Supplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing
|
|
|
- Madlyn Mills
- 5 years ago
- Views:
Transcription
1 Supplementary Table 1. Information on the 174 single nucleotide s identified by whole-exome sequencing Chr Position Type AF exomes Database A/G UBE4B missense Damaging C/G PUM1 missense Damaging C/T GJA9 missense dbsnp Damaging G/A TOE1 missense Damaging C/T C1orf175 missense Damaging G/A GBP5 nonsense NA alignment NA A/G BCAR3 missense Damaging C/T NBPF9 nonsense NA alignment NA C/T ARHGEF11 missense Damaging C/A ARHGEF11 missense Damaging T/A ABL2 missense dbsnp Damaging G/A PLXNA2 missense Damaging C/A PLXNA2 missense dbsnp Damaging G/C KCNH1 missense Damaging G/T ZNF124 nonsense dbsnp 7 NA alignment NA G/T NBAS missense Damaging G/A NBAS missense Damaging G/A HS1BP3 missense dbsnp Damaging T/G SUPT7L missense Damaging C/T SLC4A1AP missense Genomes Damaging C/T ASB3 missense Damaging T/C ASB3 missense Damaging C/T PLEK missense Damaging T/C APLF missense Damaging C/T LOXL3 missense Genomes Damaging G/A SEMA4F missense Damaging G/T POLR1A nonsense Genomes 11 NA alignment NA Artifact of of
2 Chr Position Type AF exomes Database of C/T TBC1D8 missense Damaging t A/T ZC3H6 missense damaging G/A GALNT5 missense A/G DNAH7 missense Genomes 7 of t damaging Damaging G/T XRCC5 missense dbsnp 5 benign Damaging A/T CHL1 missense Damaging G/T ANO10 nonsense NA alignment NA C/T ZNF501 missense Genomes alignment G/A EXOSC7 missense Damaging C/T LTF splice NA alignment NA G/T PTH1R missense Genomes alignment T/C KIF9 missense Genomes Damaging G/A UBA7 missense Damaging T/A PCBP4 missense Damaging G/A TMF1 missense Genomes Damaging T/A VGLL3 missense Genomes Damaging C/T KIAA1407 missense Damaging C/T PIK3R4 missense Damaging G/A HRASLS splice Genomes 10 NA alignment NA G/A NCAPG,LCORL missense Damaging C/G PTPN13 missense Damaging A/G ALPK1 missense dbsnp Damaging t G/A ALPK1 missense dbsnp 11 benign damaging T/C ALPK1 missense Genomes Damaging A/G INPP4B missense dbsnp Damaging
3 Chr Position Type AF exomes Database of of alignment NA G/A DDX60L nonsense NA A/G C6 splice Genomes 11 NA alignment NA T/G DHX29 missense Damaging C/T HEXB missense Damaging G/A IQGAP2 missense Damaging C/G EDIL3 missense Damaging G/T CDO1 missense Damaging C/T ALDH7A1 missense Genomes Damaging ANKHD1,ANKHD G/T EIF4EBP3 missense Damaging G/T KIAA0141 nonsense NA alignment NA WRNIP1, A/G LOC missense Genomes 12 benign Damaging G/C KIF13A missense Genomes Damaging T/G KIF13A missense Damaging G/A CDKAL1 missense Damaging C/T DOM3Z,STK19 missense alignment T/C PBX2 missense Damaging C/A BTNL2 missense Genomes Damaging t C/T BTNL2 missense Genomes damaging C/T MAPK13 missense dbsnp Damaging alignment NA T/C SESN1 nonsense NA CTGF, T/C LOC missense Damaging C/T FNDC1 missense dbsnp Damaging C/G RADIL,PAPOLB missense Genomes alignment NA G/A VWDE nonsense NA alignment NA HOXA5, A/T LOC missense Damaging
4 Chr Position Type AF exomes Database of T/C GLI3 missense dbsnp Damaging C/A C7orf69,PKD1L1 splice NA of alignment NA T/C DTX2 missense Damaging G/C DMTF1 missense Genomes Damaging C/T GATAD1 missense Genomes Damaging A/G SAMD9L missense Genomes Damaging G/A CALCR missense alignment NA T/C TECPR1 missense Damaging A/C FOXP2 missense Damaging Artifact C/T NAT1 nonsense dbsnp 11 NA alignment NA C/T ANK1 missense Damaging A/G SULF1 missense Genomes Damaging T/C RAD54B missense Damaging A/C KIF24 missense dbsnp t damaging alignment NA G/T ALAD nonsense NA C/A RABEPK missense Genomes Damaging C/T ZNF438 missense Damaging G/C KIF5B missense Damaging t C/T PARD3 missense damaging G/A ASAH2 nonsense Genomes 15 NA alignment NA G/A ANK3 missense Damaging G/T ANK3 nonsense NA alignment NA Artifact T/C CASP7 missense Damaging A/G FANK1 missense dbsnp Damaging T/C INPP5A missense Damaging G/A LRDD missense dbsnp Damaging G/C TM7SF2 missense Damaging
