Nature Biotechnology: doi: /nbt Supplementary Figure 1. Folate stability in GA9.15
|
|
- Christina Griffith
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Folate stability in GA9.15 Total folate levels in GA9.15 until 7 months of storage at 28 C. Seeds of the sixth (T5) generation (upon harvest stored at -80 C) were used to confirm the results obtained in the pilot stability experiment (Fig. 1A). Values are means of two biological repeats (and four biological repeats for month 6 and 7); error bars indicate standard deviation. Dots represent the measured values.
2 Supplementary Figure 2 Folate content in GA lines over successive generations Total folate levels in GA9.15 and GA26.5 of successive generations. Values are means of two biological repeats; error bars indicate standard deviation. Dots represent the measured values.
3 Supplementary Figure 3 Rice T-DNA vectors T-DNA vectors used for rice transformation. Orange arrows represent the different promoters.; blue arrows, hygromycin resistance gene (HPTII). Blue bars indicate transcriptional terminators. Abbreviations: LB and RB, left and right T-DNA borders; T35S, 35S transcriptional terminator; Tnos, nopaline synthase transcriptional terminator; CaMV35S, core cauliflower mosaic virus 35S promoter; HPTII, hygromycin phosphotransferase II; GluB1, rice glutelin B1 promoter; GluB4, rice glutelin B4 promoter; Glob, rice globulin promoter; GTPCHI, Arabidopsis thaliana cdna encoding GTP cyclohydrolase I (green arrow); ADCS, Arabidopsis thaliana cdna encoding aminodeoxychorismate synthase (pale brown arrow); mtfpgs, Arabidopsis thaliana coding cdna encoding mitochondrial folylpolyglutamate synthetase (FPGS) (black arrows); ctfpgs, Arabidopsis thaliana cdna encoding cytosolic FPGS (red arrows); sfbp, soluble folate binding protein (FBP) (dark brown arrows); CAFBP, fusion between coding sequence of β- carbonic anhydrase 2 from Arabidopsis thaliana and sfbp (lilac arrows); GluB4FBP, fusion between rice glutelin B4 coding sequence and sfbp (yellow arrows).
4 Supplementary Figure 4 Rice polishing experiment Total folate levels in unpolished and polished seeds of GA9.15 (T4) and two lines engineered for a higher folate content and stability (T3). Upon harvest, seeds were stored at -80 C for 3 years. Values are means of four biological repeats; error bars indicate standard deviation. Dots represent the measured values. Abbreviations: A, aminodeoxychorismate synthase; CAFBP, fusion of β-carbonic anhydrase 2 from Arabidopsis thaliana with soluble synthetic folate binding protein (sfbp); ctf, cytosolic folylpolyglutamate synthetase (FPGS); G, GTP cyclohydrolase I; mtf, mitochondrial FPGS.
5 Supplementary Figure 5 Transgene expression Expression levels of GTPCHI, ADCS, FPGS and FBP transgenes in green rice seeds of all lines in the stability experiment (T3 and T4 generation) presented in Figure 2 (except line GA-mtF-CAFBP 2, due to loss of RNA during extraction). Expression analyses were performed by real-time quantitative PCR. Rice tumor protein homologue (LOC_Os11g ) and expressed protein (LOC_OS07g ) were used as reference genes for normalization. Values are means of a sample and two technical replicates; error bars indicate standard error. Abbreviations: A, aminodeoxychorismate synthase; CAFBP, fusion of β-carbonic anhydrase 2 from Arabidopsis thaliana with soluble synthetic folate binding protein (sfbp); ctf, cytosolic folylpolyglutamate synthetase (FPGS); G, GTP cyclohydrolase I; GluB4FBP, fusion of rice glutelin B4 with sfbp; mtf, mitochondrial FPGS. Line GA-ctF-CAFBP 1 had a high expression of FBP (panel e), in combination with a high GTPCHI (panel a) and ADCS transgene expression (panel b), contributing to a high and stable folate content (Figure 2).
