Offspring subcutaneous adipose markers are sensitive to the timing of maternal gestational weight gain

Transcription

1 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 DOI /s RESEARCH Open Access Offspring sucutneous dipose mrkers re sensitive to the timing of mternl gesttionl weight gin Lind Gilin 1*, Christin Drimont 2, Ptrici Leone 2, Louise B McNmr 1,3, Florence Blncher 2, Dongh Berry 3, Eurídice Cstñed-Gutiérrez 2 nd Pedr G Lwlor 3 Astrct Bckground: Excessive mternl weight gin during pregnncy impcts on offspring helth. This study focused on the timing of mternl gesttionl weight gin, using porcine model with mothers of norml pre-pregnncy weight. Methods: Tril design ensured the trjectory of mternl gesttionl weight gin differed cross tretments in erly, mid nd lte gesttion. Diet composition did not differ. On dy 25 gesttion, sows were ssigned to one of five tretments: Control sows received stndrd gesttion diet of 2.3 kg/dy (30 MJ DE/dy) from erly to lte gesttion (dy gesttion). E sows received 4.6 kg food/dy in erly gesttion (dy gesttion). M sows douled their food intke in mid gesttion (dy gesttion). EM sows douled their food intke during oth erly nd mid gesttion (dy gesttion). L sows consumed 3.5 kg food/dy in lte gesttion (dy gesttion). Offspring ody weight nd food intke levels were mesured from irth to dolescence. Mrkers of lipid metolism, hypertrophy nd inflmmtion were investigted in sucutneous dipose tissue of dolescent offspring. Results: The trjectory of gesttionl weight gin differed cross tretments. However totl gesttionl weight gin did not differ except for EM sows who were the heviest nd fttest mothers t prturition. Offspring irth weight did not differ cross tretments. Sucutneous dipose tissue from EM offspring differed significntly from controls, with elevted mrna levels of lipogenic (CD36, ACACB nd LPL), nutrient trnsporters (FABP4 nd GLUT4), lipolysis (HSL nd ATGL), dipocyte size (MEST) nd inflmmtion (PAI-1) indictors. The sucutneous dipose depot from L offspring exhiited elevted levels of CD36, ACACB, LPL, GLUT4 nd FABP4 mrna trnscripts compred to control offspring. Conclusions: Incresing gesttionl weight gin in erly gesttion hd the gretest impct on offspring postntl growth rte. Incresing mternl food llownce in lte gesttion ppered to shift the offspring dipocyte focus towrds ccumultion of ft. Mothers who gined the most weight during gesttion (EM mothers) gve irth to offspring whose sucutneous dipose tissue, t dolescence, ppered hyperctive compred to controls. This study concluded tht mothers, who gined more thn the recommended weight gin in mid nd lte gesttion, put their offspring dipose tissue t risk of dysfunction. Keywords: Mternl food intke, Gesttionl weight gin, Sucutneous dipose tissue * Correspondence: Lind.Gilin@tegsc.ie 1 Tegsc Food Reserch Centre, Mooreprk, Fermoy, Co.Cork, Irelnd Full list of uthor informtion is ville t the end of the rticle 2015 Gilin et l.; licensee BioMed Centrl. This is n Open Access rticle distriuted under the terms of the Cretive Commons Attriution License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided the originl work is properly credited. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.

