Jie Luo, 1 Feiruo Huang, 1 Chenglin Xiao, 1 Zhengfeng Fang, 1 Jian Peng, 1 and Siwen Jiang Introduction
|
|
- Mavis Jackson
- 5 years ago
- Views:
Transcription
1 BioMed Reserch Interntionl Volume 2013, Article ID , 9 pges Reserch Article Responses of Growth Performnce nd Proinflmmtory Cytokines Expression to Fish Oil Supplementtion in Lcttion Sows nd/or Wened Piglets Diets Jie Luo, 1 Feiruo Hung, 1 Chenglin Xio, 1 Zhengfeng Fng, 1 Jin Peng, 1 nd Siwen Jing 2 1 Deprtment of Animl Nutrition nd Feed Science, College of Animl Science nd Technology, Huzhong Agriculturl University, Wuhn , Chin 2 Key Lortory of Swine Breeding nd Genetics of Agriculturl Ministry, College of Animl Science nd Technology, Huzhong Agriculturl University, Wuhn , Chin Correspondence should e ddressed to Jin Peng; pengjin@mil.hzu.edu.cn nd Siwen Jing; jingsiwen@mil.hzu.edu.cn Received 15 My 2013; Revised 9 July 2013; Accepted 27 July 2013 Acdemic Editor: Krsten H. Weylndt Copyright 2013 Jie Luo et l. This is n open ccess rticle distriuted under the Cretive Commons Attriution License, which permits unrestricted use, distriution, nd reproduction in ny medium, provided the originl work is properly cited. The study ws conducted to investigte whether dietry fish oil could influence growth of piglets vi regulting the expression of proinflmmtory cytokines. A split-plot experimentl design ws used with sow diet effect in the min plots nd differing piglet diet effect in the suplot. The results showed tht suckling piglets from fish oil fed dms grew rpidly (P < 0.05) thncontrol.it ws lso oserved tht these piglets hd higher ADG, feed intke, nd finl ody weight (P < 0.05) during postwening thn those piglets from lrd fed dms. Furthermore, there ws significnt decrese (P < 0.01) in the expression of interleukin 6 nd tumor necrosis fctor-α in longissimus dorsi muscle. In contrst, there ws tendency (P < 0.10) towrds lower ADG nd higher feed : gin in wened piglets receiving fish oil compred with those receiving lrd. Menwhile, splenic proinflmmtory cytokines expression ws incresed (P < 0.01) in piglets receiving fish oil during postwening period. The results suggested tht 7% fish oil ddition to sows diets llevited inflmmtory response vi decresing the proinflmmtory cytokines expression in skeletl muscle nd ccelerted piglet growth. However, 7% fish oil ddition to wened piglets diets might decrese piglet growth vi incresing splenic proinflmmtory cytokines expression. 1. Introduction The growth rte of piglet is most rpid during the erly postntl stge, nd it is very importnt to the susequent growth, finl ody weight, nd mrketing time of pigs. Mny reserches reveled tht fish oil could ffect young piglets growth [1 5]. It ws reported tht 3 5% of fish oil ddition to sows diets ws eneficil to suckling piglet growth [1, 5]. However, lcttion sow diet supplemented with 8 10% fish oil incresed piglets prewening moridity nd decresed sows milk production nd litter weight gin [2, 6]. Dietry supplementtion with 2 3% fish oil promoted wened piglets growth [3], wheres ody weight nd feed intke of wened piglets fed 5% or more fish oil were lower versus corn oil [4]. Previous studies hve demonstrted tht proinflmmtory cytokines could increse muscle protein degrdtion, reduce muscle protein synthesis, divert nutrients to the synthesis of components in the immune system, nd suppress niml growth [7 9]. Fish oil hs nti-inflmmtory nd immunomodultory effect. Studies in niml models nd in humn sujects generlly reported decresed production of proinflmmtory cytokines in immune cell in peripherl lood nd spleen fter fish oil supplementtion [10 12], nd the nti-inflmmtory effect hs lso een shown for suckling piglets of fish oil fed sows [13]. Further study reveled tht the immunomodultory effect ws cused y the (n-3) polyunsturted ftty cids ((n-3) PUFA), especilly, eicospentenoic cid (EPA, C20:5 (n-3)) nd docoshexenoic cid (DHA, C22:6 (n-3)) in the fish oil [14]. Remrkly, (n-3) PUFA could decrese the proinflmmtory cytokines (interleukin 1 (IL-1), IL-6, nd tumor necrosis fctor-α (TNF-α)) expression nd secretion in peripherl immune cells nd
2 2 BioMed Reserch Interntionl Tle 1: Ingredients nd composition of sow nd piglet diets (%). Ingredient Sow diet Piglet diet Sow diet Piglet diet Nutrients C T C T C T C T Corn DE (Mcl/kg) Whet rn Crude protein Dried whey Clcium Lrd oil Totl phosphorus Fish oil Aville phosphorus Fish mel Lys Soyen mel Met + Cys Sodium chloride Clcium cronte Diclcium phosphte L-Lysine HCl Methionine Vitmin minerl premix The control diet contins 70 g/kg lrd oil nd test group diet contins 70 g/kg fish oil; 500 mg/kg ethoxyquin ws dded to oil s nti-oxidtive. 2 Provided following per kg of diet. Cu: 5 mg; Fe: 80 mg; Zn: 50 mg; Mn: 20 mg; I: 0.14 mg; Se: 0.15 mg; V A : 2,000 IU; V D3 :200IU;V E :44IU;V k3 :0.5mg;V B1 : 1mg;V B2 :3.75mg;V B12 : mg; iotin: 0.2 mg; folic cid: 1.3 mg; nicin: 10 mg; pntothenic cid: 12 mg. 3 Providedfollowingperkgofdiet.Cu:6mg;Fe:100mg;Zn:100mg;Mn:4mg;I:0.14mg;Se:0.3mg;V A : 11,000 IU; V D3 :1,100IU;V E :44IU;V k3 :0.5mg; V B1 :1mg;V B2 :3.5mg;V B6 : 1.5 mg; iotin: 0.05 mg; folic cid: 0.3 mg; nicin: 15 mg; pntothenic cid: 10 mg. 4 By clcultion. suppress nimls inflmmtory response [5, 11, 15]. (n-3) PUFA could ttenute the growth inhiition effect y reducing the production of proinflmmtory cytokines in severl species [4, 16, 17]. Our previous study found tht intke of n-3 PUFA leds to significnt decreses in the expressions of proinflmmtory cytokine genes in loin muscle nd spleen, which my stimulte growth in growing-finishing rrows [18]. However, severl studies hve shown tht high level of fish oil (30% or more) supplementtion in mice diet incresed TNF-α production in splenocytes [19, 20]. In the present study, we hypothesized tht the inconsistent performnce of piglets tht ingested different levels of fish oil mentioned efore ws due to the different response of proinflmmtory cytokines expression to (n-3) PUFA supplementtion. Thus, piglets receiving lrd directly from the postwening diet or indirectly from the lcttion sows diets were used s the control. The im of the present study ws to investigte the effect of dietry supplementtion of 7% fish oil in lcttion sows nd/or wened piglets diets on growth performnce of piglets nd expression of proinflmmtory cytokines including IL- 1β,IL-6,nd TNF-α in skeletl muscle nd spleen. 