Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds

Transcription

1 Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds (30d) of NTBC withdrawal were stained with anti-fah antibody (A) or H&E (B). Healthy donor-derived cells are less vacuolated, stain positively for Fah and more glycogen granules causing a darker pigmentation after H&E staining. Magnification: 125x. Supplementary Figure 2 Ontology-based distribution of gene categories between -enriched and depleted populations of untreated or DDC-treated mouse liver. The most relevant gene categories observed to be differentially expressed in pairwise comparisons are indicated, as are the numbers of probes used for GO and Kegg analyses.

2 Gene Identity 5' primer 3' primer CK19/KRT19 Cytokeratin 19 GGACCCTCCCGAGATTACAACCA GCCAGCTCCTCCTTCAGGCTCT CFTR Cystic Fibrosis TCTCAGCCTTCTGTGGCCTTGG TCCGGGTCATTTTCAGCTCCAC Transmembrane Receptor CAII Carbonic anhydrase II ACCGGATGGATTGGCTGTTTTG AAGTTAGCAAAGGCCGCACGCT DPPIV/CD26 Dipeptidyl peptidase IV GGCCCTGCGTGCTACTTCCTGGCTCG ACGTCCTGCGCGGCTGCTCTGC Alb Albumin GCAGATGACAGGGCGGAACTTG AAAATCAGCAGCAATGGCAGGC HNF4a Hepatocyte nuclear factor 4a CGGGCTGGCATGAAGAAGGAAG TGGGAGAGGTGATCTGCTGGGA TAT Tyrosine aminotransferase CGTGGTCAACAACCCGTCCAAT ATTGCCTTTCAGCCACTGCCAA Des Desmin GAGAAACCAGCCCCGAGCAAAG AGCCTCGCTGACAACCTCTCCA SOX9 Sry-family homeobox 9 TGCCCATGCCCGTGCGCGTCAA CGCTCCGCCTCCTCCACGAAGGGTCT FOXJ1 Forkhead box J1 CCGCCATGCAGACCCCACCTGGCA AGGCCCCACTGAGCAGGCGCTCT GAPDH GAPDH AAGGTCGGTGTGAACGGATTTGG CGTTGAATTTGCCGTGAGTGGAG Actb Beta actin TTCTTTGCAGCTCCTTCGTT ATGGAGGGGAATACAGCCC Supplementary Table 1 qrt-pcr primers. Except where noted (asterisks), each amplicon spans a >2kb intron. Where possible, one primer lies on an intron-exon boundary to further minimize amplification of contaminating genomic DNA. Cycle threshold values were recorded as baseline corrected curve-fitted values and reported as normalized values relative to housekeeping gene GAPDH.

3 Dorrell et al. A murine liver Page 3 Elevated in fraction Category Term Count % P-Value Benjamini FDR KEGG_PATHWAY Complement and coagulation cascades E E E-17 KEGG_PATHWAY Drug metabolism E E E-13 KEGG_PATHWAY Metabolism of xenobiotics by cytochrome P E E E-08 KEGG_PATHWAY Retinol metabolism E E E-08 KEGG_PATHWAY Tryptophan metabolism E E E-04 KEGG_PATHWAY Drug metabolism E E E-03 KEGG_PATHWAY Fatty acid metabolism E E E-03 KEGG_PATHWAY Primary bile acid biosynthesis E E E-03 KEGG_PATHWAY Glycine, serine and threonine metabolism E E E-03 KEGG_PATHWAY Arginine and proline metabolism E E E-03 KEGG_PATHWAY Ascorbate and aldarate metabolism E E E-02 KEGG_PATHWAY Steroid hormone biosynthesis E E E-02 KEGG_PATHWAY Histidine metabolism E E E-02 KEGG_PATHWAY Valine, leucine and isoleucine degradation E E E-02 Reduced in fraction KEGG_PATHWAY Pathways in cancer E E E-07 KEGG_PATHWAY Tight junction E E E-06 KEGG_PATHWAY MAPK signaling pathway E E E-05 KEGG_PATHWAY Focal adhesion E E E-04 KEGG_PATHWAY Adherens junction E E E-04 KEGG_PATHWAY Arrhythmogenic right ventricular E E E-02 cardiomyopathy (ARVC) KEGG_PATHWAY Colorectal cancer E E E-02 KEGG_PATHWAY Hypertrophic cardiomyopathy (HCM) E E E-01 KEGG_PATHWAY Prostate cancer E E E-01 Supplementary Table 2 Gene ontology comparisons in untreated tissue: Progenitor-enriched vs. depleted.