2 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 2 of 16 Bckground Thirty per-cent of 7 yer old children in Europe re overweight or oese [1]. Childhood oesity trcks to dulthood [2]. An oese child hs more thn 60% chnce of eing oese in dulthood [2]. Oese girls grow up to e oese women who give irth to ies who re destined to e oese themselves [2]. Although the root cuse of oesity is excess cloric intke compred with expenditure, it is now ccepted tht n dverse (excess or restricted) nutrient supply in erly life is linked to oesity nd oesity-relted disorders in lter life [2-5]. Prentl overnutrition cn permnently chnge offspring energy homeostsis [5], ppetite drive nd dipocyte function [6,7]. Adipocytes re ft storge cells plying mjor role in metolic hemostsis. In oese individuls, dipocytes re dysfunctionl [8]. The effects of mternl overnutrition on offspring re prticulrly relevnt in modern dy life, where high mternl Body Mss Index (BMI) nd/or lrge mternl gesttionl weight gin re common plce [2,3,9]. Rts fed high ft pltle diet gve irth to offspring with greter diposity, incresed serum glucose nd elevted lipogenic ctivity in white dipose tissue t dulthood [10]. In sheep experimentl models, mternl overnutrition prior to nd during pregnncy gve irth to offspring of similr irth weight. However y dulthood, these offspring hd incresed ft mss % (20.8% versus 16.5% for controls), incresed feed intke y 10% nd incresed glucose-insulin selines when fed d liitum [11]. The timing of mternl mlnutrition is lso importnt for offspring helth sttus [12]. Women with helthy weight pre-pregnncy, BMI of , re dvised to gin kg during pregnncy which includes mximum of 2 kg in the 1st trimester followed y kg per week therefter. Epidemiologicl dt from episodes of fmine hve demonstrted tht mternl undernutrition during the emryonic nd plcentl stge ffects offspring crdiovsculr helth [12,13]. Mternl undernutrition during mid gesttion results in offspring renl nd dipose tissue dysfunction [12,13]. Mternl dietry restrictions imposed in lte gesttion compromise offspring metolism nd sucutneous to viscerl dipose rtios [13,14]. Adipose tissue is prticulrly susceptile to developmentl progrmming s result of mternl nutrition in utero [6,7]. Mternl mlnutrition is cple of ltering dipocyte numer, size, mturtion nd cpcity to store ft [15]. Any permnent ltertion to dipocyte numer or function in utero hs serious consequences for dipose tissue for life. Adipose tissue is n unusul tissue s it is cple of unlimited growth in dulthood [16]. The sucutneous dipose depot is the primry nd initil ft storge fcility in the helthy weight individul. When it s cpcity to store ft is exceeded, ft storge spills over into viscerl dipose depots [17]. Viscerl nd sucutneous dipocytes in oese individuls exhiit dysregultion of lipogenesis nd lipolysis, ltered endocrine function nd incresed level of mcrophge infiltrtion [8,18]. A dysfunctionl dipocyte due to mternl mlnutrition does not necessrily mnifest s n ltertion in offspring ody weight [14,16], rther ody composition (% ft mss) my e ltered [14,19]. Indeed n underlying dipocyte dysfunction my only ecome pprent lter in life nd/or when the offspring is chllenged postntlly with n undnt supply of highly pltle, high ft food [10,19]. As rodents self limit their food intke, rodent models for mternl overnutrition must rely on either modifictions to the diet composition or gstric cnnultion [20]. The pig is n lterntive niml model. Pigs do not generlly exhiit self limittion of food intke nd will ecome overweight when given d liitum ccess to food [21]. In ddition, pigs disply mel eting pttern, re omnivores nd hve similr metolism, digestive trct, crdiovsculr system nd proportionl orgn sizes to humns [22]. Pigs, however, re orn with only 2% ody ft compred to 15% in humns [23]. Piglets will rpidly rech 15% ody ft within 28 dys of irth [24]. The im of this study ws to investigte whether extr mternl nutrition t different windows of gesttion cn lter mrkers of lipid metolism, hypertrophy nd inflmmtion in sucutneous dipose tissue of offspring. Sucutneous dipose tissue is the lrgest ft depot in young pigs [22]. The tissue ws hrvested t dolescence s juvenile dipose tissue my e poor predictor of lter function [25]. Selecting sows of norml nd similr pre-pregnncy weight llowed us to focus solely on gesttionl weight gin. The tril design ttempted to keep overll mternl ckft increses cross tretments close to norml rnges, whilst differing the mount of weight gin in erly, mid nd lte pregnncy. Previous results from this tril indicted tht offspring from mothers who were overfed in erly gesttion hd modified muscle composition with reduced intrmusculr ft levels nd incresed type IIA muscle fires in their semitendinosus muscle [26,27]. The porcine foetl sucutneous dipose tissue undergoes rpid development in mid to lte gesttion (dy 50 to prturition (dy 115)) with lipid deposition commencing y dy 60 gesttion, opening of dipocyte cluster y dy 75 nd growth of configured dipocytes from dy 105 gesttion [28]. Bsed on this timeline, our hypothesis ws tht incresed food intke y the mother in mid to lte gesttion would hve the gretest effect on offspring dipocyte function.