2. Mterils nd Methods 2.1. Animls nd Diets. This tril ws crried out in ccordnce with Huzhong Agriculturl University Animl Cre nd Use Committee guidelines. A split-plot experimentl design ws used with sow diet effect (L) in the min plots nd differing piglet diet effect (PW) in the suplot. Lndrce lrge white sows (n = 20)t10deforeprturitionwere ssigned to 1 of 2 groups mtched for prity nd ody weight. The test group (T) received diet supplemented with 7% fish oil, while control group (C) received n isoenergetic, isonitrogenous, nd isolipidic diet with 7% lrd oil. Fish oil nd lrd were purchsed from Chin Ntionl Cerels, Oils & Foodstuffs Corp. (COFCO Limited). The oil nd ft were for food or feed-qulity grde. And 500 mg/kg ethoxyquin ws dded to fish oil nd lrd s ntioxidtive. The two diets were formulted to meet NRC requirements of nutrient stndrds for lcttion sow [21]. All diets were prepred weekly to keep them fresh. Two sows in the test group gve irth to less thn 3 piglets nd thus were dropped from the study. Upon frrowing, sows were fed their tretment diet twice dily (0800nd1600h).Sowswereinitillyfed2.0kg,ndthis ws incresed dily y 0.5 kg of feed until d 4 postprtum, depending on sows feed consumption nd recovery fter prturition. After d 4 postprtum, sows hd free ccess to their diets until wening. The composition of the sow diets is shown in Tle 1. Two sows of the fish oil fed group gve irth to less thn 3 piglets nd thus were rejected. At frrowing, litters were equlized within dietry tretments to the sme numer of piglets per litter ( 10). Prestrter feed ws freely ville to the nursing piglets from 7 d of ge until wening. At 28 d of ge, 56 piglets, 28 piglets (hlf femles nd hlf cstrted mles) per group of sows, were moved to cges nd rered in nursery room. All piglets remined in the sme tretment group defined y their dm; they were then sudivided into two groups of 14 piglets ech (one femle nd one cstrted mle s repliction) such tht totl of 4 experimentl groups otined: CC (control sows-control piglets), CT (control sows-treted piglets), TC (treted sows-control piglets), nd TT (treted sows-treted piglets). Piglets from CT nd TT groups were fed strter diet supplemented with 7% fish oil, nd n isoenergetic, isonitrogenous, nd isolipidic diet supplemented with 7% lrd ws used s the strter diet fed to CC nd TC piglets. The two diets were formulted to meet NRC requirements of nutrient stndrds for piglet [21]. The composition of the piglet diets is shown in Tle 1. Wened piglets were fed experimentl diets from 35 d to 70 d
3 BioMed Reserch Interntionl 3 Tle 2: Oligonucleotide polymerse chin rection primers. Gene 1 Accession no. Primer source Primer sequences (5 3 ) Orienttion Product size, p t 2 ( C) IL-1β M86725 Pig ATTCGAGTCTGCCCTGTA Forwrd TCTGGGTATGGCTTTCCT Reverse IL-6 M80258 Pig GCATTCCCTCCTCTGGTC Forwrd ATAGTGTCCTAACGCTCAT Reverse TNF-α AY Pig CTCCCTCTTTGTCTCCTCC Forwrd GCATTGGCATACCCACTCT Reverse β-ctin SSU07786 Pig GGACTTCGAGCAGGAGATGG Forwrd GCACCGTGTTGGCGTAGAGG Reverse IL-1β: interleukin 1β, IL-6: interleukin 6, TNF-α: tumor necrosis fctor-α. 2 t : optiml PCR nneling temperture. fter frrowing. The feed intke of piglets ws recorded dily. Theodyweightofpigletswsmesuredtd0,21,35,nd 70 postntl. The piglets verge dily gin (ADG) during 0 21 d nd d were clculted s ody weight gin/dys Collection of Milk nd Tissue Smples. At d 21 of lcttion, ml of milk ws collected from the functionl glnds of ech sow fter injection of 2 ml of oxytocin. The milk smples were immeditely frozen t 20 C for lter nlysis. The milk smples were nlyzed to determine ftty cid composition. Sixteen piglets (4 per tretment, hlf femles nd hlf cstrted mles) were slughtered t the end of the experiment. The pigs were deprived of feed for 12 h efore humnely slughter vi electriclly stun nd exsnguintion. The smples of the longissimus dorsi muscle were collected etween thetenthndlstris,ndspleensmpleswerecollectedt ccumen. All the collected smples were snp frozen in liquid nitrogenndstoredt 80 C for susequent RNA isoltion Ftty Acids Anlysis. Ftty cids composition of milk (10 ml), diets (1 g), nd diced muscle (2 g) were nlyzed y gs chromtogrphy. Lipids were extrcted y chloroform: methnol (1 : 1) s descried y Folch et l. [22]. Ftty cid methyl ester ws prepred for gs chromtogrphy determintion using KOH/methnol (0.4 mol/l) [23]. The CP-3800 gs chromtogrphy (Vrin, Inc., USA) equipped with 1177 injector, flme ioniztion detector, nd cpillry chromtogrphic column CPSil88 (Vrin, Inc., USA) (50 m 0.25 mm μm) for ftty cid methyl ester ws used in this experiment. The injector nd detector tempertures were kept t 250 Cnd270 C, respectively. Nitrogen ws used s crrier gs with flow rte of 1.0 ml/min, nd the split rtio ws 1 : 100. The column temperture ws progrmmed s follows: 100 C t first, incresed to 200 C(5 C/min), nd held constnt for 5 min; then, the temperture ws incresed to 225 C(2 C/min) nd kept constnt for 2 min. The totl nlysis time ws 39.5 min. The ftty cids were identified y compring the retention times of the peks with those of known stndrds (Sigm Chemicl Co., St. Louis, Mo). Response fctors for the ftty cidswereclcultedusingthesmestndrdmixturesplus n internl stndrd [24]. Ftty cid results re presented s g/100 g ftty cids. Sturted ftty cids re the sum of C14:0, C16:0, nd C18:0. The monounsturted ftty cids re the sum of C16:1 (n-7) nd C18:1 (n-9). The (n-3) PUFA re the sum of C18:3 (n-3), C20:5 (n-3), C22:5 (n-3), nd C22:6 (n-3). The (n-6) PUFA re the sum of C18:2 (n-6) nd C20:4 (n-6). The sum of the PUFA ws clculted s the sum of (n-3) PUFA nd (n-6) PUFA Reverse Trnscription Polymerse Chin Rection (RT- PCR). Totl RNA ws extrcted using the TRIzol regent (Invitrogen Corp., Crlsd, CA, USA) ccording to the mnufcturer s specifictions. The RNA smples were quntifiedspectrophotometricllyt260nd280nm.atwo-step semiquntittive RT-PCR method ws used to mesure gene expression [25]. Oligo-(dT) 20n (Toyoo, Osk, Jpn) ws used s the primer in the first step of cdna synthesis. Reverse trnscription rection solution (20 μl) consisted of 2 μg of totlrna,100uofmmlv(moloneymurineleukemi Virus) reverse trnscriptse (Toyoo, Osk, Jpn), 20 U of n RNAse inhiitor (Toyoo, Osk, Jpn), 0.5 mmol/l of deoxyrionucleotide triphosphtes (dntp) (Toyoo, Osk, Jpn), nd 0.5 μl oligo-dt primers. The cdna stock ws stored t 20 C. The yield of cdna ws mesured ccording to the PCR signl generted from the internl stndrd housekeeping gene, β-ctin, which ws mplified from 25 to 35 cycles strting with 0.5 μl ofthecdnasolution.the volume of ech cdna pool ws djusted to give the sme exponentil-phse PCR signl intensity for β-ctin fter 25 cycles [26]. Reltive RT-PCR [27] ws performed to mesure gene expression of IL-1β, IL-6, nd TNF-α of longissimus dorsi muscle nd spleen. Primer sequences nd optiml PCR nneling tempertures (t )relistedintle 2.PCRws performed on 2720 Therml Cycler (Applied Biosystems, USA). The PCR progrm egn with 94 C denturtion for 5 min, followed y cycles dentured t 94 Cfor 30 s, nneling for 30 s, nd extension for 30 s t 72 C, with finl extension t 72 C for 10 min. The liner mplifiction rnge for ech gene ws tested on the djusted cdna. The optiml cycle numer ws then considered to e two cycles lower thn the highest cycle of linerity. The PCR products were electrophoresed on 1.5% grose gel nd stined with ethidium romide (10 μg/ml). The gel imges were digitlly cptured with G:BOX (Syngene, Cmridge, UK) nd densitometry vlues were mesured using the Gene Tool softwre (Syngene, Cmridge, UK). RT-PCR vlues re