6 Supplementary Figure 6 Folate mono/polyglutamate content Total folate levels in lines engineered for a higher folate content and stability (T3 and T4 generation), participating in the folate stability experiment (Fig. 2). Values are means of four biological repeats; error bars indicate standard deviation. Dots represent the measured values. The folate monoglutamate fraction is represented by green bars, the polyglutamate fraction by orange bars. Lines with an enhanced folate polyglutamylation (> 20%) and a high folate content (> 500 µg per 100 g FW) are indicated in bold. Abbreviations: A, aminodeoxychorismate synthase; CAFBP, fusion of β-carbonic anhydrase 2 from Arabidopsis thaliana with soluble synthetic folate binding protein (sfbp); ctf, cytosolic folylpolyglutamate synthetase (FPGS); G, GTP cyclohydrolase I; GluB4FBP, fusion of rice glutelin B4 with sfbp; mtf, mitochondrial FPGS; WT, wild type.
7 Supplementary Figure 7 GGH and FPGS expression Expression levels of endogenous rice gamma-glutamyl hydrolase (GGH) (panel A and B), mitochondrial (mtfpgs) (panel C) and cytosolic (ctfpgs) (panel D) FPGS transgenes in seeds of the sixth (T5) generation of lines engineered for a higher folate stability through polyglutamylation. Expression analyses were performed by real-time quantitative PCR. Rice tumor protein homologue (LOC_Os11g ) and expressed protein (LOC_OS07g ) were used as reference genes for normalization. Values are means of a sample and two technical replicates; error bars indicate standard error. Abbreviations: A, aminodeoxychorismate synthase; CAFBP, fusion of β-carbonic anhydrase 2 from Arabidopsis thaliana with soluble synthetic folate binding protein (sfbp); ctf, cytosolic folylpolyglutamate synthetase (FPGS); G, GTP cyclohydrolase I; GluB4FBP, fusion of rice glutelin B4 with sfbp; mtf, mitochondrial FPGS; WT,wild type.
8 Supplementary note Folate bioavailability in the second generation of folate biofortified rice Bioavailability and biological effectiveness were proven for the first generation prototypes of folate biofortified rice in a long-term study in rats 1. Since bioavailability of folate monoglutamates is higher than that of polyglutamates which need to be deconjugated in the gut mucosa, the folate glutamylation level should be balanced (as in the wild type) or in favor of monoglutamates 2, which is the case in second generation folate biofortified rice. Two major factors will influence folate bioavailability in second generation FBP-prototypes: the matrix effect and the effect of binding with FBP. The majority of folates accumulating in engineered rice is 5-methylTHF ( 2 and this study), which is the predominant folate form naturally occurring in food. FBP-folate binding studies in a dynamic in vitro gastrointestinal model performed on fortified whey suspensions showed that after gastric passage (acidic ph), only 5% of 5-methylTHF remained bound to FBP, and that 5-methylTHF mainly occurred as free folate in the duodenal lumen 3, which is the major site of dietary folate uptake in the digestive tract. Upon higher ph conditions in the lower parts of the intestine (jejunum and ileum), folates reformed a complex with FBP, which was suggested to lower folate bioavailability. However, another study demonstrated that after gastro-intestinal passage barely 1% of FBP in 5-methylTHF fortified milk was retained, indicating that the 5-methylTHF-FBP complex is largely unstable in the intestine 4. Interestingly, UHT sterilization destroys FBP and most folates occur as free folates in UHT milk, as opposed to pasteurized milk, where FBP is only partly destroyed 4. Therefore, it can be assumed that boiling of rice will release most of the folates from FBP. Future bioavailability studies will address this hypothesis and take into account the effect of the different FBP fusions on folate binding capacities. In addition, it will be interesting to compare bioavailability of different FPGS lines, whether or not in a ggh loss-of-function mutant background. Folate biofortification versus folic acid fortification of crop products Food fortification with synthetic folic acid is currently used to combat folate deficiency. However, there is a growing concern about this practice (for a detailed review, see 5 ). Fortification with 5-methylTHF has been suggested, since it has no tolerable upper level of intake and it would not mask vitamin B12 deficiency 6. An industrial co-fortification of folate and vitamin B12 has been proposed, since both vitamins are necessary in the conversion of homocysteine to methionine 7. However, only Archaea and bacteria are capable of synthesizing vitamin B12 de novo; hence, a transgenic approach to enhance vitamin B12 content in plants would imply a complete pathway engineering. Nonetheless, fortification interventions require specialized infrastructure, which is difficult to implement in poor rural areas. Therefore, the second generation folate rice is more suitable for implementation in the battle against folate deficiency, as a complementary strategy to diet diversification.
