUCHS, MD OUTLINE High grade B-cell lymphoma with MYC and BCL2 and/or BCL6 rearrangements Patient presentation 2008/2016
More information7 Omar Abu Reesh. Dr. Ahmad Mansour Dr. Ahmad Mansour
7 Omar Abu Reesh Dr. Ahmad Mansour Dr. Ahmad Mansour -Leukemia: neoplastic leukocytes circulating in the peripheral bloodstream. -Lymphoma: a neoplastic process in the lymph nodes, spleen or other lymphatic
More informationNon-Hodgkin s Lymphomas Version
NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines ) Non-Hodgkin s Lymphomas Version 2.2015 NCCN.org Continue Use of Immunophenotyping/ Genetic Testing in Differential Diagnosis of Mature B-Cell
More information9/28/2017. Follicular Lymphoma and Nodal Marginal Zone Lymphoma. Follicular Lymphoma Definition. Low-Grade B-Cell Lymphomas in WHO Classification
and L. Jeffrey Medeiros, MD DISCLOSURES I do not have anything to disclose Low-Grade B-Cell Lymphomas in WHO Classification Lymphoma Type Frequency Follicular lymphoma 22.1 % Extranodal MALT-lymphoma 7.6
More informationPathology of the indolent B-cell lymphomas Elias Campo
Pathology of the indolent B-cell lymphomas Elias Campo Hospital Clinic, University of Barcelona Small B-cell lymphomas Antigen selection NAIVE -B LYMPHOCYTE MEMORY B-CELL MCL FL LPL MZL CLL Small cell
More informationFOLLICULARITY in LYMPHOMA
FOLLICULARITY in LYMPHOMA Reactive Follicular Hyperplasia Follicular Hyperplasia irregular follicles Follicular Hyperplasia dark and light zones Light Zone Dark Zone Follicular hyperplasia MIB1 Follicular
More informationMalignant lymphomas are neoplasms that arise from B
Overview of the Role of Molecular Methods in the Diagnosis of Malignant Lymphomas L. Jeffrey Medeiros, MD; Jeanne Carr, PhD Objective. To review the role of molecular genetics in the diagnosis of malignant
More informationMolecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU
Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU Lecture outline Time 10:00 11:00 11:15 12:10 12:20 13:15 Content Introduction to lymphoma Review of lymphocyte biology
More informationUpdate on the Classification of Aggressive B-cell Lymphomas and Hodgkin Lymphoma
Update on the Classification of Aggressive B-cell Lymphomas and Hodgkin Lymphoma Nancy Lee Harris, M. D. Massachusetts General Hospital Harvard Medical School Aggressive B-cell Lymphomas WHO 4 th Edition
More informationLarge cell immunoblastic Diffuse histiocytic (DHL) Lymphoblastic lymphoma Diffuse lymphoblastic Small non cleaved cell Burkitt s Non- Burkitt s
Non Hodgkin s Lymphoma Introduction 6th most common cause of cancer death in United States. Increasing in incidence and mortality. Since 1970, the incidence of has almost doubled. Overview The types of
More informationLYMPHOMAS an overview of some subtypes of NHLs
One of the confusing aspects of the lymphoid neoplasms concerns the use of the descriptive terms "leukemia" and "lymphoma." LYMPHOMAS an overview of some subtypes of NHLs Leukemia is used for lymphoid
More informationPearls and pitfalls in interpretation of lymphoid lesions in needle biopsies
Pearls and pitfalls in interpretation of lymphoid lesions in needle biopsies Megan S. Lim MD PhD University of Pennsylvania October 8, 2018 Objectives To understand how the trend toward less invasive lymph
More informationPhenoPath. Diagnoses you can count on B CELL NON-HODGKIN LYMPHOMA
PhenoPath Diagnoses you can count on B CELL NON-HODGKIN LYMPHOMA C urrent diagnosis of B cell non-hodgkin lymphoma (B-NHL) is based on the 2008 WHO Classification of Tumours of Haematopoietic and Lymphoid
More informationRecent advances in the genetics & biology of lymphoma
Recent advances in the genetics & biology of lymphoma Chris Bacon Northern Institute for Cancer Research Newcastle University & Newcastle Upon Tyne Hospitals NHS Foundation Trust Lymphoma Rate per 100,000
More informationIX. Is it only about MYC? How to approach the diagnosis of diffuse large B-cell lymphomas
Hematological Oncology Hematol Oncol 2015; 33: 50 55 Published online in Wiley Online Library (wileyonlinelibrary.com).2217 Supplement Article IX. Is it only about MYC? How to approach the diagnosis of
More information3/23/2017. Disclosure of Relevant Financial Relationships. Pitfalls in Immunohistochemistry in Hematopathology: CD20 and CD3 Can Let Me Down?!