3 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 3 of 16 Methods Animls nd tretments This experiment complied with the EU Council Directive 91/630/EEC, which lys down minimum stndrds for the protection of pigs [29]. It lso complied with the EU Council Directive 98/58/EC, concerning the protection of nimls kept for frming purposes [29]. The tril ws conducted in ccordnce with the Interntionl Guiding Principles for Biomedicl Reserch Involving Animls s issued y the Council for the Interntionl Orgniztions of Medicl Sciences in The tril commenced nd finished in A totl of 65 multiprous Lndrce x Lrge White crossred sows were rtificilly inseminted using the pooled semen from 7 Hylen Lrge White ors (Hermitge AI, Co. Kilkenny, Irelnd). The ingredient composition nd chemicl nlysis of the diets re listed in Tle 1. As per recommendtions [30], ll sows were fed 1.8 kg/dy (23.5 MJ DE/dy) of stndrd gesttion diet from service to dy 25 gesttion. On dy 25, sows were ssigned to one of five tretments lnced for prity nd weight (Tle 2). Diet composition did not differ cross tretments. Control (C) sows followed the feed intke recommendtions for the gestting sow which included stndrd gesttion diet of 2.3 kg/dy dry mtter sis (30 MJ DE/dy) from dy 25 to dy 110 gesttion (Tle 2) [30,31]. E sows received n incresed feed llownce to 4.6 kg/dy (60 MJ Tle 1 Ingredient composition nd nutrient content of experimentl diets on mel equivlent sis (g/kg) Diet type Gesttion Lcttion Strter Link Wener Finisher Whet ndc ndc Brley ndc ndc Soy ndc ndc Full ft soy 0 ndc ndc Soy oil ndc ndc Minerl nd vitmins ndc ndc 3 1 Lysine HCl c ndc ndc 4 3 DL-Methionine c ndc ndc L-Threonine c ndc ndc Di-clcium phosphte 5 5 ndc ndc 5 Limestone flour ndc ndc Slt 4 4 ndc ndc 3 3 Pulmotil d 0 0 ndc Phytse 5000, e IU/g ndc ndc Chemicl composition, g/kg Dry mtter Crude Protein Ft Crude fire Ash Lysine f Digestile energy, f MJ/kg Sow, wener nd finisher diets were mnufctured onsite. Strter nd link diets were mnufctured y Devenish Nutrition (Belfst, Northern Irelnd). Commercil diets for which the ingredient composition ws not disclosed (ndc). Provided per kilogrm of complete diet. Gesttion nd lcttion diets: Cu, 38 mg; Fe, 70 mg; Mn, 62 mg; Zn, 80 mg; I, 0.6 mg; Se, 0.2 mg; vitmin A, IU; vitmin D 3, 1000 IU; vitmin E, 100 IU; vitmin K, 2 mg; vitmin B 12,15μg; rioflvin, 5 mg; nicotinic cid, 12 mg; pntothenic cid, 10 mg; choline chloride, 500 mg; Biotin, 200 μg; Folic cid, 5 mg; vitmin B 1, 2 mg nd vitmin B 6, 3 mg. Wener diet: Cu, 175 mg; Fe, 140 mg; Mn, 47 mg; Zn, 120 mg; I, 0.6 mg; Se, 0.3 mg; vitmin A, 6000 IU; vitmin D 3, 1000 IU; vitmin E, 100 IU; vitmin K, 4 mg; vitmin B 12,15μg; rioflvin, 2 mg; nicotinic cid, 12 mg; pntothenic cid, 10 mg; choline chloride, 250 mg; vitmin B 1, 2 mg; vitmin B 6, 3 mg; nd endox, 60 mg. Finisher diet: Cu, 100 mg; Fe, 40 mg; Mn, 31 mg; Zn, 80 mg; I, 0.3 mg; Se, 0.2 mg; vitmin A, 2000 IU; vitmin D 3, 500 IU; vitmin E, 40 IU; vitmin K, 4 mg; vitmin B 12,15μg; rioflvin, 2 mg; nicotinic cid, 12 mg; pntothenic cid, 10 mg; vitmin B 1, 2 mg nd vitmin B 6, 3 mg. c Synthetic mino cids. d Link diet contined 200 mg Tilmicosin per kg of feed provided from Pulmotil G100 (Eli Lilly, Bsingstoke, Hmpshire, Englnd). e Sow, wener nd finisher diets contined 500 FTU phytse per kg finished feed from Ntuphos 5000 (BASF, Ludwigshfen, Germny). f Clculted vlues.