9 References 1. Kiekens, F. et al. Mol. Nutr. Food Res. 59, (2015). 2. Storozhenko, S. et al. Nat. Biotechnol. 25, (2007). 3. Verwei, M. et al. J.Nutr. 134, (2004). 4. Verwei, M. et al. J. Nutr. 133, (2003). 5. Blancquaert, D. et al. J. Exp. Bot. 65, (2014). 6. Obeid, R. et al. J. Perinat. Med. 41, (2013). 7. Selhub, J. & Paul, L. Biofactors 37, (2011).
10 Supplementary Table Primer Sequence Primer specifications STOSER 121 ATCGGCGTCTACAGCGCAGGCATCATA Cloning of rice glutelin B4 gene STOSER 122 TGGCGTGGCCAAAAGGTTCGGATCT Cloning of rice glutelin B4 gene STOSER 123 GATCAACCAGCCCAAGTTTCCAATAA Cloning of rice glutelin B4 cdna STOSER 124 CAGAACCGCCACAAAGTTTCACATACT Cloning of rice glutelin B4 cdna STOSER 125 GCGGCCGCCAATTATTTTGGACATTATGGAGAGAACA Cloning of rice glutelin B4 gene, removal of KpnI and addition of NotI restriction sites STOSER 126 GCGGCCGCATCTAGGAATTATGTGTTGAAAGGACTT Cloning of rice glutelin B4 gene, addition of NotI restriction site STOSER 127 TTTAGTCCCGGGTGCAACGGTTTAGATGAGAACTTCT Cloning of rice glutelin B4 CDS, addition of SmaI restriction site STOSER 128 TTTAATCCCGGGGTTGTTACCCGCCAATAAGAACTCC Cloning of rice glutelin B4 CDS, addition of SmaI restriction site STOSER 129 AGTCCCGGGTGATGTACTAATGAAATAGTATAGG Removal of rice glutelin B4 CDS, addition of SmaI restriction site STOSER 130 AATCCCGGGAGCTATTTGAGGATGTTATTGGAAA Removal of rice glutelin B4 CDS, addition of SmaI restriction site STOSER 131 GATATCATGGGAAACGAATCATATGAAGACGCCAT Cloning of Arabidopsis thaliana β- carbonic anhydrase 2 CDS, addition of EcoRV restriction site STOSER 132 GATATCTCATATAGAATGAACGGGGGAAATT Cloning of Arabidopsis thaliana β- carbonic anhydrase 2 CDS, addition of EcoRV restriction site CA beta 2 1 forward CCTGCTTCAGCCACTTCAAACTTGA Cloning of Arabidopsis thaliana β- carbonic anhydrase 2 cdna CA beta 2 1 reversed GGTAGCGATGGTGATGGTGATGTGT Cloning of Arabidopsis thaliana β- carbonic anhydrase 2 cdna mtfpgs forward gateway AAAAAGCAGGCTCCCTGATGCTCGTTTGTGGGAAAG Cloning of Arabidopsis thaliana mtfpgs CDS, addition of partial attb sites mtfpgs reversed gateway AGAAAGCTGGGTTCATCTCTTTAGCAACCTGA Cloning of Arabidopsis thaliana mtfpgs CDS, addition of partial attb sites ctfpgs forward gateway AAAAAGCAGGCTATCCTATGGCAACTGAAGACGATGGTGAA Cloning of Arabidopsis thaliana ctfpgs CDS, addition of partial attb sites ctfpgs reversed gateway AGAAAGCTGGGTTCATTTCTTGATAAATCTCA Cloning of Arabidopsis thaliana ctfpgs CDS, addition of partial attb sites attb1 GGGGACAAGTTTGTACAAAAAAGCAGGCT attb1 site for GATEWAY cloning attb2 GGGGACCACTTTGTACAAGAAAGCTGGGT attb2 site for GATEWAY cloning STOSER 154 ATTATCACCTGAAGTTGAC expression analysis GTPCHI STOSER 155 GTGTAGCAATGAGTTCTT expression analysis GTPCHI STOSER 156 TGATTGTTGACCTTCTAA expression analysis ADCS STOSER 157 ACTGTTGTGTATGATTCT expression analysis ADCS STOSER 162 TACATCAAGAACCTCTCC expression analysis rice tumor protein homologue (LOC_Os11g ), reference gene STOSER 163 ACCAACAAAGAACTGAAG expression analysis rice tumor protein homologue (LOC_Os11g ), reference gene STOSER 164 GAACATGGAGAAGAACAA expression analysis expressed protein (LOC_Os07g ), reference gene STOSER 165 CATATCTTGCACTGGATG expression analysis expressed protein (LOC_Os07g ), reference gene STOSER 180 AATGAAATCTGGTCTCACTCT expression analysis FBP STOSER 181 CGAACCACATCTGAATGC expression