4 Dorrell et al. A murine liver Page 4 Elevated in fraction Category Term Count % P-Value Benjamini FDR KEGG_PATHWAY Drug metabolism E E E-26 KEGG_PATHWAY Metabolism of xenobiotics by E E E-19 cytochrome P450 KEGG_PATHWAY Retinol metabolism E E E-18 KEGG_PATHWAY Complement and coagulation E E E-18 cascades KEGG_PATHWAY Tryptophan metabolism E E E-06 KEGG_PATHWAY Drug metabolism E E E-05 KEGG_PATHWAY Steroid hormone biosynthesis E E E-05 KEGG_PATHWAY Primary bile acid biosynthesis E E E-05 KEGG_PATHWAY Glycine, serine and threonine E E E-05 metabolism KEGG_PATHWAY PPAR signaling pathway E E E-04 KEGG_PATHWAY ECM-receptor interaction E E E-03 KEGG_PATHWAY Starch and sucrose metabolism E E E-03 KEGG_PATHWAY Linoleic acid metabolism E E E-03 KEGG_PATHWAY Valine, leucine and isoleucine E E E-03 degradation KEGG_PATHWAY Pentose and glucuronate E E E-02 interconversions KEGG_PATHWAY Arginine and proline metabolism E E E-02 KEGG_PATHWAY Arachidonic acid metabolism E E E-01 GOTERM_MF_FAT electron carrier activity E E E-17 GOTERM_MF_FAT heme binding E E E-16 GOTERM_MF_FAT tetrapyrrole binding E E E-15 GOTERM_MF_FAT oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, E E E-14

5 Dorrell et al. A murine liver Page 5 reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen GOTERM_MF_FAT iron ion binding E E E-14 GOTERM_MF_FAT aromatase activity E E E-12 GOTERM_MF_FAT vitamin binding E E E-10 GOTERM_MF_FAT cofactor binding E E E-10 GOTERM_MF_FAT carbohydrate binding E E E-09 GOTERM_MF_FAT pattern binding E E E-08 GOTERM_MF_FAT polysaccharide binding E E E-08 GOTERM_MF_FAT glycosaminoglycan binding E E E-07 GOTERM_MF_FAT vitamin B6 binding E E E-07 GOTERM_MF_FAT pyridoxal phosphate binding E E E-07 GOTERM_MF_FAT extracellular matrix structural E E E-04 constituent GOTERM_MF_FAT endopeptidase inhibitor activity E E E-04 GOTERM_MF_FAT peptidase inhibitor activity E E E-04 GOTERM_MF_FAT heparin binding E E E-04 GOTERM_MF_FAT enzyme inhibitor activity E E E-04 GOTERM_MF_FAT growth factor binding E E E-04 GOTERM_MF_FAT platelet-derived growth factor binding E E E-03 GOTERM_MF_FAT serine-type endopeptidase inhibitor E E E-03 activity GOTERM_MF_FAT coenzyme binding E E E-02 GOTERM_MF_FAT transferase activity, transferring E E E-02 nitrogenous groups GOTERM_MF_FAT 3',5'-cyclic-nucleotide E E E-02 phosphodiesterase activity GOTERM_MF_FAT cyclic-nucleotide phosphodiesterase activity E E E-02