4 4 BioMed Reserch Interntionl Tle 3: Lipid concentrtion nd ftty cid composition of sow nd piglet diets 1. Sow diet Piglet diet C T C T Lipid, g/100 g diet Ftty cid composition, g/100 g totl ftty cid C14: C16: C18: SFA C16:1 (n-7) C18:1 (n-9) MUFA C18:2 (n-6) C20:4 (n-6) (n-6) PUFA C18:3 (n-3) C20:5 (n-3) C22:5 (n-3) C22:6 (n-3) (n-3) PUFA PUFA Ftty cids re designted y the numer of cron toms followed y the numer of doule onds. The position of the first doule ond reltive to the methyl (n) end of the molecule is lso indicted. 2 SFA: sturted ftty cids, MUFA: monounsturted ftty cids, PUFA: polyunsturted ftty cids; SFA: the sum of C14:0, C16:0, nd C18:0; MUFA: the sum of C16:1 (n-7) nd C18:1 (n-9); (n-6) PUFA: the sum of C18:2 (n-6) nd C20:4 (n-6); (n-3) PUFA: the sum of C18:3 (n-3), C20:5 (n-3), C22:5 (n-3), nd C22:6 (n-3); PUFA: the sum of (n-6) PUFA nd (n-3) PUFA. Tle 4: Lipid concentrtion nd ftty cid composition of milk of sows fed with nd without fish oil 1,2. C T SEM P-vlue Lipid, g/100 g milk solid Ftty cid composition, g/100 g totl ftty cid C14: C16: C18: SFA C16:1 (n-7) <1 C18:1 (n-9) <1 MUFA <1 C18:2 (n-6) <1 C20:4 (n-6) (n-6) PUFA <1 C18:3 (n-3) C20:5 (n-3) <1 C22:5 (n-3) <1 C22:6 (n-3) <1 (n-3) PUFA <1 PUFA <1 1 Vlues re mens ± pooled SEM, control n=9,tretmentn=6. 2 Ftty cids re designted y the numer of cron toms followed y the numer of doule onds. The position of the first doule ond reltive to the methyl (n) end of the molecule is lso indicted. 3 SFA: sturted ftty cids, MUFA: monounsturted ftty cids, PUFA: polyunsturted ftty cids; SFA: the sum of C14:0, C16:0, nd C18:0; MUFA: the sum of C16:1 (n-7) nd C18:1 (n-9); (n-6) PUFA: the sum of C18:2 (n-6) nd C20:4 (n-6); (n-3) PUFA: the sum of C18:3 (n-3), C20:5 (n-3), C22:5 (n-3), nd C22:6 (n-3); PUFA: the sum of (n-6) PUFA nd (n-3) PUFA. presented s rtio of the specified gene signl in the selected liner mplifiction cycle divided y the β-ctin signl. Dt for ech replicte represented the men of three individul RT-PCRs Sttistics. Experimentl nimls were ssigned to different tretments in completely rndomized design. Pen ws the experimentl unit. Sttisticl nlysis of the dt ws performed with the ANOVA procedure of SAS8.01 [28], nd the residul error ws used to test the min effect of dietry tretments. The multiple comprisons were preceded with DUNCAN procedure. Dt were presented s mens ± SEM. Growth performnce nd gene expression dt of postwening piglets were nlyzed s 2 2rndomizedANOVA with lcttion (L) nd postwening diet period (PW) s effects. The correltion etween ADG nd expressions of proinflmmtory cytokine genes ws performed with the CORR procedure of SAS8.01 [28]. Mens were considered sttisticlly different t P < Results 3.1. Ftty Acids Composition of Diets nd Milk. Ftty cid composition of sow nd piglet diets is shown in Tle 3.Ftty cid composition of sow milk t d 21 of lcttion is shown in Tle 4. Fish oil diets nd lrd diets hd the sme levels of lipids, while the (n-3) PUFA were nerly 8 9 times higher in fish oil diets s compred to lrd diets. Compred with lrd oil, fish oil dministrtion incresed the concentrtion of PEA, DHA nd totl (n-3) PUFA in sows milk (P < 0.01), wheres, the EPA, DHA, nd totl (n-3) PUFA contents in milkfromfishoilfedsowswerelowerthnthoseinfishoil dded diets which fed to piglets during postwening period (7.00 g/100 g totl ftty cid versus g/100 g totl ftty cid). As result, piglets from fish oil fed dms received fewer mount of (n-3) PUFA thn wened piglets fed 7% fish oil diet (0.41% versus 1.00%) Ftty Acids Composition in Longissimus Dorsi Muscle. Ftty cid composition of longissimus dorsi muscle is shown in Tle 5.The sturted ftty cids(c14:0,c16:0,c18:0,nd C20:0), C20:4n-6, nd n-6 PUFA contents in longissimus dorsi muscle of postwening piglets from fish oil fed dms were significntly lower (P < 0.05) thnthoseofpigletsfrom control sows. The C20:1n-9 (0.78% versus 0.62%) nd C22:5n- 3 (0.84% versus 0.2%) contents were significntly incresed (P < 0.05) in piglets from sows compred with those from control sows.
5 BioMed Reserch Interntionl 5 Tle 5: Ftty cids composition of longissimus dorsi muscle. Ftty cid Diet 1 P-vlue 2 SEM L PW L PW Ftty cid composition, g/100 g totl ftty cid C14: C16: C16:1n C18: C18:1n C18:1n C18:2n C18:3n C20: <0.01 < C20:1n <0.01 < C20:4n C20:5n < C22:5n < C22:6n < SFA <0.01 < MUFA n-6 PUFA n-3 PUFA < PUFA n-6/n <0.01 < P/S Vlues re mens ± pooled SEM, n=7. CC: ll period fed lrd diet; CT: post-wening period fed fish oil diet; TC: lcttion period fed fish oil diet; TT: ll period fed fish oil diet. 2 Effects of lcttion (L) nd the post-wening (PW) or the interction etween lcttion nd the strter diet period (L PW). 3 Ftty cids re designted y the numer of cron toms followed y the numer of doule onds. The position of the first doule ond reltive to the methyl (n) end of the molecule is lso indicted. SFA: sturted ftty cids, MUFA: monounsturted ftty cids, PUFA: polyunsturted ftty cids; SFA: the sum of C14:0, C16:0, nd C18:0; MUFA: the sum of C16:1 (n-7) nd C18:1 (n-9); (n-6) PUFA: the sum of C18:2 (n-6) nd C20:4 (n-6); (n-3) PUFA: the sum of C18:3 (n-3), C20:5 (n-3), C22:5 (n-3), nd C22:6 (n-3); PUFA: the sum of (n-6) PUFA nd (n-3) PUFA. Tle 6: Effect of fish oil supplementtion during lte gesttion nd lcttion on the performnce of suckling piglets 1. Item Diet C T SEM P-vlue Litter weight t delivery, kg Body weight t irth, kg Body weight t 21 d, kg Averge dily gin, g Vlues re mens ± pooled SEM, control n=10,tretmentn=8. The C16:0, C20:0, nd SFA contents in longissimus dorsi muscle of piglets receiving fish oil were significntly decresed (P < 0.05) compred with those receiving control diets during the postwening period. The C20:5n-3 (1.39% versus 0.13%), C22:5n-3 (0.56% versus 0.47%), C22:6n-3 (1.38% versus 0.34%), nd totl n-3 PUFA (4.38% versus 1.3%) contents in longissimus dorsi muscle of piglets receiving fish oilweresignificntlyincresed(p < 0.01) morethnthose receiving control diets during the postwening period Growth Performnce of Piglets. Growth performnce of suckling piglets is shown in Tle 6.Theodyweightstirth nd litter weights t delivery were not different (P > 0.05) etween groups. However, the verge dily gin (ADG) of suckling piglets ws significntly (P < 0.05) higher in the fish oil group thn in the control group. The growth performnce of wened piglets ws lso significntly (P < 0.05) ffected y sow diet effect (L) (Tle 7). The finl ody weights (21.29 kg versus kg) of postwening piglets from fish oil fed dms were significntly higher (P < 0.05) thn those of piglets from control sows. The ADG (325 g/d versus 265 g/d) nd verge dily feed intke (ADFI) (615 g/d versus 510 g/d) were lso significntly incresed (P < 0.05) in piglets from sows compred with those from control sows, wheres the feed conversion rte (1.91 versus 1.96) ws not different (P > 0.05) etween groups. The growth performnce of wened piglets ws not significntly (P > 0.05) ffected y piglet diet effect. However, there ws tendency (P < 0.10) towrds lower ADG (270 g/d versus 321 g/d) nd higher feed : gin (2.00 versus 1.87) in piglets receiving fish oil compred with those receiving control diets during the postwening period, ut the ADFI (534 g/d versus 591 g/d) nd finl ody weights (19.18 kg versus kg) were not significntly (P > 0.05) different etween groups. Additionlly, finl ody weight, ADG, nd ADFI were significntly higher in group TC thn those in group CT (P < 0.05).