Pitfalls in Immunohistochemistry in Hematopathology: CD20 and CD3 Can Let Me Down?! Judith A. Ferry Massachusetts General Hospital Disclosure of Relevant Financial Relationships USCAP requires that all
More informationChromosomal translocations in non-hodgkin lymphomas
Chromosomal Translocations Involved in Non-Hodgkin Lymphomas Francisco Vega, MD, PhD; L. Jeffrey Medeiros, MD Context. The discovery that recurrent chromosomal translocations are involved in the pathogenesis
More informationMolecular Hematopathology
Molecular Hematopathology Charles E. Hill, MD, PhD Emory University School of Medicine April 2013 The Association for Molecular Pathology Education. Innovation and Improved Patient Care. Advocacy. www.amp.org
More informationUse of MYC, BCL2 and BCL6 FISH for investigations of high grade B cell lymphoma
Use of MYC, BCL2 and BCL6 FISH for investigations of high grade B cell lymphoma Dr Anthony Bench Haematopathology and Oncology Diagnostic Service Cambrıdge Unıversıty Hospitals NHS Foundatıon Trust Cambridge
More informationLymphoma/CLL 101: Know your Subtype. Dr. David Macdonald Hematologist, The Ottawa Hospital
Lymphoma/CLL 101: Know your Subtype Dr. David Macdonald Hematologist, The Ottawa Hospital Function of the Lymph System Lymph Node Lymphocytes B-cells develop in the bone marrow and influence the immune
More informationA Practical Guide To Diagnose B-Cell Lymphomas on FNAs. Nancy P. Caraway, M.D.
A Practical Guide To Diagnose B-Cell Lymphomas on FNAs Nancy P. Caraway, M.D. Major Factors Impacting Dx Lymphomas on Small Bxs Classification systems Immunophenotyping by multiprobe flow cytometry and
More informationLow-Grade B-Cell Lymphomas in WHO Classification. Follicular Lymphoma Definition. Follicular Lymphoma Clinical Features 11/7/2017 DISCLOSURES
Low-Grade B-Cell Lymphomas in WHO Classification DISCLOSURES I do not have anything to disclose Lymphoma Type Frequency Follicular lymphoma 22.1 % Extranodal MALT-lymphoma 7.6 % Small lymphocytic lymphoma/cll
More informationContents. vii. Preface... Acknowledgments... v xiii
Contents Preface... Acknowledgments... v xiii SECTION I 1. Introduction... 3 Knowledge-Based Diagnosis... 4 Systematic Examination of the Lymph Node... 7 Cell Type Identification... 9 Cell Size and Cellularity...