5 Type exomes Chr Position AF Database C/T SLC25A45 missense Genomes Damaging G/A SCYL1 missense Damaging G/A FOXM1 missense dbsnp 8 of of Damaging G/A MLL2 missense Genomes Damaging G/C ITGA7 missense Damaging G/A RASAL1 missense Damaging G/T RPLP0 nonsense NA alignment NA Artifact C/T WDR66 missense Damaging G/A SFRS8 missense Damaging C/T OLFM4 nonsense Genomes 17 NA alignment NA A/G DIS3 nonsense NA alignment NA C/T MYCBP2 missense Genomes Damaging G/A TEP1 missense Damaging C/T TEP1 missense Damaging A/G WDHD1 missense Genomes Damaging T/C KTN1 missense Genomes t damaging T/C MUDENG missense Damaging t C/T ZWILCH missense damaging C/G MYO9A missense alignment G/A CHRNB4 missense dbsnp Damaging G/C ANPEP missense Damaging G/A IGF1R missense dbsnp Damaging G/A PKD1 missense Damaging C/G BTBD12 missense Damaging t T/C MKL2 missense Genomes 4, 10 benign damaging G/A XYLT1 missense dbsnp Damaging
6 Chr Position Type AF exomes Database of A/C PALB2 missense dbsnp Damaging G/A FBXL19 missense dbsnp 9 of Damaging C/A NKD1 missense Damaging G/A WWOX missense Damaging C/A DPEP1 nonsense NA alignment NA C/T ARRB2 missense Damaging C/T WDR16 missense dbsnp Damaging A/T FLII missense Damaging C/T SGK494 splice NA alignment NA G/A NEK8 missense Damaging G/A TRAF4 missense Genomes Damaging A/G AFMID splice NA alignment NA A/G LAMA1 missense Damaging C/T DSG4 missense dbsnp Damaging G/A ASXL3 missense alignment NA G/A SLC39A6 missense Damaging C/A ZNF554 nonsense NA alignment NA G/C XAB2 missense Damaging G/T CCDC130 missense Damaging G/A CASP14 missense Damaging C/A LSR nonsense NA alignment NA C/A PRODH2 splice NA alignment NA C/G AKT2 missense Damaging C/T GEMIN7 nonsense NA alignment NA A/T DHDH missense Damaging
7 Chr Position Type AF exomes Database A/T TRPM4 nonsense NA alignment NA C/T PNKP missense dbsnp Damaging G/A MYBPC2 missense Genomes Damaging C/T ZNF320 missense alignment t C/T LILRA3 missense damaging C/G LILRA3 splice dbsnp 9 NA alignment NA C/A C20orf26 missense Genomes alignment NA C/T DNMT3B missense dbsnp Damaging C/T ZHX3 missense Damaging C/T TUBB1 nonsense NA alignment NA G/T PRMT2 splice NA alignment NA C/T ASPHD2 missense Damaging G/C RNF215 missense Damaging C/G C22orf30 missense dbsnp t damaging C/A C22orf30 missense Damaging A/G EP300 missense Damaging C/A EFCAB6 missense , Damaging G/A C22orf9 nonsense NA alignment G/A SAPS2 missense Damaging of of
Supplementary Figures. Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated. for each lesion type.
Supplementary Figures Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated for each lesion type. a b Supplementary Figure 2. Non-negative matrix factorization-derived
Novel Insights into Breast Cancer Genetic Variance through RNA Sequencing
Insights into Breast Cancer Genetic Variance through RNA Sequencing SUPPLEMENTARY DATA Anelia Horvath, 1,2* Suresh Babu Pakala, 2* Prakriti Mudvari, 1* Sirigiri Divijendra Natha Reddy, 2 Kazufumi Ohshiro,
Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT
GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes
BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
Supplemental Table 1. List of genes and mature shrna sequences identified from the shrna screen in BRCA2-mutant PEO1 cells.