analysis FBP mtfpgs 3 F GGTCACTTCCAGTGCCGTAA expression analysis mtfpgs mtfpgs 3 R AGCAACCTGAGCACATCTCC expression analysis mtfpgs ctfpgs 2 F ACATTTGCGGAGTCTATTCTTCGTTG expression analysis ctfpgs ctfpgs 2 R TCAACAGCCACAGGAAGTGACGAGAA expression analysis ctfpgs GGH F CAGGGATTCCATTTCCACTTT expression analysis GGH (LOC_Os05g ) GGH R GTGGCACTGAATGACTCCAAGATA expression analysis GGH (LOC_Os05g ) Supplementary Table 1: List of primers used for cloning and for expression analysis by real-time quantitative PCR.
HarvestPlus Statement on the Potential Benefits of Biofortification on the Nutritional Status of Populations
HarvestPlus Statement on the Potential Benefits of Biofortification on the Nutritional Status of Populations Biofortification is an intervention strategy currently being researched and developed for increasing
More informationSupporting Information
Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement
More informationPotential use of High iron and low phytate GM rice and their Bio-safety Assessment
Potential use of High iron and low phytate GM rice and their Bio-safety Assessment Dr. Karabi Datta University of Calcutta, India Background High iron rice and iron bioavailability Micronutrient deficiency
More informationB. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.
Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1
More informationRice Mutation Breeding for Various Grain Qualities in Thailand
8. Thailand Rice Mutation Breeding for Various Grain Qualities in Thailand S. Taprab, W. Sukviwat, D. Chettanachit, S. Wongpiyachon and W. Rattanakarn Bureau of Rice Research and Development, Rice Department,
More informationCloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College
Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants
More informationFolic Acid and vitamin B12
Folic Acid and vitamin B12 ILOs: by the end of this lecture, you will be able to: 1. Understand that vitamins are crucial nutrients that are important to health. 2. Know that folic acid and vitamin B12
More informationFolic Acid. Ameer Saadallah Al-Zacko Ahmad Ausama Al-Kazzaz Ahmad Maan Al-Hajar
Folic Acid Ameer Saadallah Al-Zacko Ahmad Ausama Al-Kazzaz Ahmad Maan Al-Hajar Now with Ahmad Maan Al-Hajar Folic acid Folic acid is a water soluble Vitamin which has many forms include folate, vitamin
More informationTriple Burden of Malnutrition
Greatest Challenges of 21 st Century Food System Strategies for Preventing Micronutrient Malnutrition Dennis Miller, PhD Professor Department of Food Science Cornell University Providing a sustainable,
More informationSupplemental Data. Deinlein et al. Plant Cell. (2012) /tpc
µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant
More informationHarvestPlus Nutrition
HarvestPlus Nutrition Introduction and update Erick Boy Hyderabad (September 8, 2014) HarvestPlus c/o IFPRI 2033 K Street, NW Washington, DC 20006-1002 USA Tel: 202-862-5600 Fax: 202-467-4439 HarvestPlus@cgiar.org
More informationSupplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
More informationExtrafolate-S (6S)-5-Methyltetrahydrofolate Calcium Salt
Extrafolate-S (6S)-5-Methyltetrahydrofolate Calcium Salt Folate and the misleading concept The terms folic acid and folate are often erroneously used interchangeably for the water-soluble B-complex vitamin.