More informationClassification of Hematologic Malignancies. Patricia Aoun MD MPH
Classification of Hematologic Malignancies Patricia Aoun MD MPH Objectives Know the basic principles of the current classification system for hematopoietic and lymphoid malignancies Understand the differences
More informationDiagnosis of lymphoid neoplasms has been
Iranian Journal of Pathology (2007)2 (1), 1-61 Review Article Mehdi Nassiri Dep. of Pathology, University of Miami Miller School of Medicine, Miami, USA Abstract Correct diagnosis and classification of
More informationMany of the hematolymphoid disorders are derived
REVIEW ARTICLE Practical Immunohistochemistry in Hematopathology: A Review of Useful Antibodies for Diagnosis Ji Lu, MD and Karen L. Chang, MD Abstract: This review article offers some useful panels of
More informationCost-Effective Strategies in the Workup of Hematologic Neoplasm. Karl S. Theil, Claudiu V. Cotta Cleveland Clinic
Cost-Effective Strategies in the Workup of Hematologic Neoplasm Karl S. Theil, Claudiu V. Cotta Cleveland Clinic In the past 12 months, we have not had a significant financial interest or other relationship
More information5003 Immunohistochemistry in hematopathology, what's in, what's out, what's useful
www.ascp.org/ascp2014 5003 Immunohistochemistry in hematopathology, what's in, what's out, what's useful Kathryn Rizzo, DO, PhD VIRGINIA COMMONWEALTH UNIVERSITY Department of Pathology School of Medicine
More informationNEW ENTITIES IN AGGRESSIVE B CELL LYMPHOMA. Joon Seong Park, M.D. Dept. of Hematology-Oncology Ajou University School of Medicine
NEW ENTITIES IN AGGRESSIVE B CELL LYMPHOMA Joon Seong Park, M.D. Dept. of Hematology-Oncology Ajou University School of Medicine Historical background of Lymphoma classification Rappaport classification
More informationCase 3. Ann T. Moriarty,MD
Case 3 Ann T. Moriarty,MD Case 3 59 year old male with asymptomatic cervical lymphadenopathy. These images are from a fine needle biopsy of a left cervical lymph node. Image 1 Papanicolaou Stained smear,100x.
More informationEurekah Bioscience Collection
in Malignant 5/31/06 12:09 PM in Malignant to Leukemia and Lymphoma Eurekah Bioscience Collection in Malignant Sarah E. enrickson Elena M. artmann German Ott Andreas Rosenwald* The practice of clinical
More informationCase Report A case of EBV positive diffuse large B-cell lymphoma of the adolescent
Int J Clin Exp Med 2014;7(1):307-311 www.ijcem.com /ISSN:1940-5901/IJCEM1311029 Case Report A case of EBV positive diffuse large B-cell lymphoma of the adolescent Qilin Ao 2, Ying Wang 1, Sanpeng Xu 2,
More informationDiffuse large B-cell lymphoma (DLBCL) is one of the
Practical Applications in Immunohistochemistry Evaluation of Diffuse Large B-Cell Lymphoma and Related Large B-Cell Lymphomas Dennis P. O Malley, MD; Aaron Auerbach, MD; Lawrence M. Weiss, MD Context.
More informationWHO 4th ED Classification of Mature B-cell Neoplasms
WHO 4th ED Classification of Mature B-cell Neoplasms Chronic lymphocytic leukemia /Small lymphocytic lymphoma B-cell prolymphocytic leukaemia Splenic marginal zone lymphoma Hairy cell leukemia Splenic
More informationFollicular Lymphoma: the WHO
Follicular Lymphoma: the WHO and the WHERE? Yuri Fedoriw, MD Associate Professor of Pathology and Laboratory Medicine Director of Hematopathology University of North Carolina Chapel Hill, NC Disclosure
More informationNon-Hodgkin lymphomas (NHLs) Hodgkin lymphoma )HL)
Non-Hodgkin lymphomas (NHLs) Hodgkin lymphoma )HL) Lymphoid Neoplasms: 1- non-hodgkin lymphomas (NHLs) 2- Hodgkin lymphoma 3- plasma cell neoplasms Non-Hodgkin lymphomas (NHLs) Acute Lymphoblastic Leukemia/Lymphoma
More informationMOLECULAR PATHOGENESIS OF NON-HODGKIN LYMPHOMA: A CLINICAL PERSPECTIVE
molecular basis of disease Haematologica 1995; 80:454-472 MOLECULAR PATHOGENESIS OF NON-HODGKIN LYMPHOMA: A CLINICAL PERSPECTIVE Gianluca Gaidano, Cristina Pastore, Gisella Volpe Laboratorio di Medicina
More informationGray Zones and Double Hits Distinguishing True Burkitt Lymphoma from Other High-Grade B-NHLs Burkitt Lymphoma Burkitt-Like Lymphoma DLBCL Patrick Tres
Gray Zones and Double Hits Distinguishing True Burkitt Lymphoma from Other High-Grade B-NHLs Burkitt Lymphoma Burkitt-Like Lymphoma DLBCL Patrick Treseler, MD, PhD University of California San Francisco
More informationDoes the proliferation fraction help identify mature B cell lymphomas with double- and triple-hit translocations?