6 6 BioMed Reserch Interntionl Tle 7: Growth performnce of wened piglets orn to fish oil-treted nd control sows nd fed diets with nd without fish oil supplementtion in the post-wening period. Item Diet 1 P-vlue 2 SEM L PW L PW Body weight (35 d), kg Body weight (70 d), kg Averge dily gin, g Averge dily feed intke, g Feed : gin Vlues re mens ± pooled SEM, n=7. CC: ll period fed lrd diet; CT: post-wening period fed fish oil diet; TC: lcttion period fed fish oil diet; TT: ll period fed fish oil diet. 2 Effects of lcttion (L) nd the post-wening (PW) or the interction etween lcttion nd the strter diet period (L PW)., Mens with different letters re significntly different (P < 0.05) mong groups. Tle 8: The correltion coefficients etween ADG nd expressions of proinflmmtory cytokine genes in longissimus dorsi muscle nd spleen. Item Longissimus dorsi muscle Spleen IL-1β 1 IL-6 1 TNF-α 1 IL-1β IL-6 TNF-α ADG Correltion coefficients (r) P-vlue IL-1β: interleukin 1β, IL-6: interleukin 6, TNF-α: tumor necrosis fctor-α Proinflmmtory Cytokines Gene Expression in Longissimus Dorsi Muscle nd Spleen. Figure 1 showstheresultsof cytokines expression in longissimus dorsi muscle nd spleen of wened piglets in C-C, C-T, T-C, nd T-T groups. IL-6 (Figure 1()) nd TNF-α (Figure 1(c)) expression in longissimus dorsi muscle ws significntly (P < 0.05) decresed in wened piglets from fish oil fed dms compred with those of piglets from lrd fed dms, while the IL-1β expression in longissimus dorsi muscle (Figure 1()) ws not different (P > 0.05). Additionlly, the IL-1β nd IL-6 (Figures 1(d) nd 1(e)) expression in spleen ws not different (P > 0.05). However, postwening piglets from fish oil fed dms hd higher (P < 0.05) TNF-α (Figure 1(f))expressioninspleen. Proinflmmtory cytokines expression of wened piglets in longissimus dorsi ws not ffected y postwening fish oil supplementtion (PW) or L PW interction (P > 0.05) (Figures 1(), 1(), nd1(c)). However, postwening fishoilsupplementtionresultedinsignificntlyincresed (P < 0.01) spleen IL-1β, IL-6, ndtnf-α mrna undnces (Figures 1(d), 1(e),nd1(f)). 3.5.TheCorreltionetweenADGndExpressionsofProinflmmtory Cytokine Genes. The mrna expressions for proinflmmtory cytokines in groups CC, CT, TC, nd TT were pooled nd compred with the ADG of the corresponding slughtered piglets in order to evlute possile correltion etween expressions of proinflmmtory cytokines nd growth performnce. The correltion coefficients etween ADG nd expressions of proinflmmtory cytokine genes re shown in Tle 8. Proinflmmtory cytokines expressions in longissimus dorsi muscleor in spleen were negtively correlted with piglets growth. There were sttisticlly significnt negtive correltions etween musculr IL-1β expression (r = , P < 0.01) or splenic IL-1β expression (r = , P < 0.01)levelsndADG. 4. Discussion Dily supplementry low level of cod liver oil (50 ml/d, pproximtely 1% 2%)to sows from dy 107 of gesttion until wening did not ffect weight gin nd overll moridity of pigletsinthestudyytugøletl.[29]. It ws suggested tht 1.75% (17.5 g/kg of diet) of fish oil to pregnnt diet nd 3.5% (35 g/kg of diet) of fish oil to lcttion diet for sows improved growth of their progeny [1]. The previous results showed tht the ody weight nd ADG of suckling piglets t 21 d postntl were incresed y 7% (70 g/kg of diet) fish oil supplementtion to the lte gesttion nd lcttion sows diets, which greed with other reserchers [1, 30]. We lso found tht wened piglets from fish oil fed dms hd higher growth rte thn those from lrd oil fed dms during the d35to70postntlperiod.theseresultsreveledtht7% of fish oil supplemented to sows diets could promote the growth performnce of their progeny, nd this effect even lsted during the postwening period. Interestingly, high level of fish oil supplementtion ws not eneficil for piglets growth. It ws found tht 8% (80 g/kg of diet) fish oil ddition to sow diet during lte gesttion nd lcttion period decresed litter weight gin of suckling piglets, compred with 8% niml ft (6). Similrly, 10% (100 g/kg of diet) fish oil ddition to lcttion sow diet resulted in incresed piglets prewening moridity nd decresedsowsmilkproduction(2).welsofoundthesme trend in the present study. The ADG nd feed conversion rte
7 BioMed Reserch Interntionl 7 Reltive gene expression nt nt nt nt Reltive gene expression Reltive gene expression () () (c) Reltive gene expression c c Reltive gene expression Reltive gene expression c, c (d) (e) (f) Figure 1: Reltive longissimus dorsi muscle nd spleen cytokines expression of wened piglets orn to fish oil-treted or control sows, nd piglets fed diets with nd without fish oil supplementtion during the postwening period. (), (), nd (c) were longissimus dorsi muscle cytokines expression; (d), (e), nd (f) were spleen cytokines expression. () nd (d): IL-1β expression; () nd (e): IL-6 expression; (c) nd (f): TNF-α expression. Gene signls were normlized to the expression of the housekeeping gene β-ctin opticl density signl. CC: ll period fed lrd diet; CT: postwening period fed fish oil diet; TC: lcttion period fed fish oil diet; TT: ll period fed fish oil diet. Dt shown re men vlues ± SEM, n=4., : mens lcttion decrese effect with P < 0.05, P < 0.01;, : mens postwening increse effect with P < 0.05, P < 0.01;, : mens with different letters re significntly different (P < 0.05)monggroups; nt : mens hve no significnt difference. (FCR) of postwening piglets were tended to decrese fter 7% of fish oil feeding. The results were in generl greement with nother study showing tht wened piglets receiving 5% (50 g/kg of diet) menhden fish oil + 1% (10 g/kg of diet) corn oilduringthed24to36postntlperiodhdlowerody weightginndadfithnthosefed6%cornoil[4]. The three proinflmmtory cytokines IL-1, IL-6, nd TNF-α could induce gret metolic chnges [31]. The cytokines pper to e primrily derived from mcrophgerich tissues, such s the liver nd spleen, nd vrious myelomonocytic cells s well. However, it ws reported tht cytokinesrelsoproducedycellsnottrditionllyconsidered to e prt of the immune system such s dipocytes nd myofiers [32, 33], which re effective sources nd trgets of cytokines [34, 35]. Proinflmmtory cytokines medite reprogrmming of metolism nd shift the prtitioning of dietry nutrients wy from skeletl muscle ccretion towrd metolic responses tht support the immune system [7, 31]. Skeletl muscle s the iggest ody tissue, mounting for 40 45% of the totl ody mss, is lso the most quickly growing tissues during erly postntl period except for one nd nervous system. Collectively, these dt suggest tht the utocrine/prcrine ctions of cytokines re of potentil importnce in muscle nd thus in postntl niml growth. There ws pucity of dt pertining to the cytokines expression fter (n-3) PUFA dministrtion in skeletl muscle. Previous study in our lortory showed tht during norml physiologicl processes feeding linseed diet (rich in α-linolenic cid) suppressed the expression of proinflmmtory cytokines in longissimus muscle of growing-finishing rrows nd decresed serum level of TNF-α from to ng/ml during norml physiologicl condition. These results showed tht the pproprite reduction of serum TNF- α levels tht rnged from to ng/ml might e eneficil to increse the longissimus muscle mss under norml physiologicl condition [18]. EPA nd DHA were considered to e more potent in regulting immune function [14]. Fish oil hs een reported to decrese production of proinflmmtory cytokines ecuse of the high content of EPA nd DHA[10 12]. The IL-6 nd TNF-α expression ws significntly suppressed in muscle of wened piglets from fish oil fed dms in the present study. We lso found negtive correltion etween ADG nd proinflmmtory cytokines expression. Thus, suppression of cytokines expression in muscle of piglets my positively reduce the inflmmtory response in skeletl muscle, ttenute the negtive effect of the potent proinflmmtory cytokines, nd promote piglet growth.