More informationMaximization of Vitamin A, Folic Acid, and Other Essential Micronutrient Utilization in the Body
Maximization of Vitamin A, Folic Acid, and Other Essential Micronutrient Utilization in the Body Michael I McBurney, PhD Twitter: @MIMcBurney IFT, Las Vegas, NV June 25, 2017 Utilization of Essential Nutrients
More informationTesting the ABC floral-organ identity model: expression of A and C function genes
Objectives: Testing the ABC floral-organ identity model: expression of A and C function genes To test the validity of the ABC model for floral organ identity we will: 1. Use the model to make predictions
More informationSignaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana
Biochemistry: Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana 38 CAMERON E. NIENABER ʻ04 Abstract Long recognized as essential plant nutrients and metabolites, inorganic and organic
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationExpression constructs
Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression
More informationA putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus
Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and
More informationBreeding for Nutritional Enhancement in Potato: Exploring Vitamin B9 diversity in Wild and Cultivated Potatoes.
Breeding for Nutritional Enhancement in Potato: Exploring Vitamin B9 diversity in Wild and Cultivated Potatoes. Bruce Reid Robinson II Department of Crop and Soil Sciences Hermiston Agricultural Research
More informationHIGHLIGHTING NUTRITIONAL SECURITY: A KEY COMPONENT OF FOOD SECURITY. Delia B. Rodriguez-Amaya
HIGHLIGHTING NUTRITIONAL SECURITY: A KEY COMPONENT OF FOOD SECURITY Delia B. Rodriguez-Amaya Food Security sufficient, safe and nutritious food for all The State of Food Insecurity in the World Food and
More informationAre seed proteins a problem or a boon?
Are seed proteins a problem or a boon?, Biochemist Department of AgriFood Molecular Sciences Faculty of Agriculture University of Milan, Italy Main sources Production Concluding remarks Seed proteins Protein
More informationby Micah Johnson, Michael Turner, Elena Poiata, Stephanie Vadasz, Nathan Yardley, and Maria Moreno
MCDB 201L: Molecular Biology Laboratory Professor: Maria Moreno By submitting this essay, I attest that it is my own work, completed in accordance with University regulations. Micah Johnson Abstract Cloning
More informationSupplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationSupplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
More informationImpact of FPGS and GGH SNPs on Plasma Folate and Homocysteine Levels in the Singapore Chinese Health Study
Impact of FPGS and GGH SNPs on Plasma Folate and Homocysteine Levels in the Singapore Chinese Health Study A THESIS SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Sarah
More informationSupplementary information
Supplementary information Supplementary Figure 1: Components of Arabidopsis tricarboxylic acid (TCA) cycle. Schematic summary of the TCA cycle and the enzymes related to the reactions. The large text and
More informationVITAMINS-FAT SOLUBLE [LIPPINCOTT S ] Deeba S. Jairajpuri
VITAMINS-FAT SOLUBLE [LIPPINCOTT S 381-394] Deeba S. Jairajpuri VITAMIN A othe term retinoids includes both natural and synthetic forms of vitamin A essential for vision, reproduction, growth and maintenance
More informationSelenium biofortification and human health. Gijs Du Laing
Selenium biofortification and human health Gijs Du Laing Selenium discovered in Sweden by Jöns Jacob Berzelius (1817) impurity contaminating sulfuric acid (H 2 SO 4 ) sulphur analogue semiconductor used
More informationFolate Polyglutamylation is Required for Rice Seed Development
Rice (21) 3:181 193 DOI 1.17/s12284-1-94- Folate Polyglutamylation is Required for Rice Seed Development Nampeung Anukul & Riza Abilgos Ramos & Payam Mehrshahi & Anahi Santoyo Castelazo & Helen Parker
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationTyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
More informationSupplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
More informationGenetic engineering and functional foods
Genetic engineering and functional foods Symposium ALIMENTOS GENETICAMENTE MODIFICADOS 25 de Maio de 2006 São Paulo, Brasil Ralf Greiner Federal Research Centre for Nutrition and Food, Centre for Molecular
More informationZinc Deficiency-Inducible OsZIP8 Encodes a Plasma Membrane-Localized Zinc Transporter in Rice
Mol. Cells 29, 551-558, June 30, 2010 DOI/10.1007/s10059-010-0069-0 Molecules and Cells 2010 KSMCB Zinc Deficiency-Inducible OsZIP8 Encodes a Plasma Membrane-Localized Zinc Transporter in Rice Sichul Lee
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationEXCELLENCE IN YEAST EXCELLENT FOR FISH REAL BREWERS YEAST
EXCELLENCE IN YEAST EXCELLENT FOR FISH Made in Germany REAL BREWERS YEAST Leiber specialized brewers yeast products are recommended for: Fish Crustaceans Leiber Excellence in Yeast Leiber GmbH has been
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our
More informationBiofortification: from discovery to impact
Biofortification: from discovery to impact From assessment to solutions Erick Boy HarvestPlus / IFPRI-CIAT e.boy@cgiar.org Outline Biofortification in a nutshell The nutrition research plan Update on results
More informationMetabolic engineering of micronutrients in crop plants
Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES Issue: Staple Crops Biofortified with Vitamins and Minerals REVIEW ARTICLE Metabolic engineering of micronutrients in crop
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationAligning the food system to meet dietary needs: fruits and vegetables
Aligning the food system to meet dietary needs: fruits and vegetables Introduction to Session 1 Kathryn G. Dewey, PhD Distinguished Professor, Dept of Nutrition Director, Program in International & Community
More informationAddressing Myths and Misconceptions about Rice Fortification
188 ADDRESSING MYTHS AND MISCONCEPTIONS ABOUT RICE FORTIFICATION Addressing Myths and Misconceptions about Rice Fortification Helena Pachón Food Fortification Initiative, USA Cecilia Fabrizio, Jennifer
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationGeneral information. 1. Iron homeostasis
1. Iron homeostasis General information Iron homeostasis (1) is defined as the correct balance of iron in the body. The balance of iron is associated with a physiological ratio of iron between tissues
More informationTargeted Levels of Minerals in Plant Foods: biofortification & post harvest fortification
Targeted Levels of Minerals in Plant Foods: biofortification & post harvest fortification Erick Boy Workshop: Improving the composition of plant foods for better mineral nutrition June 4, 2012 ETH Zurich,
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationβ-carotene (trans or cis isomer)
β-carotene (trans or cis isomer) Overview Natural beta-carotene contains a mixture of different isomers (cis and trans) of the betacarotene molecule. Synthetically produced beta-carotene is nature identical.
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationNAME KEY ID # EXAM 3a BIOC 460. Wednesday April 10, Please include your name and ID# on each page. Limit your answers to the space provided!
EXAM 3a BIOC 460 Wednesday April 10, 2002 Please include your name and ID# on each page. Limit your answers to the space provided! 1 1. (5 pts.) Define the term energy charge: Energy charge refers to the
More informationJosie Grace C. Castillo, M.D.
Josie Grace C. Castillo, M.D. 2 types of nutrients Macronutrients Carbohydrate Fats Protein Micronutrients Vitamins Minerals 1 Occur when the quantity or quality of food is not sufficient to meet a persons
More informationProblem Set #5 4/3/ Spring 02
Question 1 Chloroplasts contain six compartments outer membrane, intermembrane space, inner membrane, stroma, thylakoid membrane, and thylakoid lumen each of which is populated by specific sets of proteins.