Guillemette_Supplemental Table 1 Gene Mature Sequence Gene Mature Sequence ATTCATAGGATGTCAGCAG LOC157193 TATGCGTAAGTAATAAATTGCT TTAGTTCTGTCTTGGAGG LOC152225 CGCATATATGTTCTGACTT ALDH2 CACTTCAGTGTATGCCT
devseek (Sequence(Analysis(Panel(for(Neurodevelopmental(Disorders
ACSL4 Mental/retardation,/XBlinked/63 XLBR ADSL Adenylosuccinase/Deficiency AR AFF2 Mental/retardation,/XBlinked,/FRAXE/type XLBR ALG6 Congenital/disorder/of/glycosylation/type/Ic AR ANK3 Mental/retardation,/autosomal/recessive/37
CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE
CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous
Supplementary Material. Table S1. Summary of mapping results
Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598
Integrative Radiation Biology
Dr. Kristian Unger Integrative Biology Group Research Unit of Radiation Cytogenetics Department of Radiation Sciences Helmholtz-Zentrum München 1 Key Questions Molecular mechanisms of radiation-induced
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10860 Supplementary Discussion It remains unclear why H3K9 demethylation appeared to be more sensitive to suppression than at least some other histone methylation marks as a result of
Identification of 12 novel loci that confer susceptibility to early-onset dyslipidemia
INTERNATIONAL JOURNAL OF MOlecular medicine 43: 57-82, 2019 Identification of 12 novel loci that confer susceptibility to early-onset dyslipidemia YOSHIJI YAMADA 1,2, KIMIHIKO KATO 1,3, MITSUTOSHI OGURI
Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits.
Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits. All With Fst in the With long With SNP(s) at the 5' top 5% bracket haplotypes regulatory region
Supplementary Methods
Supplementary Methods Short Read Preprocessing Reads are preprocessed differently according to how they will be used: detection of the variant in the tumor, discovery of an artifact in the normal or for
Supplementary Information to
Supplementary Information to Exome sequencing to identify de novo mutations in sporadic ALS trios Alessandra Chesi 1,11, Brett T. Staahl 2, Ana Jovicic 1, Julien Couthouis 1, Maria Fasolino 3, Alya R.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature12912 Figure S1. Distribution of mutation rates and spectra across 4,742 tumor-normal (TN) pairs from 21 tumor types, as in Figure 1 from Lawrence et al. Nature
IPATIMUP Translational Research Unit Matching IPATIMUP s Expertise with Company s Research/Clinical Strategy
IPATIMUP Translational Research Unit Matching IPATIMUP s Expertise with Company s Research/Clinical Strategy Innovative Projects Questions & Needs André Albergaria INDUSTRY Pharma R&D Clinical Research
Quantitative Real Time PCR (RT-qPCR) Differentiation of human preadipocytes to adipocytes
Quantitative Real Time PCR (RT-qPCR) First strand cdna was synthesized and RT-qPCR was performed using RT2 first strand kits (Cat#330401) and RT2 qpcr Master Mix (SABioscience, Frederick, MD). Experiments
CilioPathy panel. 3-Jul-2018 (102 genen) Centrum voor Medische Genetica Gent. versie. OMIM gene ID
versie 3-Jul-2018 (102 genen) CilioPathy panel Centrum voor Medische Genetica Gent Gene OMIM gene ID Associated phenotype, OMIM phenotype ID, phenotype mapping key and inheritance pattern AHI1 608894 Joubert
Supplemental Tables and Figures
Supplemental Tables and Figures Post-zygotic de novo changes in glutamate and dopamine pathways may explain discordance of monozygotic twins for schizophrenia Castellani, CA., Melka, MG., Gui, JL., Gallo,
Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease
Cronicon OPEN ACCESS EC DIABETES AND METABOLIC RESEARCH Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease Amr TM Saeb* University Diabetes Center, College
SUPPLEMENTAL MATERIAL ADDITIONAL TABLES
SUPPLEMENTAL MATERIAL ADDITIONAL TABLES Table S1. List of distinct rare variants detected by high-throughput sequencing in our cohort. The number of patients with each variant and the reference for the
Supplementary Table 1. Annotated candidate SNV and indels in melanoma tumors. Patient C1 Patient C2 Patient C3 Patient C4 Patient C5 Patient C6 Patient C7 Patient C10 Chr Position Reference Allele Sample
Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues
Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing
p.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure
a Missense ATG p.arg119gly p.arg119his p.ala179thr p.ala189val p.gly206trp p.gly206arg p.arg251his p.ala257thr TGA 5 UTR 1 2 3 4 5 6 7 3 UTR Splice Site, Frameshift b Mutation p.gly206trp p.gly4fsx50 c.138+1g>a
Reporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
RNA sequencing of cancer reveals novel splicing alterations
RNA sequencing of cancer reveals novel splicing alterations Jeyanthy Eswaran, Anelia Horvath, Sucheta Godbole, Sirigiri Divijendra Reddy, Prakriti Mudvari, Kazufumi Ohshiro, Dinesh Cyanam, Sujit Nair,
MSI positive MSI negative
Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden
Supplementary Information
Supplementary Information Index of Supplementary Materials Supplementary Figure. Distribution of methylation levels, characteristics of cis-meqtls and association plots for meqtls in methylation-related
Supplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Ahlqvist E, Storm P, Käräjämäki A, et al. Novel
Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2.
Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2. mir D HF VS CTR ND HF VS CTR D HF VS ND HF FOLD CHANGE p FOLD CHANGE p FOLD CHANGE
Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer
Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer risk in stage 1 (red) and after removing any SNPs within
Targeted Genes and Methodology Details for Epilepsy/Seizure Genetic Panels
Targeted s and Methodology Details for Epilepsy/Seizure tic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Epilepsy/Seizure tic Panels Epilepsy Expanded Panel Epilepsy Expanded
Influence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia
Supplementary Information For: Influence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia Aroon T. Chande 1,2,3, Jessica Rowell
Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP
Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP Frequency Domain Mammals a 3 S/P b Mammals a 3 S/P b
Supplementary Online Content
Supplementary Online Content Lyall DM, Celis-Morales C, Ward J, et al. Association of body mass index with cardiometabolic disease in the UK Biobank: a mendelian randomization study. JAMA Cardiol. Published
Allele specific FKBP5 DNA demethylation: a molecular mediator of gene childhood
Allele specific FKBP5 DNA demethylation: a molecular mediator of gene childhood trauma interactions Torsten Klengel 1, Divya Mehta 1, Christoph Anacker 2, Monika Rex Haffner 1, Jens C. Pruessner 3, Carmine
Myeloproliferative neoplasms: recent advances in pathogenesis
Myeloproliferative neoplasms: recent advances in pathogenesis Andy Chase University of Southampton and Wessex Regional Genetics Laboratory Salisbury, UK Uppsala 2010 Myeloproliferative neoplasms MDS/MN
Supplementary Figure 1: Classification scheme for non-synonymous and nonsense germline MC1R variants. The common variants with previously established
Supplementary Figure 1: Classification scheme for nonsynonymous and nonsense germline MC1R variants. The common variants with previously established classifications 1 3 are shown. The effect of novel missense
Supplementary Material
Supplementary Material for Recessive LAMC3 mutations cause malformations of occipital cortical development Tanyeri Barak 1,2,3, #, Kenneth Y. Kwan 2,4, #, Angeliki Louvi 1,2, Veysi Demirbilek 5, Serap
Inactivating mutations of the chromatin remodeling gene ARID2 in hepatocellular carcinoma
Supplementary information Inactivating mutations of the chromatin remodeling gene ARID2 in hepatocellular carcinoma Meng Li 1,8, Hong Zhao 2,8, Xiaosong Zhang 3, Laura D. Wood 4, Robert A. Anders 4, Michael
Moyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic
Supplementary Information for Moyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic signals in endothelial cells Kazuhiro Ohkubo 1,, Yasunari Sakai 1,*,, Hirosuke Inoue 1, Satoshi
SUPPLEMENTARY INFORMATION
doi:10.1038/nature13898 Supplementary Information Table 1 Kras mutation status of carcinogen-induced mouse lung adenomas Tumour Treatment Strain Grade Genotype Kras status (WES)* Kras status (Sanger) 32T1
Table S5: List of 152 differentially expressed genes in anti-gal-1 versus scramble JJN3
Table S5: List of 152 differentially expressed genes in anti-gal-1 versus scramble JJN3 comparison specific after re-oxygenation process. Gene.symbol Variation Gene Name FOS -1.049641012 v-fos FBJ murine
Supplementary Figure 1. Microarray data mining and validation
Supplementary Figure 1. Microarray data mining and validation Microarray (>47,000 probes) Raw data Background subtraction NanoString (124 genes) Set cut-off and threshold values Raw data Normalized to
Lions and Tigers and Bears.Oh My!