4 Tle 2 Food intke of sows during gesttion Sow tretment : Food intke per dy Gesttion dys % gesttion C E M EM L completed Dys % 1.8 kg (23.5 MJ DE/dy) 1.8 kg (23.5 MJ DE/dy) 1.8 kg (23.5 MJ DE/dy) 1.8 kg (23.5 MJ DE/dy) 1.8 kg (23.5 MJ DE/dy) Dys % 2.3 kg (30 MJ DE/dy) 4.6 kg (60 MJ DE/dy) 2.3 kg (30 MJ DE/dy) 4.6 kg (60 MJ DE/dy) 2.3 kg (30 MJ DE/dy) Dys % 2.3 kg (30 MJ DE/dy) 2.3 kg (30 MJ DE/dy) 4.6 kg (60 MJ DE/dy) 4.6 kg (60 MJ DE/dy) 2.3 kg (30 MJ DE/dy) Dys % 2.3 kg (30 MJ DE/dy) 2.3 kg (30 MJ DE/dy) 2.3 kg (30 MJ DE/dy) 2.3 kg (30 MJ DE/dy) 3.5 kg (46 MJ DE/dy) Dys % 1.8 kg (25.6 MJ DE/dy) 1.8 kg (25.6 MJ DE/dy) 1.8 kg (25.6 MJ DE/dy) 1.8 kg (25.6 MJ DE/dy) 1.8 kg (25.6 MJ DE/dy) C were Control Sows tht received 2.3 kg/dy food from dy 25 to dy 110 gesttion, E sows consumed 4.6 kg/dy food in erly (dys 25 to 50) gesttion, M sows received 4.6 kg/dy in mid gesttion (dys 50 to 80), EM sows received 4.6 kg/dy in erly nd mid gesttion (dys 25 to 80) nd L sows received 3.5 kg/dy from dys 80 to 110 of gesttion. Food intke per dy is expressed s kg of food nd s digestile energy (DE). Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 4 of 16

5 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 5 of 16 DE/dy) erly in gesttion, from dy 25 to dy 50 gesttion. M sows received 4.6 kg food/dy in mid-gesttion, from dy 50 to dy 80 gesttion. EM sows received 4.6 kg/dy in erly nd mid gesttion, from dys 25 to 80 gesttion. L sows received 3.5 kg food/dy (45.5 MJ DE/dy) in lte gesttion, from dy 80 to 110 gesttion. At the end of n incresed feeding period, sow feed llownce returned to 2.3 kg/dy (Tle 2). At dy 110, pproximtely 5 dys efore prturition, ll sows were trnsferred onto lcttion diet of 1.8 kg/dy (25.6 MJ DE/dy) in preprtion for prturition nd lcttion (Tle 2). Sows consumed ll food lloctions received. Ad liitum for pregnnt sows pproximtes 4.6 kg food intke per dy [26] with d liitum feeding in lte gesttion reducing to 3.5 kg/dy. The numer of sows included in the nlysis ws 10 C sows, 15 E sows, 13 M sows, 12 EM sows nd 11 L sows. At prturition, the progeny from ech sow were weighed individully nd tgged for identifiction purposes. Within ech tretment, litter size ws stndrdised to 10 piglets per litter y cross fostering. All litters received strter diet (Creep fed) from dy 12 post-ntl to wening (dy 28 post-ntl). At wening, three sme gender pigs from ech litter were selected sed on irth weight ctegory (light, medium nd hevy). The solute lightest, heviest nd medium weight pigs estlished within ech litter were selected. Therefore, t wening, totl of 240 pigs (120 femles nd 120 entire mles) were weighed nd penned individully. By dy 77 this numer ws reduced to 180 pigs, due to housing restrictions. This ws chieved y removing 12 pigs in ech tretment (ll pigs from 2 rndomly selected litters within tretment). Pigs were fed 3 times dily in the first week nd d liitum therefter. Food intke ws recorded weekly. Pigs were weighed t irth, t wening (dy 28) nd t dys 41, 55, 76, 118 nd 159. Housing conditions for sows nd pigs re descried previously [32]. Crcss mesurements Pigs were trnsported 107 km to the ttoir nd killed y leeding fter CO 2 stunning. Muscle depth nd ckft thickness, t 6 cm from the edge of the split ck t the level of the 3rd nd 4th lst ri, were mesured using Hennessy grding proe (Hennessy nd Chong, Aucklnd, New Zelnd). Cold crcss weight ws estimted s the weight of the hot eviscerted crcss, (minus tongue, ristles, genitl orgns, kidneys, flre ft nd diphrgm) 45 min fter hrvest x Formul for estimte len met content (%) = x y, where x = ft depth (mm); y = muscle depth (mm) [33]. Tissue smpling, RNA extrction nd cdna synthesis Eighteen representtive pigs from ech tretment (9 femle (3 light, 3 medium, 3 hevy irthweight) nd 9 mles (3 light, 3 medium, 3 hevy irthweight)) were selected rndomly t slughter for dipose tissue smpling. Sucutneous dipose tissue (0.5 cm in depth) ws excised from t the ckft mesurement position, immersed in RNA-lter (Amion Inc., U.S.A.) nd stored t 4 C overnight. Within 24 hours of hrvest, these sucutneous dipose smples were trnsferred to 80 C for rchivl storge. Totl RNA ws extrcted y homogenistion of pproximtely 75 mg dipose tissue using the Agencourt