8 8 BioMed Reserch Interntionl Remrkly,itwsnotlwysconsistentwiththeresult which modertes fish oil supplementtion decresed production of proinflmmtory cytokines. The study in rodents suggested tht mice fed s high s 30% (300 g/kg of diet) of fish oil for 4 6 weeks incresed the TNF-α syntheses in splenocytes [19]. Brer et l. [20] lso reported tht TNF-α secretion ws incresed in splenocytes seprted from 4% of EPA (>30% fish oil ccording to our dt) fed mice fter stimultion with LPS. We lso found tht ll of the three proinflmmtory cytokines expressions were significntly incresed in spleen fter 7% of fish oil feeding during post-wening. High production of proinflmmtory cytokines in spleen, the iggest immune orgn, my increse proinflmmtory cytokines levels of the whole ody, suppress skeletl muscle protein ccretion, nd impct niml growth [7, 9, 36]. The results suggested tht dministrtion of 7% fish oil to lcttion sows significntly incresed the growth rte of their progeny during postwening period. However, the ddition of 7% fish oil to diets of postwening piglets ws likely to decresethegrowthrtendfcrofpiglets.thecontrry effects of 7% fish oil supplementtion to sows or wened piglets diets my e due to the different content of (n-3) PUFA tht the piglets received. The current results demonstrted tht the EPA, DHA, nd totl (n-3) PUFA contents of milk were lower thn those of piglets diets (2.71% versus 5.90%, 2.53% versus 2.94%, nd 7.00% versus 10.28%, resp.). As result of the lower level of lipid content in milk compred with tht in the diet, piglets only received 40% of (n-3) PUFA from milk reltive to tht ingested from fish oil diets directly. Our previous study found tht intke of n-3pufa couldincresethen-3pufacontentinlongissimus dorsi muscle of growing-finishing pigs [37]. In the current experiment, C22:5n-3 contents in longissimus dorsi muscle of postwening piglets from fish oil fed dms were incresed (0.84% versus 0.2%) more thn those of piglets from control sows. However, the C20:5n-3 (1.39% versus 0.13%), C22:5n-3 (0.56% versus 0.47%), C22:6n-3 (1.38% versus 0.34%), nd totl n-3 PUFA (4.38% versus 1.3%) contents in longissimus dorsi muscle of piglets receiving fish oil were incresed more thn those of piglets receiving control diets during the postwening period. These results reveled tht n-3pufa contents in the muscle were higher in piglets fed fish oil directly thn tht in wened piglets from fish oil fed dms. It ws further oserved tht the IL-6 nd TNF-α expression either in the muscle or in spleen ws lower in wened piglets from fish oil fed dms thn tht in piglets fed fish oil directly. It could e concluded tht moderte (n-3) PUFA intke ws eneficil to piglets growth y decresing proinflmmtory cytokines production nd suppressing inflmmtory response in skeletl muscle. However, high intke of (n-3) PUFA my promote splenic proinflmmtory cytokines production nd impct niml growth consequently. In conclusion, fish oil might regulte piglet growth through modulting proinflmmtory cytokines production in ody tissues. Approprite levels of fish oil supplementtion to sows diets my increse (n-3) PUFA content in milk nd (n-3) PUFA ingestion of their progenies, decrese the proinflmmtory cytokines expression nd their unfvorle effects on skeletl muscle, nd thus promote growth of piglets. However, high levels of fish oil supplementtion to postwening piglets diets my increse splenic proinflmmtory cytokines expression nd thus negtively impct the growth of wened piglets. Given tht the limited replicte numer of slughtered nimls in the present study my e not enough to generte definitive conclusion, further investigtion with more numer of smples is required to determine the pproprite fish oil supplementtion level, durtion, nd the precise mechnisms y which long chin (n-3) PUFA ffect piglets immunity nd growth. Conflict of Interests The uthors declre tht they hve no competing interests. Authors Contriution JieLuondFeiruoHungcontriutedequllytothiswork. Acknowledgments This reserch ws supported y the Ntionl High Technology R & D Progrm of Chin (no. 2006AA10Z140), the Ntionl Science Foundtion of Chin (no ), nd Mjor Science & Technology Industriliztion Projects in Wuhn City of Chin (no ). References [1] J. A. Rooke, M. Shnks, nd S. A. Edwrds, Effect of offering mize, linseed or tun oils throughout pregnncy nd lcttion on sow nd piglet tissue composition nd piglet performnce, Animl Science,vol.71,no.2,pp ,2000. [2] V. Dnielsen nd C. Luridsen, Fodringens indflydelse påmælkemængde og-smmensætning, in Dnmrks Jordrugs- Forskning, K.JkosenndV.Dnielsen,Eds.,vol.141,pp.29 36, Intern Rpport, [3] A.B.Schellingerhout,H.Everts,ndA.C.Beynen, Influenceof dietry (n-3) polyunsturted cids, in the form of either linseed or fish oil, on growth performnce, smll intestinl morphology nd essentil ftty cid sttus of wenling piglets, in Essentil- Ftty Acid Supply of Wenling Piglets,A.B.Schellingerhoutnd A. Betrix, Eds., [4]A.M.Gines,J.A.Crroll,G.F.Yi,G.L.Allee,ndM.E. Znnelli, Effect of menhden fish oil supplementtion nd lipopolyscchride exposure on nursery pigs II. Effects on the immune xis when fed simple or complex diets contining no spry-dried plsm, Domestic Animl Endocrinology, vol. 24, no. 4, pp , [5] G.Zho,T.D.Etherton,K.R.Mrtinetl., Anti-inflmmtory effects of polyunsturted ftty cids in THP-1 cells, Biochemicl nd Biophysicl Reserch Communictions, vol.336,no.3, pp ,2005. [6] C. Luridsen nd V. Dnielsen, Lcttionl dietry ft levels nd sources influence milk composition nd performnce of sows nd their progeny, Livestock Production Science, vol. 91, no.1-2,pp ,2004. [7] M.E.Spurlock, Regultionofmetolismndgrowthduring immune chllenge: n overview of cytokine function, Journl of Animl Science,vol.75,no.7,pp ,1997.