Histopathology 2012, 61, 1214 1218. DOI: 10.1111/j.1365-2559.2012.04351.x SHORT REPORT Does the proliferation fraction help identify mature B cell lymphomas with double- and triple-hit translocations?
More informationInitial Diagnosis and Treatment 81 Male
Case SH2017-0359 Shiraz Fidai 1, Sandeep Gurbuxani 1, Girish Venkataraman 1, Gordana Raca 2, Madina Sukhanova 3, Michelle M Le Beau 3, Y. Lynn Wang 4, Mir Alikhan 4, Megan M.McNerney 4, Yuri Kobzev 4,
More informationEQA SCHEME CIRCULATION 33 EDUCATIONAL SLIDES DR GRAEME SMITH MONKLANDS DGH
EQA SCHEME CIRCULATION 33 EDUCATIONAL SLIDES DR GRAEME SMITH MONKLANDS DGH CASE E1 M: 68 yrs Left destructive sinonasal lesion.?lymphoma?adenocarcinoma CD20 CD10 BCL6 MIB1 Answers Diffuse large B cell
More informationChronic Lymphocytic Leukemia Mantle Cell Lymphoma Elias Campo
Chronic Lymphocytic Leukemia Mantle Cell Lymphoma Elias Campo Hospital Clinic, University of Barcelona Small B-cell lymphomas NAIVE -B LYMPHOCYTE MEMORY CELL CLL MCL FL MZL Small cell size Low proliferation
More informationThe patient had a mild splenomegaly but no obvious lymph node enlargement. The consensus phenotype obtained from part one of the exercise was:
Case History An 86 year old male was admitted to hospital with chest infection. Haematological examination subsequently revealed the following: Hb- 11.0 g/dl; WBC- 67.1 x 10^9/l; PLT- 99 x10^9/l; RBC-
More informationImmunohistochemical classification of haematolymphoid tumours. Stephen Hamilton-Dutoit Institute of Pathology Aarhus University Hospital
Immunohistochemical classification of haematolymphoid tumours Stephen Hamilton-Dutoit Institute of Pathology Aarhus University Hospital Malignant lymphoproliferative diseases What are they? Haematolymphoid
More informationLymphoma Update: Lymphoma Update: What s Likely to be New in the New WHO. Patrick Treseler, MD, PhD University of California San Francisco
Lymphoma Update: What s Likely to be New in the New WHO Blood 127:2375; 2016 Patrick Treseler, MD, PhD University of California San Francisco Lymphoma Update: What IS New in the New WHO! Patrick Treseler,
More informationBurkitt lymphoma. Sporadic Endemic in Africa associated with EBV Translocations involving MYC gene on chromosome 8
Heme 8 Burkitt lymphoma Sporadic Endemic in Africa associated with EBV Translocations involving MYC gene on chromosome 8 Most common is t(8;14) Believed to be the fastest growing tumor in humans!!!! Morphology
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationHepatic Lymphoma Diagnosis An Algorithmic Approach
Hepatic Lymphoma Diagnosis An Algorithmic Approach Ryan M. Gill, M.D., Ph.D. University of California, San Francisco PLEASE TURN OFF YOUR CELL PHONES Disclosure of Relevant Financial Relationships USCAP
More informationNon-Hodgkin s Lymphoma: Molecular Features of B Cell Lymphoma
Non-Hodgkin s Lymphoma: Molecular Features of B Cell Lymphoma Elizabeth Macintyre (Chair), Dennis Willerford, and Stephan W. Morris The rapid increase in the incidence of the B cell non-hodgkin s lymphomas
More informationAnaplastic Large Cell Lymphoma (of T cell lineage)
Anaplastic Large Cell Lymphoma (of T cell lineage) Definition T-cell lymphoma comprised of large cells with abundant cytoplasm and pleomorphic, often horseshoe-shaped nuclei CD30+ Most express cytotoxic
More informationHaematology Probes for Multiple Myeloma
Haematology Probes for Multiple Myeloma MULTIPLE MYELOMA Multiple myeloma (MM) is a plasma cell neoplasm, characterised by the accumulation of clonal plasma cells in the bone marrow and by very complex
More informationPrevalent lymphomas in Africa
Prevalent lymphomas in Africa Dr Zainab Mohamed Clinical Oncologist GSH/UCT Groote Schuur Hospital Disclaimer I declare that I have no conflict of interest Groote Schuur Hospital Denis Burkitt 1911-1993
More informationWHO UPDATE ON LYMPHOMAS. Dr Priya Mary Jacob Asst Professor, Pathology.