More informationLECTURE-3 VITAMINS DR PAWAN TOSHNIWAL ASSISTANT PROFESSOR BIOCHEMISTRY ZYDUS MEDICAL COLLEGE AND HOSPITAL, DAHOD, GUJARAT DATE
LECTURE-3 VITAMINS DR PAWAN TOSHNIWAL ASSISTANT PROFESSOR BIOCHEMISTRY ZYDUS MEDICAL COLLEGE AND HOSPITAL, DAHOD, GUJARAT DATE-20-12-2018 FOLATE or FOLIC ACID FOLATE Other names Folic acid Folacin Pteroylglutamic
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationConcerns, myths and misconceptions of rice fortification
Concerns, myths and misconceptions of rice fortification Helena Pachón Senior Nutrition Scientist Food Fortification Initiative helena.pachon@emory.edu Is rice fortification safe? EAR RDA / RNI UL EAR:
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationPhysiological Role: B-vitamins are coenzymes of many enzymes systems of body metabolism. Thiamine {B 1 }
Food Constituents [continued] Micronutrients B-Vitamins The B group of vitamin {water soluble} includes: Thiamine: vitamin B 1, ant beriberi vitamin. Riboflavin: vitamin B 2. Niacin: nicotinic acid, PP
More informationEVERYDAY CLINICAL APPLICATION OF TELOMERE AND AGING SUPPORT PRESENTED BY: Fred Pescatore, MD, MPH, CCN
EVERYDAY CLINICAL APPLICATION OF TELOMERE AND AGING SUPPORT PRESENTED BY: Fred Pescatore, MD, MPH, CCN Financial Disclosure: Consultant to DaVinci Labs AGENDA Overview of the following: Methylation Telomere
More informationImpact Of Folate Depletion On Expression Of Folate Metabolizing Enzymes
Wayne State University Wayne State University Theses 1-1-2013 Impact Of Folate Depletion On Expression Of Folate Metabolizing Enzymes Yizhen Wu Wayne State University, Follow this and additional works
More information17 Cell Differentiation and Gene Expression In m ost h u m a n cells, the nucleus contains a full set of 23 pairs of chromosomes,
17 Cell Differentiation and Gene Expression In m ost h u m a n cells, the nucleus contains a full set of 23 pairs of chromosomes, which carry 20,000 25,000 genes. These genes are identical from cell to
More informationNutrition Essentials Improving your PKU diet through balanced nutrition
Nutrition Essentials Improving your PKU diet through balanced nutrition Sharon L Ernst, MPH, RD, CSP, FAND Associate Professor Chief Metabolic Dietitian Division of Medical Genetics Department of Pediatrics
More informationNutritional Improvement of Food Crops
Nutritional Improvement of Food Crops Gerard Barry International Rice Research Institute, The Philippines IMPROVING FOOD PLANT DEVELOPMENT FOR BETTER FOODS Organized by the International Food Biotechnology
More informationChapter. The Micronutrients: Vitamins and Minerals. Images shutterstock.com
Chapter 13 The Micronutrients: Vitamins and Minerals Images shutterstock.com Objectives Differentiate between fat-soluble vitamins and water-soluble vitamins. List functions and sources of major minerals
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationSystematic review of factors influencing zinc bioavailability
Systematic review of factors influencing zinc bioavailability Dr Nicola M Lowe International Institute of Nutritional Sciences and Food Safety Studies University of Central Lancashire. COST: Modifying
More informationLivestock and Fisheries. Actions Sub-actions Evidence Category *
ANNEX 1 FOOD, AGRICULTURE AND HEALTH DIETS: SUMMARY LIST OF ACTIONS AND SUB-ACTIONS Livestock and Fisheries Evidence Category * 1. Animal husbandry, fisheries and insect farming 1a. Extensive animal rearing
More informationViral vaccines. Lec. 3 أ.د.فائزة عبد هللا مخلص
Lec. 3 أ.د.فائزة عبد هللا مخلص Viral vaccines 0bjectives 1-Define active immunity. 2-Describe the methods used for the preparation of attenuated live & killed virus vaccines. 3- Comparison of Characteristics
More informationNutrition and Energy 1
Nutrition and Energy 1 Food Energy The ingestion of food serves two primary functions: 1. it provides a source of energy 2. it provides raw materials the animal is unable to manufacture for itself. 2 Basal
More informationMicronutrient bio-fortification and disease resistance in Banana
Micronutrient bio-fortification and disease resistance in Banana A Unique Initiative of Public Sector Research for Public Good a. Vegetatively propagated genetically complex crops like banana are difficult
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationCOURSE: Medical Microbiology, MBIM 650/720 - Fall TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12
COURSE: Medical Microbiology, MBIM 650/720 - Fall 2008 TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12 FACULTY: Dr. Mayer Office: Bldg. #1, Rm B32 Phone: 733-3281 Email: MAYER@MED.SC.EDU
More informationNature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
More informationEffects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
More informationSupplementary Figure 1
Supplementary Figure 1 Isolation of mt-trnas and RNA-MS analysis of mt-trna Asn from M. nudus (a)m. nudus mt-trnas were isolated by RCC and resolved by 10% denaturing PAGE. The gel was stained with SYBR