9 BioMed Reserch Interntionl 9 [8] A.D.Mitchell,A.M.Scholz,ndH.J.Mersmnn, Growthnd ody composition, in Biology of the Domestic Pig, W. G. Pond nd H. J. Mersmnn, Eds., Cornell University Press, Ithc, NY, USA, 2nd edition, [9] R. W. Johnson nd J. Escor, Cytokine regultion of protein ccretion in growing nimls, in Biology of Metolism in Growing Animls, D. G. Burrin nd H. J. Mersmnn, Eds., vol. 3,pp ,Elsevier,Houston,Tex,USA,2005. [10] S. Endres, R. Ghorni, V. E. Kelley et l., The effect of dietry supplementtion with n-3 polyunsturted ftty cids on the synthesis of interleukin-1 nd tumor necrosis fctor y mononucler cells, The New Englnd Journl of Medicine, vol. 320, no. 5, pp , [11] G. E. Cughey, E. Mntzioris, R. A. Gison, L. G. Clelnd, nd M. J. Jmes, The effect on humn tumor necrosis fctor α nd interleukin 1β production of diets enriched in n-3 ftty cids from vegetle oil or fish oil, The Americn Journl of Clinicl Nutrition,vol.63,no.1,pp ,1996. [12] S. Kew, T. Bnerjee, A. M. Minihne, Y. E. Finnegn, C. M. Willims, nd P. C. Clder, Reltion etween the ftty cid composition of peripherl lood mononucler cells nd mesures of immune cell function in helthy, free-living sujects ged y, The Americn Journl of Clinicl Nutrition, vol. 77,no.5,pp ,2003. [13]K.L.Fritsche,D.W.Alexnder,N.A.Cssity,ndS.Hung, Mternlly-supplied fish oil lters piglet immune cell ftty cid profile nd eicosnoid production, Lipids, vol. 28, no. 8, pp , [14] P. C. Clder, Dietry ftty cids nd the immune system, Lipids, vol. 34, no. 6, pp. S137 S140, [15] S. N. Meydni, S. Endres, M. M. Woods et l., Orl (n-3) ftty cid supplementtion suppresses cytokine production nd lymphocyte prolifertion: comprison etween young nd older women, Journl of Nutrition, vol. 121, no. 4, pp , [16] D. R. Korver nd K. C. Klsing, Dietry fish oil lters specific nd inflmmtory immune responses in chicks, Journl of Nutrition,vol.127,no.10,pp ,1997. [17] S.Xi,D.Cohen,S.Brve,ndL.H.Chen, Fishoilsuppressed cytokines nd nucler fctor-kppb induced y murine AIDS virus infection, Nutrition Reserch, vol.21,no.6,pp , [18]Z.P.Zhn,F.R.Hung,J.Luo,J.J.Di,X.H.Yn,ndJ. Peng, Durtion of feeding linseed diet influences expression of inflmmtion-relted genes nd growth performnce of growing-finishing rrows, JournlofAnimlScience,vol.87, no. 2, pp , [19] R. Alers, M. Bol, R. Bleumink, A. Willems, C. Blonk, nd R. Pieters, Effects of dietry lipids on immune function in murine sensitistion model, The British Journl of Nutrition, vol. 88, no. 3, pp , [20] M.D.Brer,K.C.H.Feron,ndJ.A.Ross, Eicospentenoic cid modultes the immune response ut hs no effect on mimic of ntigen-specific responses, Nutrition, vol. 21, no. 5, pp , [21] Ntionl Reserch Council, Nutrient Requirements of Swine, Ntionl Acdemy Press, Wshington, DC, USA, 10th edition, [22] J. Folch, M. Lees, nd G. H. S. Stnley, A simple method for the isoltion nd purifiction of totl lipides from niml tissues, TheJournlofBiologiclChemistry,vol.226,no.1,pp , [23] G. Demirel, A. M. Wchir, L. A. Sinclir, R. G. Wilkinson, J. D. Wood, nd M. Enser, Effects of dietry n-3 polyunsturted ftty cids, reed nd dietry vitmin E on the ftty cids of lm muscle, liver nd dipose tissue, The British Journl of Nutrition,vol.91,no.4,pp ,2004. [24]M.Enser,R.I.Richrdson,J.D.Wood,B.P.Gill,ndP.R. Sherd, Feeding linseed to increse the n-3 PUFA of pork: ftty cid composition of muscle, dipose tissue, liver nd susges, Met Science,vol.55,no.2,pp ,2000. [25] Z. F. Fng, J. Luo, Z. L. Qi et l., Effects of 2-hydroxy- 4-methylthioutyrte on portl plsm flow nd net portl ppernce of mino cids in piglets, Amino Acids, vol. 36, no. 3,pp ,2009. [26]W.J.Medus,R.McInnis,ndM.E.R.Dugn, Prolonged dietry tretment with conjugted linoleic cid stimultes porcinemuscleperoxisomeprolifertorctivtedreceptorγ nd glutmine-fructose minotrnsferse gene expression in vivo, Journl of Moleculr Endocrinology,vol.28,no.2,pp.79 86, [27] W. E. Spencer nd M. J. Christensen, Multiplex reltive RT- PCR method for verifiction of differentil gene expression, BioTechniques,vol.27,no.5,pp ,1999. [28] SAS Institute Inc., SAS/STAT User s Guide: Version 6, SAS Institute Inc., Cry, NC, USA, 4th edition, [29] O. Tugøl, T. Frmstd, nd K. Srem, Supplements of cod liver oil to lctting sows. Influence on milk ftty cid composition nd growth performnce of piglets, Zentrlltt fur Veterinrmedizin A,vol.40,no.6,pp ,1993. [30] C.L.Xio,C.Z.Tin,F.R.Hung,J.Luo,ndJ.Peng, Effects of feeding sows fish oil on ftty cids in milk nd growth performnce of piglets, Chinese Journl of Animl Nutrition, vol.20,pp.8 15,2008. [31] D. Melchior, B. Sève, nd N. L. Floc h, Chronic lung inflmmtion ffects plsm mino cid concentrtions in pigs, Journl of Animl Science,vol.82,no.4,pp ,2004. [32] G. Bumgrten, P. Knuefermnn, N. Nozki, N. Sivsurmnin,D.L.Mnn,nd J.G.Vllejo, In vivo expression of proinflmmtory meditors in the dult hert fter endotoxin dministrtion: the role of toll-like receptor-4, Journl of Infectious Diseses,vol.183,no.11,pp ,2001. [33] E. A. Plmieri, G. Benincs, F. D. Rell et l., Differentil expression of TNF-α, IL-6, nd IGF-1 y grded mechnicl stress in norml rt myocrdium, The Americn Journl of Physiology Hert nd Circultory Physiology, vol.282,no.3, pp. H926 H934, [34] S. Pié, J. P. Lllès, F. Blzy, J. Lffitte, B. Sève,ndI.P.Oswld, Wening is ssocited with n upregultion of expression of inflmtory cytokines in the intestine of piglets, Journl of Nutrition,vol.134,no.3,pp ,2004. [35]S.K.Jcoi,N.K.Gler,K.M.Ajuwon,J.E.Dvis,ndM. E. Spurlock, Adipocytes, myofiers, nd cytokine iology: new horizons in the regultion of growth nd ody composition, Journl of Animl Science,vol.84,pp.E140 E149,2006. [36] A. P. Simopoulos, Omeg-3 ftty cids in inflmmtion nd utoimmune diseses, Journl of the Americn College of Nutrition,vol.21,no.6,pp ,2002. [37] F.R.Hung,Z.P.Zhn,J.Luo,Z.X.Liu,ndJ.Peng, Durtion of dietry linseed feeding ffects the intrmusculr ft, muscle mss nd ftty cid composition in pig muscle, Livestock Science,vol.118,no.1-2,pp ,2008.