RNAdvnce Tissue protocol ccording to the mnufcturer s instructions (Beckmnn Coutler, U.S.A.) which included DNAse1 tretment (20units/smple) step. Qulity nd quntity of totl RNA ws determined y opticl density redings t 260 nm nd 280 nm using Nnodrop ND-1000 (Thermo scientific, USA) nd y the Agilent Bionlyzer system (Agilent, U.S.A). OD260:280 rtios were ll ove 1.8. RNA extrctions were performed in duplicte for ech dipose tissue smple. Totl RNA smples were stored t 20 C. Totl RNA (0.3 μg) ws reverse trnscried into cdna using the PrimeScript 1st strnd cdna synthesis kit (Tkr, Jpn) in the presence of 20units RNAse Inhiitor, ccording to mnufcturer s instructions into finl volume of 20 μl nd stored t 20 C. Reverse trnscription rections were performed in duplicte on ech RNA smple. Asolute quntifiction y rel-time PCR Tle 3 lists the Gennk ccession numers, primer sequences, nneling tempertures nd mplicon sizes of the porcine trget RNA. Rel time quntittive PCR nlyses ws performed following MIQE stndrds [34]. Complementry DNA (1 μl of 1/2.5 dilution of cdna synthesis rection), sense nd ntisense primers (0.45 μm ech) ws dded to SYBR Green 1 PCR core regents (Applied Biosystems, Life Technologies, U.S.A.) to finl volume of 10 μl using in n ABI prism 7900HT Sequence Detection system Instrument (Applied Biosystems, Life Technologies, U.S.A.). The therml cycling protocol ws s follows: 2 min t 50 C, 1 cycle of denturtion t 95 C for 10mins followed y 40 cycles of mplifiction 95 C for 15 sec nd 60 C for 1 min. Cycle threshold (C T ) vlues were the mens of t lest duplicte experiments. Dt were discrded nd the experiment repeted if there ws 1 cycle difference in Ct vlue within duplictes on the sme plte. A no DNA templte ws run s negtive control on ech plte. A melting curve nlysis ws performed to scertin single product specific melting tempertures. Complementry DNA smples were pooled to generte n inter plte control for ech gene. The rel time efficiency of ech gene ws clculted using 7 point 4 fold dilution series of cdna. The efficiencies rnged from %. A gene tht encodes component of the 60S suunit riosoml protein, rplpo, ws stly expressed in our smples nd therefore selected s the reference trget. Inter ssy nd

6 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 6 of 16 Tle 3 Gene nmes, primers, gennk ccession numers, nneling temperture nd size of mplicons Gene Primer sequence (5-3 ) Gennk T* Amplicon Accession No. ( C) size (p) MEST (Peg-1) TGGAGGCGTGCTGTCACCCA NM_ ACTGGGGTGAGACCCCGAGAG 59 LEP (Leptin) TCCAGGATGACACCAAAACCCTCA NM_ GGTGACCCTCTGTTTGGAGGAGACA 60 PPARGC1 (PGC-1α) GGCAATTGAAGAACGTCGTGT NM_ GGTCCCTCAGTTCTGTCCGT 61 CASP1 (Cspse-1; ICE; IL1BC; P45) GGAGACGACCCCCACCTTGC NM_ GGAGGAACCACCGCCTGGGAT 60 MCP1 (CCL2; SCYA2) GGTCCTTGCCCAGCCAGATGC NM_ TCATCAGCCGCTGCATCGAGA 58 PAI-1 (SERPINE-1) CGGACCACGGTCAAGCAGGTG NM_ CACCAGAACCAGGCGCGTCA 60 IL-18 ACCAGGGACATCAAGCCGTGT NM_ ACTGCCAGACCTCTAGTGAGGC 57 ACACB (ACC2) TGCCGTGTCCCTGTTTGGGC NM_ AGGCGCACAGCACACTGCTC 60 FABP4 GCAGATGACAGGAAAGTCAAGAGCA NM_ CCTGTACCAGGGCGCCTCCA 60 HSL (LIPE) AGTGCCTATGCTGGCGGGGA NM_ CCCAGGCGGAGGTCTCGGAA 60 LPL GTCTCGGGCCCAGCAGCATT NM_ GCGTGGGCTCCAAGGCTGTA 59 CD36 GCTGTGGCAGCTGTACCCCA NM_ TGGATCCGGATAGCCCCACAAT 57 GLUT4 (SLC2A4) CGGCATGGGTTTCCAGTATG NM_ CGCGAAGAGAAGGAAGACGTA 58 ATGL (PNPLA2) GGCGGAACGGCCTCCTGAAC NM_ TTGGCTCCGGCCCTCTCCTC 60 * T Anneling temperture C. intr-ssy vrition ws less thn 5%. For ech smple, the reltive mount of trget ws clculted y the 2 ΔCT formul (using the comprtive C T method [35]) where ΔC T =C T Trget - C T reference. Primers for rel-time PCR were designed cross intron/exon oundries where possile, to prevent mplifiction from porcine genomic DNA. Sttisticl nlysis The experiment ws completely rndomized design. Dt were nlysed using SAS (SAS Inst. Inc., Cry NC, U.S.A.). When the dependent vrile under investigtion ws trit of the sow, dt were nlysed using fixed effects models in PROC GLM in SAS (SAS Inst. Inc., Cry NC, U.S.A) with effects for tretment, prity group nd their two-wy interction included in the model. Sow ws the experimentl unit. Sow ody weight nd sow ckft t dy of insemintion were used s covrites when the dependent vrile ws sow weight, nd sow ckft, respectively. A single degree of freedom contrst ws used to compre tretment C with ll other tretments. Differences etween tretment mens were compred using Duncn s multiple rnge test. Results were considered sttisticlly significnt when P 0.05 nd were considered s tendencies when 0.05 < P < Offspring dily live-weight gin, verge dily feed intke, crcss trits nd RNA dt were nlysed using mixed model in PROC MIXED in SAS (SAS Inst. Inc., Cry NC, U.S.A) with tretment, gender, irth weight ctegory (i.e. light, medium nd hevy) nd their interctions s fixed effects. Sow ws included s rndom effect. The numer of pigs orn live ws included s