More informationSupplementary Figures
Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis
More informationOverview of Evidence for Impact of Flour Fortification with Folic Acid
Overview of Evidence for Impact of Flour Fortification with Folic Acid Helene McNulty PhD RD Northern Ireland Centre for Food and Health (NICHE) University of Ulster Impact of Flour Fortification with
More informationRELATIVE CONTRIBUTION OF FOOD FOLATE AND FOLIC ACID TO INTAKE AND STATUS OF YOUNG MEN AND WOMEN
RELATIVE CONTRIBUTION OF FOOD FOLATE AND FOLIC ACID TO INTAKE AND STATUS OF YOUNG MEN AND WOMEN By MELANIE LYN GRABIANOWSKI A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL
More informationOverview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System
Overview of the Expressway Cell-Free Expression Systems The Expressway Cell-Free Expression Systems use an efficient coupled transcription and translation reaction to produce up to milligram quantities
More informationDr. Juan Carlos Rodriguez-Lecompte FINAL REPORT. January 14, 2011
Dried distiller grains with soluble (DDGS) in poultry diets and manure phosphorus content - implications for feeding strategies to decrease phosphorus loading Dr. Juan Carlos Rodriguez-Lecompte FINAL REPORT
More informationNutritional Megaloblastic Anemias DR. NABIL BASHIR HLS, 2018
Nutritional Megaloblastic Anemias DR. NABIL BASHIR HLS, 2018 Definition: Macrocytic Anemia MCV>100fL Impaired DNA formation due to lack of: B12 or folate in ultimately active form use of antimetabolite
More informationreads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express
Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced
More informationNature Inspired Solutions for Improving Quality and Safety of Food
Nature Inspired Solutions for Improving Quality and Safety of Food N. Nitin Departments of Food Science and Technology And Biological and Agricultural Engineering University of California-Davis Key Challenges
More informationVITAMIN BASICS VITAMIN WHAT IT DOES TOO LITTLE TOO MUCH SOURCES. Night blindness Total blindness Reduced resistance to infection Can lead to death
VITAMIN BASICS VITAMIN WHAT IT DOES TOO LITTLE TOO MUCH SOURCES Fat-Soluble Vitamin A Maintains vision Maintains epithelial tissues (skin) Develops immune cells Bone growth Night blindness Total blindness
More informationThe antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
More informationCultavit - Nature in a capsule.
Cultavit - Nature in a capsule www.eurochem.de Introduction The Cultavit process is inseparably bound to the region in which it was developed: The Austrian county of Burgenland. The inventor, Ing. Ulrich
More informationCell wall components:
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. The Cell Wall The primary cell wall is capable of rapid expansion during
More informationMain differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure.
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Animal cells have a lysosome (related to vacuole) and centrioles (function
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationEffect of fructooligosaccharide fortification on quality characteristic of some fruit juice beverages (apple &orange juice)
International Journal of Farming and Allied Sciences Available online at www.ijfas.com 2014 IJFAS Journal-2014-3-2/141-146/ 28 February, 2014 ISSN 2322-4134 2014 IJFAS Effect of fructooligosaccharide fortification
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationRama Nada. -Ensherah Mokheemer. 1 P a g e
- 3 - Rama Nada -Ensherah Mokheemer - 1 P a g e Don t forget to refer to page index wherever you see * Quick revision: In the previous lecture we said that: - your body contains 4-5g of iron (4g in females
More informationsirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome
Qi et al. 26-3-2564C Qi et al., Figure S1 sirna count per 5 kb small RNAs matching the direct strand sirna count per 5 kb small RNAs matching the complementary strand Repeat length (bp) per 5 kb repeats
More informationCell Differentiation and Gene Expression
17 Cell Differentiation and Gene Expression I cells, the nucleus contains a full set of 23 pairs of chromosomes, which carry 20,000 25,000 genes. These genes are identical from cell to cell. In Activity
More information3.1.1 Water Soluble Vitamins
3.1.1 Water Soluble Vitamins Overview of Vitamins essential for good health organic molecules individual units regulate body processes micronutrients solubility fat or water Water Soluble Vitamins B-complex;
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationThe Citric Acid Cycle 19-1
The Citric Acid Cycle 19-1 The Citric Acid Cycle Three processes play central role in aerobic metabolism the citric acid cycle electron transport oxidative phosphorylation Metabolism consists of catabolism:
More information