10 Interntionl Journl of Peptides BioMed Reserch Interntionl Advnces in Stem Cells Interntionl Virolog y Interntionl Journl of Genomics Journl of Nucleic Acids Zoology Interntionl Journl of Sumit your mnuscripts t The Scientific World Journl Journl of Signl Trnsduction Genetics Reserch Interntionl Antomy Reserch Interntionl Enzyme Reserch Arche Biochemistry Reserch Interntionl Interntionl Journl of Microiology Interntionl Journl of Evolutionry Biology Moleculr Biology Interntionl Advnces in Bioinformtics Journl of Mrine Biology
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationThe Journal of Physiology
J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationSupporting information
Supporting informtion Multiple Univrite Dt Anlysis Revels the Inulin Effects on the High-ft-diet Induced Metolic Altertions in Rt Myocrdium nd Testicles in the Pre-oesity Stte Yixun Dun #, Ynpeng An #,
More informationEffect Of MiCroPlex Chromium Methionine And Vitamin E Supplementation On Growth Performance And Immune Status Of Stressed Beef Calves
Effect Of MiCroPlex Chromium Methionine And Vitmin E Supplementtion On Growth Performnce And Immune Sttus Of Stressed Beef Clves Z BCr - 16 Ojective Evlute MiCroPlex nd vitmin E effects on growth nd immune
More informationEffects of Dietary Protein and Energy on Growth Performance and Carcass Characteristics of Betong Chickens (Gallus domesticus) During Growing Period
Interntionl Journl of Poultry Science 9 (5): 468-472, 2010 ISSN 1682-8356 Asin Network for Scientific Informtion, 2010 Effects of Dietry Protein nd Energy on Growth Performnce nd Crcss Chrcteristics of
More informationEffect of Mannan Oligosaccharide (Bio-Mos) Addition With and Without Zinc Oxide on Performance and Immunocompetence of Weanling Pigs
Effect of Mnnn Oligoscchride (Bio-Mos) Addition With nd Without Zinc Oxide on Performnce nd Immunocompetence of Wenling Pigs E. Dvis, C. Mxwell, B. de Rods, nd D. Brown 1 Story in Brief An experiment involving
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationResponse of Commercial Egg-Type Pullets to Diets Varying in Protein and Energy Content in Arid Hot Climate
Interntionl Journl of Poultry Science 8 (9): 90-98, 2009 ISSN 682-8356 sin Network for Scientific Informtion, 2009 Response of Commercil Egg-Type Pullets to Diets Vrying in Protein nd Energy Content in
More informationSows with high milk production had both a high feed intake and high body mobilization
Animl (2017), 11:11, pp 1913 1921 The Animl Consortium 2017 doi:10.1017/s1751731117000155 niml Sows with high milk production hd oth high feed intke nd high ody moiliztion A. V. Strthe 1, T. S. Bruun 2
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationEffects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle
Effects of Recominnt Bovine Somtotropin Administrtion t Breeding on the Cow, Conceptus nd Susequent Offspring Performnce of Beef Cttle V. R. G. Mercdnte 1, F. M. Cirico 1, D. D. Henry 1, P. L. P. Fontes
More informationThe Effects of Diet Particle Size on Animal Performance
MF-2050 Feed Mnufcturing Feed Mnufcturing Cerel grins re the primry energy source in swine nd poultry diets. Therefore, not only must producers be concerned bout the composition of the grin, but lso how
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationProducts for weaners Benzoic acid or the combination of lactic acid and formic acid
Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationStudy of some Blood Parameters of Broilers Fed on Ration Containing Fish Oil
Journl of Biology, Agriculture nd Helthcre ISSN 2224-3208 (Pper) ISSN 2225-093X (Online) Study of some Blood Prmeters of Broilers Fed on Rtion Contining Fish Oil Ysser Jml Jmeel 1 * Ali Mhdi Shi 2 1. Deprtment
More information3/10/ Energy metabolism o How to best supply energy to the pig o How the pig uses energy for growth
Keeping Control of Feed Costs in n Uncertin Mrket Presented To: Iow Pork Producers Assocition Regionl Meetings Februry, 2009 John F. Ptience Iow Stte University Ames, IA Outline Wht s new in swine nutrition
More informationInfluence of $-Adrenergic Agonist (Metaproterenol) and Lysine on Growth, Carcass Quality in Broiler Chickens
Interntionl Journl of Poultry Science 5 (11): 1082-1086, 2006 ISSN 1682-856 Asin Network for Scientific Informtion, 2006 Influence of $-Adrenergic Agonist (Metproterenol) nd Lysine on Growth, Crcss Qulity
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationEffect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens
Interntionl Journl of Poultry Science 7 (12): 1232-1236, 2008 ISSN 1682-8356 sin Network for Scientific Informtion, 2008 Effect of Different Dietry Energy Sources on Induction of Ftty Liver-Hemorrhgic
More informationIbrahim, I. Hamid Animal Production Research Center-Khartoum North, Sudan
Interntionl Journl of Poultry Science 13 (8): 484-488, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 Investigtions into the Addition of Herl Methionine (Phytonin) As Sustitute of Synthetic
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationEffects of Different Sources and Levels of Selenium on Performance, Thyroid Function and Antioxidant Status in Stressed Broiler Chickens
Interntionl Journl of Poultry Science 8 (6): 583-587, 2009 ISSN 1682-8356 Asin Network for Scientific Informtion, 2009 Effects of Different Sources nd Levels of Selenium on Performnce, Thyroid Function
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationOffspring subcutaneous adipose markers are sensitive to the timing of maternal gestational weight gain
Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 DOI 10.1186/s12958-015-0009-0 RESEARCH Open Access Offspring sucutneous dipose mrkers re sensitive to the timing of mternl gesttionl weight
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationThe Ever Changing World of Feed Additives in The Poultry Industry
The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of
More informationIntroduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010
Introduction Lnce Bumgrd Associte Professor Ntive of southwest Minnesot BS: U of Minnesot MS: U of Minnesot Advisor: Brin Crooker Thesis: Effects of genetic selection for milk yield on somtotropin prmeters
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationdoi: /s British Journal of Nutrition (2016), 115, The Authors 2016
British Journl of Nutrition (2016), 115, 2236 2245 The Authors 2016 doi:10.1017/s0007114516000842 Supplementtion of rnched-chin mino cids to reduced-protein diet improves growth performnce in piglets:
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationEffect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows
Ksetsrt J. (Nt. Sci.) 37 : 145-149 (2003) Effect of Orl Administrtion of Propylene Glycol on Serum Glucose Concentrtions in Periprturient Diry Cows Theer Rukkwmsuk, Nrongpol Petploi, Ing-orn Preechnvinit,
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationDigestible Sulfur Amino Acid Requirement of Male Turkeys During the 12 to 18 Week Period
Interntionl Journl of Poultry Science (): 8-, 00 Asin Network for Scientific Informtion 00 Digestible Sulfur Amino Acid Requirement of Mle Turkeys During the to 8 Week Period D. T. Moore, K. Bker, K. Thompson,
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationDifferent Dietary Protein and PUFA Interventions Alter the Fatty Acid Concentrations, but Not the Meat Quality, of Porcine Muscle
Nutrients 2012, 4, 1237-1246; doi:10.3390/nu4091237 Article OPEN ACCESS nutrients ISSN 2072-6643 www.mdpi.com/journl/nutrients Different Dietry Protein nd PUFA Interventions Alter the Ftty Acid Concentrtions,
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationUse of δ-aminolevulinic Acid in Swine Diet: Effect on Growth Performance, Behavioral Characteristics and Hematological/Immune Status in Nursery Pigs*
97 Use of δ-aminolevulinic Acid in Swine Diet: Effect on Growth Performnce, Behviorl Chrcteristics nd Hemtologicl/Immune Sttus in Nursery Pigs* R. D. Mteo 1, J. L. Morrow 2, J. W. Diley 2, F. Ji 1 nd S.
More informationNutrition Guide. National Swine. Protein and Amino Acid Sources for Swine Diets. Introduction. Objectives. Amino Acid Sources
Ntionl Swine Nutrition Guide Protein nd Amino Acid Sources for Swine Diets Introduction Authors Mrci C. Shnnon, University of Missouri Gry L. Allee, University of Missouri Reviewers R. Den Boyd, The Hnor
More informationTHE INFLUENCE OF MILK THISTLE SEED CAKES ON BROILER CHICKENS PERFORMANCE PARAMETERS
THE INFLUENCE OF MILK THISTLE SEED CAKES ON BROILER CHICKENS PERFORMANCE PARAMETERS STASTNIK ONDREJ 1, DETVANOVA LENKA 2, KARASEK FILIP 1, STENCLOVA HANA 1, KALHOTKA LIBOR 2, PAVLATA LEOS 1, MRKVICOVA
More informationBritish Journal of Nutrition
(11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen
More informationThe effect of diet that contained fish oil on performance, serum parameters, the immune system and the fatty acid composition of meat in broilers.
Int.J.Vet.Res. 3,:69-75,9 69 The effect of diet t contined fish oil on performnce, serum prmeters, e immune system nd e ftty cid composition of met in roilers. Sleh, H., Rhimi, Sh.*,Krimi Torshizi, M.
More informationChromium Content Of Feedstuffs. Chromium An Essential Nutrient. Which Tissue?