7 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 7 of 16 covrite when significnt. Dt not normlly distriuted ws log trnsformed. Results Tril design Gesttionl length in pigs is pproximtely 115 dys. Control (C) sows consumed stndrd gesttion diet (1.8 kg food/dy (23.5 MJ DE/dy) from dy 1 to dy 24 gesttion, 2.3 kg food/dy (30 MJ DE/dy) from dy 25 to 110 gesttion, followed y 1.8 kg food/dy (25.6 MJ DE/dy) from dy 111 to prturition (Tle 2). This level of food intke provides sufficient energy for 195 kg sow t dy 1 gesttion, to rech trget totl gesttionl weight gin of pproximtely 50 kg nd ckft increse of 9 mm [30,31]. Overfeeding prior to dy 25 gesttion is not recommended due to n incresed risk of emryo deth [31,30]. As such, the erliest dietry intervention ws t dy 25 gesttion. E sows consumed 4.6 kg/dy food in erly gesttion (dys 25 to 50 gesttion) (Tle 2). M sows received 4.6 kg/dy in mid gesttion (dys 50 to 80) (Tle 2). EM sows received 4.6 kg/ dy in erly nd mid gesttion (dys 25 to 80) (Tle 2). L sows were fed to ppetite (3.5 kg/dy) from dys 80 to 110 of gesttion (Tle 2). Diet composition did not differ cross tretments. Mternl gesttionl weight gin trjectory All sows hd similr ody weights t service (189.2 kg, SEM 1.1, P > 0.05). The effect of tretment on sow ody weight during gesttion did not differ y prity. At the end of gesttion (dy 110), only tretment EM sows were hevier thn tretment C sows (275.8 kg versus kg, SEM 5.09, P < 0.05). However, timing of gesttionl weight gin differed cross tretments (Figure 1). From dy 25 to 50 gesttion, E nd EM sows gined significntly more weight thn tretment C, M nd L sows (P < 0.05). From dy 50 to 80 gesttion, M sows gined significntly more weight thn ll other tretments (P < 0.05). In contrst, within this time period, E sows gined significntly less weight thn ll tretments (P < 0.05). From dy 80 to 110 gesttion, L sows gined significntly more weight thn ll other tretments (P < 0.05). Within this time period, C sows hd similr weight gins to E nd EM sows (P > 0.05) ut significntly greter weight gins thn M sows (P < 0.05). Tretment M hd similr weight gins to EM sows (P > 0.05) (Figure 1). Mternl gesttionl ckft All sows hd similr ckft mesurements t service (12.4 mm, SEM 0.29, P > 0.05) (Tle 4). At dy 50 of gesttion, sows from tretment EM hd greter ckft depth thn C sows (P < 0.05). This ws still evident t dy 80 (P < 0.05) nd dy 110 gesttion (P 0.05). Tretments M sows lso hd incresed ckft depth thn C sows t dy 80 gesttion (P < 0.05) nd tendency to hve higher ckft t dy 110 gesttion (P < 0.1). Offspring phenotypes Offspring from this study were 159 dys old t slughter, corresponding to humn dolescence [22]. Post wening, offspring were given d liitum ccess to food. The effect of tretment on offspring weight nd ody Sow gesttionl weight gin (kg) c d c cd Sow Tretment Figure 1 Mternl weight gin during gesttion. Control C Sows (n = 10) received 2.3 kg/dy food from dy 25 to 110 gesttion, E sows (n = 15) received 4.6 kg/dy food in erly gesttion (dys 25 to 50), M sows (n = 13) received 4.6 kg/dy in mid gesttion (dys 50 to 80), EM sows (n = 12) received 4.6 kg/dy in erly nd mid gesttion (dys 25 to 80) nd L sows (n = 11) received 3.5 kg/dy from dys 80 to 110 of gesttion. Colour coding; lue depicts weight gin from service to dy 25 gesttion, yellow depicts weight gin from dy 25 to dy 50 gesttion, green depicts weight gin from dy 50 to dy 80 gesttion nd pink depicts weight gin from dy 80 to dy 110 gesttion. Vlues represent Duncn s mens. Different superscripts indicte significnt differences (P < 0.05) etween tretments within the sme time intervl.