6 Dorrell et al. A murine liver Page 6 GOTERM_BP_FAT oxidation reduction E E E-33 GOTERM_BP_FAT response to wounding E E E-19 GOTERM_BP_FAT acute inflammatory response E E E-13 GOTERM_BP_FAT blood coagulation E E E-12 GOTERM_BP_FAT coagulation E E E-12 GOTERM_BP_FAT hemostasis E E E-12 GOTERM_BP_FAT inflammatory response E E E-11 GOTERM_BP_FAT organic acid catabolic process E E E-11 GOTERM_BP_FAT carboxylic acid catabolic process E E E-11 GOTERM_BP_FAT defense response E E E-10 GOTERM_BP_FAT blood vessel development E E E-10 GOTERM_BP_FAT vasculature development E E E-09 GOTERM_BP_FAT steroid metabolic process E E E-09 GOTERM_BP_FAT regulation of body fluid levels E E E-09 GOTERM_BP_FAT wound healing E E E-09 GOTERM_BP_FAT cell adhesion E E E-08 GOTERM_BP_FAT biological adhesion E E E-08 GOTERM_BP_FAT activation of plasma proteins involved E E E-07 in acute inflammatory response GOTERM_BP_FAT complement activation E E E-07 GOTERM_BP_FAT immune response E E E-07 GOTERM_BP_FAT protein maturation by peptide bond E E E-07 cleavage GOTERM_BP_FAT cellular amino acid catabolic process E E E-06 GOTERM_BP_FAT blood vessel morphogenesis E E E-06 GOTERM_BP_FAT lipid transport E E E-06 GOTERM_BP_FAT complement activation, classical E E E-06 pathway GOTERM_BP_FAT organic ether metabolic process E E E-05 GOTERM_BP_FAT vitamin metabolic process E E E-05

7 Dorrell et al. A murine liver Page 7 GOTERM_BP_FAT cofactor metabolic process E E E-05 GOTERM_BP_FAT regulation of coagulation E E E-05 GOTERM_BP_FAT amine catabolic process E E E-05 GOTERM_BP_FAT neutral lipid metabolic process E E E-05 GOTERM_BP_FAT heterocycle catabolic process E E E-05 GOTERM_BP_FAT protein processing E E E-05 GOTERM_BP_FAT lipid localization E E E-05 GOTERM_BP_FAT acylglycerol metabolic process E E E-05 GOTERM_BP_FAT fatty acid metabolic process E E E-05 GOTERM_BP_FAT acute-phase response E E E-05 GOTERM_BP_FAT humoral immune response E E E-04 GOTERM_BP_FAT humoral immune response mediated E E E-04 by circulating immunoglobulin GOTERM_BP_FAT angiogenesis E E E-04 GOTERM_BP_FAT extracellular matrix organization E E E-04 GOTERM_BP_FAT glycerol ether metabolic process E E E-04 GOTERM_BP_FAT triglyceride metabolic process E E E-04 GOTERM_BP_FAT protein maturation E E E-04 GOTERM_BP_FAT response to endogenous stimulus E E E-04 GOTERM_BP_FAT positive regulation of response to E E E-04 stimulus GOTERM_BP_FAT response to hormone stimulus E E E-04 GOTERM_BP_FAT cholesterol metabolic process E E E-04 GOTERM_BP_FAT response to extracellular stimulus E E E-04 GOTERM_BP_FAT B cell mediated immunity E E E-04 GOTERM_BP_FAT fat-soluble vitamin metabolic process E E E-04 GOTERM_BP_FAT regulation of blood coagulation E E E-04 GOTERM_BP_FAT positive regulation of immune system E E E-04 process GOTERM_BP_FAT extracellular structure organization E E E-04