CHROMIUM FOR DAIRY CATTLE Chromium Content Of Feedstuffs Feedstuff Avil Cr in Diry Production A. Geiger, Ph.D. Zinpro Corportion Psture 0.8 Whet silge 2.2 Dehydrted lflf 0.2 Corn silge 2.0 Ryegrss 0.4
More informationEffect of dietary linseed supplements on ω-3 PUFA content and on IGF-1 expression in broiler tissues
Vol. 18 (2009): 35 44. Effect of dietry linseed supplements on ω-3 PUFA content nd on IGF-1 expression in broiler tissues Zinid Sprõkin 1 *, Avo Krus 1, Sirje Kuusik 4, Hrld Tikk 2, Peeter Järv 3, Riin
More informationChoice Feeding of Two Different Broiler Strains Using Diets with Constant Energy Level 1
Interntionl Journl of Poultry Science 7 (8): 726-737, 2008 ISSN 1682-8356 Asin Network for Scientific Informtion, 2008 Choice Feeding of Two Different Broiler Strins Using Diets with Constnt Energy Level
More informationWith. The NEW vaccine against Swine Erysipelas and Porcine Parvovirus infection. A powerful immunity you can rely on
With The NEW vccine ginst Swine Erysipels nd Porcine Prvovirus infection A powerful immunity you cn rely on Swine Erysipels Erysipelothrix rhusiopthie cn e found on most pig frms: it cuses Swine Erysipels,
More informationDecreasing Diet Density: Direct Fed Microbials and L-Threonine 1,2
Interntionl Journl of Poultry Science 9 (): -9, 00 ISSN 68-86 Asin Network for Scientific Informtion, 00 Decresing Diet Density: Direct Fed Microils nd L-Threonine, 4 4,4 4 6 M.T. Kidd, A. Corzo, W.A.
More informationThe Effects of Dietary Protein and Lysine Levels on Broiler Performance, Carcass Characteristics and N Excretion
Interntionl Journl of Poultry Science 3 (): 148-15, 004 Asin Network for Scientific Informtion 004 The Effects of Dietry Protein nd Lysine Levels on Broiler Performnce, Crcss Chrcteristics nd N Excretion
More informationMeat Science 84 (2010) Contents lists available at ScienceDirect. Meat Science. journal homepage:
Met Science 84 (2010) 578 584 Contents lists vilble t ScienceDirect Met Science journl homepge: www.elsevier.com/locte/metsci Feeding co-extruded flxseed to pigs: Effects of durtion nd feeding level on
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationThe Effects of Metabolizable Energy Inclusion Rates on Feed Efficiency in Broilers
The Effects of Metolizle Energy Inclusion Rtes on Feed Efficiency in Broilers Presented y: Molly Cutter, Kevin Ksch, Eric Frzier, Sr Ludington, Michelle Sirum, Linne Olson Astrct: An experiment ws conducted
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationReplacing Fish Meal with Soybean Meal and Brewer s Grains with Yeast in Diets for Australian Red Claw Crayfish, Cherax quadricarinatus
Replcing Fish Mel with Soyben Mel nd Brewer s Grins with Yest in Diets for Austrlin Red Clw Cryfish, Cherx qudricrintus Lur A. Muzinic*, Kenneth R. Thompson, & Crl D. Webster Introduction Soyben mel (SBM)
More informationEgg quality, fatty acid composition and immunoglobulin Y content in eggs from laying hens fed full fat camelina or flax seed
Cherin nd Quezd Journl of Animl Science nd Biotechnology (2016) 7:15 DOI 10.1186/s40104-016-0075-y RESEARCH Open Access Egg qulity, ftty cid composition nd immunogloulin Y content in eggs from lying hens
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationScholarly Research Exchange
Scholrly Reserch Exchnge Volume 9 Article ID 7959 doi:1.3814/9/7959 Reserch Article Different Dietry Levels of Protein to Lipid Rtio Affected Digestive Efficiency, Skeletl Growth, nd Muscle Protein in
More informationMartinez-Rubio et al. BMC Genomics 2014, 15:462
Mrtinez-Rubio et l. BMC Genomics 2014, 15:462 RESEARCH ARTICLE Open Access Effects of functionl feeds on the lipid composition, trnscriptomic responses nd pthology in hert of Atlntic slmon (Slmo slr L.)
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationEFFECT OF PHOTOPERIOD AND TRYPTOPHAN AMINO ACID SUPPLEMENTATION ON PINEAL GLAND HORMONE (MELATONIN) AND ITS RELATION TO PERFORMANCE IN LOCAL STRAIN.
Egypt. Poult. Sci. Vol (30) (IV): (927-960) EFFECT OF PHOTOPERIOD AND TRYPTOPHAN AMINO ACID SUPPLEMENTATION ON PINEAL GLAND HORMONE (MELATONIN) AND ITS RELATION TO PERFORMANCE IN LOCAL STRAIN. 1- EFFECT
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationEvaluation of Sun and Oven-Dried Broiler Offal Meal as Replacement for Fishmeal in Broiler and Layer Rations
Interntionl Journl of Poultry Science 5 (7): 646-650, 2006 ISSN 1682-8356 Asin Network for Scientific Informtion, 2006 Evlution of Sun nd Oven-Dried Broiler Offl Mel s Replcement for Fishmel in Broiler
More informationThe Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers
Beef Reserch Report, 2000 Animl Science Reserch Reports 2001 The Effects of High-Oil Corn or Typicl Corn with or without Supplementl Ft on Diet Digestibility in Finishing Steers Crig R. Belknp Iow Stte
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationThe Effects of Decorticated Sunflower Meal as a Substitute for Groundnut Meal in Broiler Diet
The Effects of Decorticted Sunflower Mel s Sustitute for Groundnut Mel in Broiler Diet Mohmed E. Ahmed, Nivin M. Elfki nd Tlh E. As Astrct An experiment involving 160, one dy old unsexed Hurd roiler chicks
More informationAmino Acid Density and L-Threonine Responses in Ross Broilers 1,2
Interntionl Journl of Poultry Science (): 8-6, 00 ISSN 68-86 Asin Network for Scientific Informtion, 00 Amino Acid Density nd L-Threonine Responses in Ross Broilers, M.T. Kidd, W.S. Virden, A. Corzo, W.A.
More informationEffect of Field Pea Replacement and Yucca schidigera extract on weaning transition growth and feedlot performance
Effect of Field Pe Replcement nd Yucc schidiger extrct on wening trnsition growth nd feedlot performnce D.G. Lndblom 1 nd J. Pennington 2 1 Dickinson Reserch Extension Center, Dickinson, ND 2 Dickinson
More information2012 Small Grain Forage Trial Nitrogen Fertility and Harvest Date
212 Smll Grin Forge Tril Nitrogen Fertility nd Hrvest Dte Dr. Hether Dry, UVM Extension Agronomist Susn Monhn, Eric Cummings, Hnnh Hrwood, nd Roslie Mdden UVM Extension Crops nd Soils Technicins 82-524-651
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationBright Futures Medical Screening Reference Table 2 to 5 Day (First Week) Visit
Bright Futures Medicl Reference Tle 2 to 5 Dy (First Week) Visit Universl Action Metolic nd Verify documenttion of neworn metolic screening results, pproprite rescreening, nd needed follow-up. Document
More informationAlpha linolenic acid in maternal diet halts the lipid disarray due to saturated fatty acids in the liver of mice offspring at weaning
Shomonov-Wgner et l. Lipids in Helth nd Disese (2015) 14:14 DOI 10.1186/s12944-015-0012-7 RESEARCH Open Access Alph linolenic cid in mternl diet hlts the lipid disrry due to sturted ftty cids in the liver
More informationEnhanced glutathione peroxidases (GPx) activity in young barley seedlings enriched with selenium
Africn Journl of Biotechnology Vol. 10(55), pp. 11483-11487, 21 Septemer, 2011 Aville online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB11.1480 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationB. Koven 1*, E. Gisbert 2, O. Nixon 1, I. Meiri-Ashkenazi 1, A. Gaon 1, M.M. Solovyev 3,4, A. Tandler 1, H. Rosenfeld 1
DESIGNING WEANING DIETS BASED ON THE ONTOGENY OF DIGESTIVE TRACT ENZYME ACTIVITY DURING THE CARNIVOROUS-OMNIVOROUS TRANSITION IN GREY MULLET (MUGIL CEPHALUS) JUVENILES B. Koven 1*, E. Gisert 2, O. Nixon
More information