WHO UPDATE ON LYMPHOMAS Dr Priya Mary Jacob Asst Professor, Pathology 3 rd 4 th 4 th revised 2001 2008 2017 The Change The Significance of the Change- Diagnostic, Prognostic The Rationale behind the change.
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationLow-grade B-cell lymphoma
Low-grade B-cell lymphoma Patho-Basic 11. September 2018 Stephan Dirnhofer Pathology Outline Definition LPL, MBL/CLL/SLL, MCL FL Subtypes & variants Diagnosis including Grading Transformation Summary Be
More information10/31/2017. Immunodeficiencies. Outline. Discuss EBV. Non-destructive Polymorphic Monomorphic Therapies Challenges
I have no financial disclosures Joo Y. Song, MD Assistant Professor of Clinical Pathology City of Hope National Medical Center Immunodeficiencies Outline Transplant Congenital Autoimmunity T-cell/immune
More informationHEMATOPATHOLOGY DIAGNOSIS & SUBTYPING. Use of IHC. Use of Polymerase Chain Reaction (PCR) Use of Flow Cytometry
HEMATOPATHOLOGY DIAGNOSIS & SUBTYPING HEMATOPATHOLOGY DIAGNOSIS & SUBTYPING The 2008 WHO classification system for tumors of hematopoietic and lymphoid tissues specifies that various combinations of immunophenotypic
More informationB Cell Lymphoma: Aggressive
B Cell Lymphoma: Aggressive UpToDate: Introduction: Risk Factors: Biology: Symptoms: Diagnosis: Ibrutinib approved for mantle cell lymphoma as 2nd line therapy. - Aggressive lymphomas are a group of malignant
More informationCase year old male with abdominal lymphadenopathy Treated with 8 cycles of R-CHOP One year later B-symptoms and progressive disease
Codirectors Tsieh Sun, M.D., FASCP Francisco Vega, M.D., Ph.D. Department of Hematopathology UT MD Anderson Cancer Center Houston Texas There is no conflict of interest involved in the content and presentation
More informationWHO Classification. B-cell chronic lymphocytic leukemia/small T-cell granular lymphocytic leukemia
Blood Malignancies-II Prof. Dr. Herman Hariman, a Ph.D, SpPK (KH). Prof. Dr. Adikoesoema Aman, SpPK (KH) Dept. of Clinical Pathology, School of Medicine, University of North Sumatra WHO classification
More informationSH Comprehensive Molecular Profiling of an ALK-Negative, Anaplastic Large Cell Lymphoma with DUSP22 rearrangement
SH2017-0277 Comprehensive Molecular Profiling of an ALK-Negative, Anaplastic Large Cell Lymphoma with DUSP22 rearrangement Caleb Ho, M.D.; Alexander Chan, M.D., Yanming Zhang, M.D.; Lu Wang, M.D., Ph.D;
More informationReview. Molecular Diagnostic Approach to Non-Hodgkin s Lymphoma. Materials and Methods. Daniel A. Arber
Journal of Molecular Diagnostics, Vol. 2, No. 4, November 2000 Copyright American Society for Investigative Pathology and the Association for Molecular Pathology Review Molecular Diagnostic Approach to
More informationComposite mantle cell and follicular lymphoma. A case report
Human Pathology (2009) 40, 259 263 www.elsevier.com/locate/humpath Case study Composite mantle cell and follicular lymphoma. A case report Raquel B. Ilgenfritz MD a,, Agnès Le Tourneau MD a, Michel Arborio
More informationHENATOLYMPHOID SYSTEM THIRD YEAR MEDICAL STUDENTS- UNIVERSITY OF JORDAN AHMAD T. MANSOUR, MD. Parts 2 and 3
HENATOLYMPHOID SYSTEM THIRD YEAR MEDICAL STUDENTS- UNIVERSITY OF JORDAN AHMAD T. MANSOUR, MD Parts 2 and 3 NEOPLASTIC LYMPHOID DISEASES Introduction o The bone marrow is the source of all cells in the
More informationLymphoma: The Basics. Dr. Douglas Stewart
Lymphoma: The Basics Dr. Douglas Stewart Objectives What is lymphoma? How common is it? Why does it occur? How do you diagnose it? How do you manage it? How do you follow patients after treatment? What
More information11/2/2017. Immunodeficiencies. Joo Y. Song, MD Assistant Professor of Clinical Pathology. I have no financial disclosures.