8 Dorrell et al. A murine liver Page 8 GOTERM_BP_FAT regulation of response to external E E E-04 stimulus GOTERM_BP_FAT activation of immune response E E E-03 GOTERM_BP_FAT aromatic compound catabolic process E E E-03 GOTERM_BP_FAT immune effector process E E E-03 GOTERM_BP_FAT immunoglobulin mediated immune E E E-03 response GOTERM_BP_FAT cellular amino acid derivative E E E-03 metabolic process GOTERM_BP_FAT positive regulation of immune E E E-03 response GOTERM_BP_FAT sterol metabolic process E E E-03 GOTERM_BP_FAT cellular amide metabolic process E E E-03 GOTERM_BP_FAT amine biosynthetic process E E E-03 GOTERM_BP_FAT secondary metabolic process E E E-03 GOTERM_BP_FAT coenzyme metabolic process E E E-03 GOTERM_BP_FAT lymphocyte mediated immunity E E E-03 GOTERM_BP_FAT vascular endothelial growth factor E E E-02 receptor signaling pathway GOTERM_BP_FAT regulation of locomotion E E E-02 GOTERM_BP_FAT adaptive immune response based on E E E-02 somatic recombination of immune receptors built from immunoglobulin superfamily domains GOTERM_BP_FAT adaptive immune response E E E-02 GOTERM_BP_FAT response to corticosteroid stimulus E E E-02 GOTERM_BP_FAT regulation of cell migration E E E-02 GOTERM_BP_FAT response to glucocorticoid stimulus E E E-02 GOTERM_BP_FAT regulation of cell motion E E E-02 GOTERM_BP_FAT sulfur metabolic process E E E-02 GOTERM_BP_FAT chemotaxis E E E-02

9 Dorrell et al. A murine liver Page 9 GOTERM_BP_FAT taxis E E E-02 GOTERM_BP_FAT cell-substrate adhesion E E E-02 GOTERM_BP_FAT cellular hormone metabolic process E E E-02 GOTERM_BP_FAT blood circulation E E E-02 GOTERM_BP_FAT circulatory system process E E E-02 GOTERM_BP_FAT carboxylic acid biosynthetic process E E E-02 GOTERM_BP_FAT organic acid biosynthetic process E E E-02 GOTERM_BP_FAT collagen fibril organization E E E-02 GOTERM_BP_FAT innate immune response E E E-02 GOTERM_BP_FAT response to nutrient levels E E E-02 GOTERM_BP_FAT response to cytokine stimulus E E E-02 GOTERM_BP_FAT response to peptide hormone stimulus E E E-02 GOTERM_BP_FAT cellular amino acid biosynthetic process E E E-01 Reduced in fraction Category Term Count % P-Value Benjamini FDR KEGG_PATHWAY Tight junction E E E-04 KEGG_PATHWAY Pathways in cancer E E E-02 GOTERM_MF_FAT ATP binding E E E-03 GOTERM_MF_FAT adenyl ribonucleotide binding E E E-03 GOTERM_MF_FAT ion binding E E E-03 GOTERM_MF_FAT calcium ion binding E E E-02 GOTERM_MF_FAT protein tyrosine kinase activity E E E-02 GOTERM_MF_FAT adenyl nucleotide binding E E E-02 GOTERM_MF_FAT cytoskeletal protein binding E E E-02 GOTERM_MF_FAT nucleoside binding E E E-02 GOTERM_MF_FAT purine nucleoside binding E E E-02 GOTERM_MF_FAT protein kinase activity E E E-02

10 Dorrell et al. A murine liver Page 10 GOTERM_MF_FAT cation binding E E E-02 GOTERM_MF_FAT nucleotide binding E E E-02 GOTERM_MF_FAT actin binding E E E-02 GOTERM_MF_FAT metal ion binding E E E-02 GOTERM_BP_FAT epithelium development E E E-10 GOTERM_BP_FAT cilium assembly E E E-06 GOTERM_BP_FAT cell projection assembly E E E-06 GOTERM_BP_FAT cilium morphogenesis E E E-05 GOTERM_BP_FAT tissue morphogenesis E E E-04 GOTERM_BP_FAT tube development E E E-04 GOTERM_BP_FAT morphogenesis of an epithelium E E E-04 GOTERM_BP_FAT cell projection organization E E E-04 GOTERM_BP_FAT tube morphogenesis E E E-03 GOTERM_BP_FAT negative regulation of cell E E E-03 proliferation GOTERM_BP_FAT cell adhesion E E E-03 GOTERM_BP_FAT biological adhesion E E E-03 GOTERM_BP_FAT urogenital system development E E E-03 GOTERM_BP_FAT kidney development E E E-02 GOTERM_BP_FAT epithelial cell differentiation E E E-02 GOTERM_BP_FAT positive regulation of transcription E E E-02 GOTERM_BP_FAT embryonic development ending in E E E-02 birth or egg hatching GOTERM_BP_FAT cell morphogenesis E E E-02 GOTERM_BP_FAT neural tube development E E E-02 GOTERM_BP_FAT cell-cell adhesion E E E-02 GOTERM_BP_FAT regulation of transcription from RNA E E E-02 polymerase II promoter GOTERM_BP_FAT chordate embryonic development E E E-02