Lions and Tigers and Bears.Oh My! TAKING THE FEAR OUT OF GENETIC TESTING Lisa Butterfield, MS, CGC Genetic Counselor Clinical Assistant Professor University of Kansas Health System Why is Genetic Testing
Pushing%PET%Imaging%to%the% Cellular%Level:%Development%of%a% Radioluminescence%Microscope%
Stanford University School of Medicine Department of Radiation Oncology Division of Radiation Physics Pushing%PET%Imaging%to%the% Cellular%Level:%Development%of%a% Radioluminescence%Microscope%! Guillem!Pratx,!PhD!
Utilization of the MiSeq in a clinical lab. Tony Krentz, PhD PreventionGenetics
Utilization of the MiSeq in a clinical lab Tony Krentz, PhD PreventionGenetics PreventionGenetics Founded in 2004 in Marshfield, Wisconsin by James Weber ~90 employees Largest test menu in US Vision: Disease
Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK
Supplemental legends Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK Table SП. List of genes in cluster 1 identified using two-dimensional hierarchical clustering analysis Table SШ.
Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency
Supplementary Figure 1 Missense damaging predictions as a function of allele frequency Percentage of missense variants classified as damaging by eight different classifiers and a classifier consisting
Concurrent Practical Session ACMG Classification
Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim
Supplementary Information
Supplementary Information Exome Sequencing Identifies Somatic Mutations of DNA Methyltransferase Gene DNMT3A in Acute Monocytic Leukemia Xiao-Jing Yan*, Jie Xu*, Zhao-Hui Gu*, Chun-Ming Pan*, Gang Lu*,
Epilepsie & ernstige mentale retardatie: (nieuwe) genen en genotype-fenotype correlatie
Epilepsie & ernstige mentale retardatie: (nieuwe) genen en genotype-fenotype correlatie dr. Hannah Stamberger prof. dr. Peter De Jonghe Neurogenetics group, DMG, VIB http://www.molgen.vib-ua.be Disclosures
Genomic Service List
Document ID: MBG-C009 Effective Date: 10 Jan 018 Page: 1 of 5 WHOLE GENOME SEQUENCING Human Whole Genome Sequencing 1 HGG-15 Human Whole Genome Sequencing HGG-157 (FASTQ data only) WHOLE EXOME SEQUENCING
Illumina s Cancer Research Portfolio and Dedicated Workflows
Illumina s Cancer Research Portfolio and Dedicated Workflows Michael Sohn Clinical Sales Specialist Spain&Italy 2017 2017 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish,
A A B B. 6ss. Cont MO. ZFoxJ1 MO. n=296. n=247
A A C E 6ss B B D Cont MO ZFoxJ1 MO Supplementary Figure 1: ZFoxJ1 RNA expression and function in ciliated cells of Zebrafish embryos. (A-B) At the 6ss stage (A,A ), ZFoxJ1 RNA is expressed prominently
Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing
GA N 668353 H2020 Research and Innovation Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing WP N and Title: WP2 - Towards shared European Guidelines for PGx Lead beneficiary:
Phenotype Report. Num. Positions Not Called (Missing data) Num. Variants Assessed
Report Date: August 19, 2015 Software Annotation Version: 8 Report Name: NA12144 NW European Genome : NA12144_S1 Sequencing Provider: Illumina Sequencing Type: Exome : Retinitis Pigmentosa Description:
Sample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60%
Supplemental Table 1: Estimated tumor purity, allele frequency, and independent read depth for all gene mutations classified as either potentially pathogenic or VUS in the metatastic and primary tumor
ChIP-seq Identification of Weakly Conserved Heart Enhancers
ChIP-seq Identification of Weakly Conserved Heart Enhancers Matthew J. Blow, David J. McCulley, Zirong Li, Tao Zhang, Jennifer A. Akiyama, Amy Holt, Ingrid Plajzer-Frick, Malak Shoukry, Crystal Wright,
Supporting Information
Supporting Information Rampal et al. 10.1073/pnas.1407792111 Fig. S1. Genetic events in leukemic transformation of chronic-phase MPNs. (A) Survival of post-mpn AML patients according to mutational status
A genome-wide association study identifies vitiligo
A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples
modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
한국지질동맥경화학회, 부산 BEXCO, 2010 년 4 월 16 일