8 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 8 of 16 Tle 4 Effect of tretment on sow ckft during gesttion Gesttion feeding tretment P-vlue C E M EM L SEM Trt C v E C v M C v EM C v L No. of sows Sow ckft, mm At service Dy 25 gesttion Dy 50 gesttion Dy 80 gesttion Dy 110 gesttion C were Control Sows tht received 2.3 kg/dy food from dy 25 to dy 110 gesttion, E sows consumed 4.6 kg/dy food in erly gesttion (dys 25 to 50), M sows received 4.6 kg/dy in mid gesttion (dys 50 to 80), EM sows received 4.6 kg/dy in erly nd mid gesttion (dys 25 to 80) nd L sows received 3.5 kg/dy from dys 80 to 110 of gesttion. A P vlue of < 0.05 indictes significnce. composition hs een presented, in prt, previously [27] nd together with food intke dt is summrized in Tle 5. Birth weight of offspring ws not ffected y tretment of sows (P > 0.05). However offspring weight trjectories, food intke nd ody composition t slughter were influenced y mternl food lloction during gesttion (Tle 5). There ws tretment y irth weight interction for offspring food intke from dy 41 to 55 nd from wening to dy 76. There ws tretment y gender interction for offspring food intke from ll time points recorded from dy 76 to 159 nd overll from wening to 159 dys old. In ddition, there ws tretment y gender interction, t slughter, for oth offspring len % nd muscle depth with tendency oserved for ckft mesurements. At wening, offspring orn to E sows were hevier thn offspring orn to C sows (P < 0.05) (Tle 5). From dy 76 to 118 dys old, tretment E offspring tended to hve reduced food intke compred to tretment C offspring. As such on dy 118 (P < 0.05) nd on dy 159 (P < 0.05), offspring orn to E sows were lighter thn offspring orn to C sows. At slughter, tretment E offspring hd lighter crcss weight (P < 0.05) nd reduced ckft (P < 0.01) thn tretment C offspring. Tretment M offspring were hevier thn tretment C offspring t wening ge (P < 0.01). From wening to dy 41, tretment M offspring te less thn C offspring (P < 0.001). Although there ws no difference in live weight t slughter, M offspring hd lighter crcss weight (P < 0.05) reduced ckft (P <0.01) nd incresed len met % (P < 0.01) compred to tretment C offspring. Tretment EM offspring hd similr weight trjectory, food intke level nd ody composition to tretment C offspring. Tretment L offspring were lighter thn tretment C offspring on dy 118 (P < 0.05) nd on slughter dy (P < 0.05) ut crcss weight, ckft thickness nd % len t slughter were similr. Offspring irth weight nd gender effects hve een discussed previously [27]. Briefly, offspring irth weight hd significnt influence on offspring weight t ll time points, food intke t ll time points, except dy 118 to 159, crcss weight nd muscle depth. Mle offspring tended to e hevier thn femle offspring t dy 159 (94.5 kg versus 91.8 kg, SEM 1.42 P < 0.1). Gender influenced food intke with mles hving reduced food intke compred to femles from ll time points from dy 55 to 159 nd overll from wening to dy 159 (1570 g versus 1624 g, SEM 21 P < 0.01). Mles hd greter ckft depth, less muscle depth nd reduced % len thn femles [27]. Offspring sucutneous dipose signls To determine whether dipose signls were different in offspring from mothers with different gesttionl weight gin ptterns, mrna levels of pnel of genes were quntified in sucutneous dipose tissue hrvested from dolescent offspring. Figures 2, 3 nd 4 detil levels of lipid metolism, dipocyte hypertrophy nd inflmmtion mrna mrkers, compred to riosoml rplpo mrna levels, in offspring sucutneous dipose tissue. Levels of mrna GLUT4, which codes for the mjor glucose trnsporter in dipocytes [36] were higher in tretment EM (2.8 fold increse, P < 0.05) nd L offspring (4.6 fold increse, P < 0.001) compred to tretment C offspring (Figure 2). Levels of mrna FABP4, which codes for mjor lipid trnsport protein in mture dipocytes [37] were elevted in offspring orn to tretment EM (1.5 fold increse, P < 0.01) nd L (1.5 fold increse, P < 0.01) mothers compred to their control counterprts (Figure 2). CD36 codes for memrne glycoprotein which inds long chin ftty cids for trnsport into cells [38]. CD36 mrna levels were incresed in tretment M