11 Dorrell et al. A murine liver Page 11 GOTERM_BP_FAT cell projection morphogenesis E E E-01 GOTERM_BP_FAT phosphorus metabolic process E E E-01 GOTERM_BP_FAT phosphate metabolic process E E E-01 GOTERM_BP_FAT cytoskeleton organization E E E-01 Supplementary Table 3 Gene ontology comparisons in DDC-treated tissue: Progenitor-enriched vs. depleted.

12 Dorrell et al. A murine liver Page 12 Higher in DDC fraction relative to untreated population Category Term Count % P-Value Benjamini FDR KEGG_PATHWAY Systemic lupus erythematosus E E E-03 GOTERM_MF_FAT ATP binding E E E-02 GOTERM_MF_FAT microtubule motor activity E E E-02 GOTERM_MF_FAT adenyl ribonucleotide binding E E E-02 GOTERM_MF_FAT adenyl nucleotide binding E E E-02 GOTERM_MF_FAT purine nucleoside binding E E E-02 GOTERM_MF_FAT nucleoside binding E E E-02 GOTERM_BP_FAT M phase of mitotic cell cycle E E E-16 GOTERM_BP_FAT cell cycle E E E-16 GOTERM_BP_FAT cell division E E E-15 GOTERM_BP_FAT M phase E E E-15 GOTERM_BP_FAT cell cycle process E E E-15 GOTERM_BP_FAT mitosis E E E-14 GOTERM_BP_FAT nuclear division E E E-14 GOTERM_BP_FAT cell cycle phase E E E-14 GOTERM_BP_FAT organelle fission E E E-14 GOTERM_BP_FAT mitotic cell cycle E E E-13 GOTERM_BP_FAT DNA packaging E E E-10 GOTERM_BP_FAT chromatin assembly E E E-08 GOTERM_BP_FAT protein-dna complex assembly E E E-08 GOTERM_BP_FAT nucleosome assembly E E E-07 GOTERM_BP_FAT nucleosome organization E E E-07 GOTERM_BP_FAT chromatin assembly or disassembly E E E-07 GOTERM_BP_FAT chromosome segregation E E E-06 GOTERM_BP_FAT chromosome organization E E E-05

13 Dorrell et al. A murine liver Page 13 GOTERM_BP_FAT cellular macromolecular complex E E E-03 assembly GOTERM_BP_FAT DNA metabolic process E E E-03 GOTERM_BP_FAT cellular macromolecular complex E E E-03 subunit organization GOTERM_BP_FAT macromolecular complex assembly E E E-02 GOTERM_BP_FAT macromolecular complex subunit E E E-02 organization GOTERM_BP_FAT chromatin organization E E E-02 GOTERM_BP_FAT microtubule-based process E E E-01 Lower in DDC fraction relative to untreated progentitor population GOTERM_MF_FAT zinc ion binding E E E-08 GOTERM_MF_FAT transition metal ion binding E E E-06 GOTERM_MF_FAT ion binding E E E-06 GOTERM_MF_FAT metal ion binding E E E-06 GOTERM_MF_FAT cation binding E E E-05 GOTERM_MF_FAT DNA binding E E E-01 GOTERM_BP_FAT regulation of transcription E E E-10 GOTERM_BP_FAT transcription E E E-07 GOTERM_BP_FAT regulation of RNA metabolic E E E-04 process GOTERM_BP_FAT regulation of transcription, DNAdependent E E E-04 Supplementary Table 4 Gene ontology comparisons in Progenitor-enriched fractions: DDC-treated vs. untreated.