한국지질동맥경화학회, 부산 BEXCO, 2010 년 4 월 16 일 Dietary intake of folate, vitamin B2, vitamin B6, vitamin B12, genetic polymorphism of related enzymes, and risk of breast cancer: a case-control study in Korea KIM
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations Kouichi Ozaki 1, Hiroshi Sato 2, Katsumi Inoue 3, Tatsuhiko Tsunoda 4, Yasuhiko
Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population
Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population Tao Wang #, Xiaojing Ma #, Danfeng Peng, Rong Zhang, Xue Sun, Miao Chen, Jing Yan, Shiyun
Nature Biotechnology: doi: /nbt # m
Supplementary Figure 1. Cell seeding in microwells. Cells were stained with SYBR green and visualized under a microscope. Arrows point to single cells (green). Each image is a different position within
Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each
Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each mutated gene and the panel of 125 cancer-driving genes
Mapping by recurrence and modelling the mutation rate
Mapping by recurrence and modelling the mutation rate Shamil Sunyaev Broad Institute of M.I.T. and Harvard Current knowledge is from Comparative genomics Experimental systems: yeast reporter assays Potential
What Do We Know About Individual Variability and Its
What Do We Know About Individual Variability and Its Contribution to Disease? Nathaniel Rothman, MD, MPH, MHS Occupational and Environmental Epidemiology Branch, Division of Cancer Epidemiology and Genetics,
Supplemental Figures/Tables. Methylation forward GTCGGGGCGTATTTAGTTC. Methylation reverse AACGACGTAAACGAAAATATCG
Supplemental Figures/Tables Supplementary Tables Table S1. Primer sequences MSP Primers SPARC2 Unmethylation forward TTTTTTAGATTGTTTGGAGAGTG Unmethylation reverse AACTAACAACATAAACAAAAATATC Methylation
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12439 Supplementary Table 1. Coriell IDs for all exome sequenced 264 infantile spasms (IS) and Lennox- Gastaut syndrome (LGS) trios. Coriell ID Trio ID Proband
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
MathIOmica: Dynamic Transcriptome
Printed from the Complete Wolfram Language Documentation 1 MathIOmica: Dynamic Transcriptome Loading the MathIOmica Package Classification, Clustering and Visualization of Transcriptome Time eries Importing
Supplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
Supplementary Figure 1: Number and pattern of somatic mutations in 30 LCBs. (a) Number of mutations. RK308, which had a deletion in MLH1 gene and
Supplementary Figure 1: Number and pattern of somatic mutations in 30 LCBs. (a) Number of mutations. RK308, which had a deletion in MLH1 gene and missense mutation in MSH2 gene, had exceptionally large
Dravet Syndrome: What Warrants Further Testing
Dravet Syndrome: What Warrants Further Testing or SCN1A in the Modern Era and SCN1A-negative Dravet syndrome Annapurna Poduri, MD, MPH Director, Epilepsy Genetics Program Division of Epilepsy & Clinical
b 0.50 Synonymous Subtype
omatic mutation count Mutations per Mb a 80 * b 0.50 ynonymous 60 0.40 Non-synonymous 40 0.30 0.20 20 0.10 c 0 Fibroadenoma Phyllodes 0.00 ubtype Benign Borderline MAL upplementary Figure 1 Landscape of
Supplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
DYSREGULATION OF WT1 (-KTS) IS ASSOCIATED WITH THE KIDNEY-SPECIFIC EFFECTS OF THE LMX1B R246Q MUTATION
DYSREGULATION OF WT1 (-KTS) IS ASSOCIATED WITH THE KIDNEY-SPECIFIC EFFECTS OF THE LMX1B R246Q MUTATION Gentzon Hall 1,2#, Brandon Lane 1,3#, Megan Chryst-Ladd 1,3, Guanghong Wu 1,3, Jen-Jar Lin 4, XueJun
New network topology approaches reveal differential correlation patterns in breast cancer
Bockmayr et al. BMC Systems Biology 2013, 7:78 RESECH TICLE Open Access New network topology approaches reveal differential correlation patterns in breast cancer Michael Bockmayr 1, Frederick Klauschen
Whole Exome Sequenced Characteristics
Supplementary Tables Supplementary Table 1: Patient characteristics of 45 whole exome sequenced HNSCC tumors Whole Exome Sequenced Characteristics Tumors (n=45) Age, years Median (range) 61.0 (19-90) Sex,
TP53 mutational profile in CLL : A retrospective study of the FILO group.
TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :
Clinical utility of the functional mrna evaluation of rare genetic variants in diagnostic practice
Clinical utility of the functional mrna evaluation of rare genetic variants in diagnostic practice Celia Duff-Farrier: STP MSc project 2017 Funding provided by the Showering Fund mrna functional evaluation
Supplementary Information. PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small
Sato T, et al. Supplementary Information PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small cell lung cancer Teruyuki Sato 1,2, Atsushi Kaneda 1,3,4 *, Shingo Tsuji
Genome Summary. Sequencing Coverage: Variation Counts: Known Phenotype Summary: 131 disease or trait variations are found in this genome
Report Date: August 2, 215 Software Annotation Version: 8 Genome Summary Name: Greg Mendel Genome ID: genome_greg_mendel_dad Sequencing Provider: 23andMe Sequencing Type: Genotyping SNP Array Sequencing
Inferring the Mammalian Cardiogenic Gene Regulatory Network. Jason Bazil 10/18/13 Cardiac Physiome Workshop 2013
Inferring the Mammalian Cardiogenic Gene Regulatory Network Jason Bazil 1/18/13 Cardiac Physiome Workshop 213 Reverse Engineering Gene Regulatory Networks Two main questions need addressed: 1) What s connected
Subject ID: Date Test Started: Specimen Type: Peripheral Blood Date of Report: Date Specimen Obtained:
TEST PERFORMED Whole exome sequencing (WES) with Focused Diagnostic Panel(s): Neuropathy, Leukodystrophy, Myopathy See below for a complete list of genes analyzed. RESULTS 1 sequence variant with potential
Supplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
Exons from 137 genes were targeted for hybrid selection and massively parallel sequencing.
SUPPLEMENTARY TABLES Supplementary Table 1. Targeted Genes ABL1 ABL2 AKT1 AKT2 AKT3 ALK APC ATM AURKA BCL2 BRAF BRCA1 BRCA2 CCND1 CCNE1 CDC73 CDH1 CDK4 CDK6 CDK8 CDKN1A CDKN2A CEBPA CHEK1 CHEK2 CREBBP
SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.
SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang
Supplementary Information
Supplementary Information Table S1. Donor and sample information for blood samples used in the microarray and gene expression studies. Sample ID Age (Years) Diagnosis Smoking Classification DNA Methylation
6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels
Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA
Variant Detection & Interpretation in a diagnostic context. Christian Gilissen
Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant
Supplementary Table S1. Histopathologic findings for multi-region analysis.
SUPPLEMENTARY INFORMATION SUPPLEMENTARY TABLES Supplementary Table S1. Histopathologic findings for multi-region analysis. Patient Histology R1: clear cell RCC, Fuhrman 2-3, acinar pattern 1 R2: clear
UNIVERSITY OF TORINO DEPARTMENT OF ONCOLOGY. Giorgio V. Scagliotti University of Torino Dipartment of Oncology
Giorgio V. Scagliotti University of Torino Dipartment of Oncology giorgio.scagliotti@unito.it Molecular landscape of MM not fully characterized to allow personalized treatment Recurrent genetic alterations
PALB2 c g>c is. VARIANT OF UNCERTAIN SIGNIFICANCE (VUS) CGI s summary of the available evidence is in Appendices A-C.
Consultation sponsor (may not be the patient): First LastName [Patient identity withheld] Date received by CGI: 2 Sept 2017 Variant Fact Checker Report ID: 0000001.5 Date Variant Fact Checker issued: 12
Molecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s
ROMA, 23 GIUGNO 2011 Molecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s USSD Lab Genetica Medica Ospedali Riuniti Bergamo The problem What does the clinician/patient want to know?? Diagnosis,
SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation
SUPPLEMENTARY INFORMATION Rare independent mutations in renal salt handling genes contribute to blood pressure variation Weizhen Ji, Jia Nee Foo, Brian J. O Roak, Hongyu Zhao, Martin G. Larson, David B.
WT-TP53 DLBCL WT-TP53 GCB-DLBCL
SUPPLEMENTAL TABLES AND FIGURES Supplemental Table S1. Summary of gene expression profiling analysis results listing counts of significant differentially expressed transcripts between defined two groups