I have no financial disclosures Joo Y. Song, MD Assistant Professor of Clinical Pathology City of Hope National Medical Center Immunodeficiencies Transplant Autoimmunity Drugs T-cell dysfunction (Age,
More informationNON HODGKINS LYMPHOMA: INDOLENT Updated June 2015 by Dr. Manna (PGY-5 Medical Oncology Resident, University of Calgary)
NON HODGKINS LYMPHOMA: INDOLENT Updated June 2015 by Dr. Manna (PGY-5 Medical Oncology Resident, University of Calgary) Reviewed by Dr. Michelle Geddes (Staff Hematologist, University of Calgary) and Dr.
More informationTemplate for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma
Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma Version: CLLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017
More informationPathology #07. Hussein Al-Sa di. Dr. Sohaib Al-Khatib. Mature B-Cell Neoplasm. 0 P a g e
Pathology #07 Mature B-Cell Neoplasm Hussein Al-Sa di Dr. Sohaib Al-Khatib 0 P a g e Thursday 18/2/2016 Our lecture today (with the next 2 lectures) will be about lymphoid tumors This is a little bit long
More informationPatterns of Lymphoid Neoplasia in Peripheral Blood. Leon F. Baltrucki, M.D. Leon F. Baltrucki, M.D. Disclosure
Patterns of Lymphoid Neoplasia in Peripheral Blood Leon F. Baltrucki, M.D. Leon F. Baltrucki, M.D. Disclosure Dr Baltrucki has received an honorarium for his participation as a faculty presenter in this
More informationConflict of Interest Disclosure Form NAME :James O. Armitage, M.D AFFILIATION: University of Nebraska Medical Center
What Is Personalized Medicine For Patients With Lymphoma? Conflict of Interest Disclosure Form NAME :James O. Armitage, M.D AFFILIATION: University of Nebraska Medical Center DISCLOSURE I have no potential
More informationCCND1-IGH Fusion-Amplification and MYC Copy Number Gain in a Case of Pleomorphic Variant Mantle Cell Lymphoma
AJCP /CASE REPORT CCND1-IGH Fusion-Amplification and MYC Copy Number Gain in a Case of Pleomorphic Variant Mantle Cell Lymphoma Yuan Miao, MD, 1,2 Pei Lin, MD, 1 Wei Wang, MD, 1 L. Jeffrey Medeiros, MD,
More informationMolecular Advances in Hematopathology
Molecular Advances in Hematopathology HOW MOLECULAR METHODS HAVE CHANGED MY PRACTICE Objectives Understand the importance of cytogenetic/molecular studies in hematolymphoid diseases Know some of the important
More information2010 Hematopoietic and Lymphoid ICD-O Codes - Alphabetical List THIS TABLE REPLACES ALL ICD-O-3 Codes
Acute basophilic leukemia 9870/3 Acute biphenotypic leukemia [OBS] 9805/3 Acute erythroid leukemia 9840/3 Acute megakaryoblastic leukemia 9910/3 Acute monoblastic and monocytic leukemia 9891/3 Acute myeloid
More information2012 Hematopoietic and Lymphoid ICD-O Codes - Numerical List THIS TABLE REPLACES ALL ICD-O-3 Codes
Malignant lymphoma, NOS 9590/3 Non-Hodgkin lymphoma, NOS 9591/3 B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and classical Hodgkin lymphoma 9596/3 Primary
More information88-year-old Female with Lymphadenopathy. Faizi Ali, MD
88-year-old Female with Lymphadenopathy Faizi Ali, MD Clinical History A 88-year-old caucasian female presented to our hospital with the complaints of nausea, vomiting,diarrhea, shortness of breath and
More information