9 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 9 of 16 Tle 5 Effect of mternl tretment on offspring from irth to dolescence Tretments* P C E M EM L N se VALUE WEIGHTS (kg) Birth weight Wening weight 7.59c c 7.60c <0.01 Weight Dy Weight Dy Weight Dy Weight Dy <0.05 Weight Dy <0.05 DAILY FEED INTAKE (g) Wening to Dy c <0.001 Dy 41 to Wening to Dy Dy 55 to Wening to Dy Dy 76 to Dy 118 to Dy 76 to Wening to Dy SLAUGHTER DATA Crcss weight (kg) <0.05 Ft (mm) c 9.2c <0.01 Len (%) 58.5c c 59.0c <0.01 *C = Control Sows consumed 2.3 kg/dy food from dy 25 to 110 gesttion, E sows consumed 4.6 kg/dy food in erly (dys 25 to 50) gesttion, M sows consumed 4.6 kg/dy in mid gesttion (dys 50 to 80), EM sows consumed 4.6 kg/dy in erly nd mid gesttion (dys 25 to 80) nd L sows received 3.5 kg/dy from dys 80 to 110 of gesttion. N = numer of Offspring. Wening of offspring occurred t dy 28. Offspring were slughtered t 159 dys old. Different superscripts, within the row, indicte significnt differences. P vlue < 0.1 is defined s tendency nd < 0.05 is significnt. (1.6 fold increse P < 0.01), EM (1.8 fold increse, P < ) nd L (2 fold increse, P < ) offspring compred to tretment C offspring (Figure 2). HSL nd ATGL code for enzymes tht regulte the hydrolysis nd moiliztion of tricylglycerol stored in dipose cells into non-esterified ftty cids nd glycerol for circultion [39]. HSL mrna levels in tretment EM offspring were higher compred to offspring orn to control sows (1.7 fold increse, P < 0.001) (Figure 2). ATGL mrna levels were elevted in tretment M (4 fold increse, P < 0.01) nd EM (4.5 fold increse, P < 0.01) offspring compred to tretment C offspring (Figure 2). The lipogenic mrkers, LPL nd ACACB [40,41], were lso different in offspring dipose from different mternl tretments (Figures 2 nd 3). LPL mrna levels in sucutneous dipose from offspring orn to tretment M (1.75 fold increse, P < 0.001), EM (1.6 fold increse, P < 0.01) nd L (1.8 fold increse, P < 0.001) mothers were higher thn those in offspring orn to control sows (Figure 2). Levels of ACACB mrna were lso elevted in tretment M (1.8 fold increse, P < 0.01) nd EM (2.1 fold increses, P < ) offspring compred to controls, with tretment L offspring hving the highest levels of ACACB mrna in sucutneous dipose smples (3.2 fold increse from levels oserved in tretment C offspring, P < ) (Figure 3). Leptin (LEP) nd CASPASE1 mrna levels in offspring sucutneous dipose tissue were unffected y tretment of mother (Figure 3). CASPASE1 codes for n enzyme involved in the ctivtion of the inflmmsome resulting in n incresed flux of mcrophges into dipose tissue [42]. PPARGC1A codes for verstile trnscriptionl coregultor, tht links nutritionl signls to energy metolism [43]. The sucutneous dipose

10 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 10 of 16 Offspring GLUT4 mrna reltive expression 2 CT c c d Offspring FABP4 mrna reltive expression 2 CT c cd d Offspring CD36 mrna reltive expression 2 CT Mternl Tretment c c Offspring HSL mrna reltive expression 2 CT Mternl Tretment c Offspring ATGL mrna reltive expression 2 CT Mternl Tretment Offspring LPL mrna reltive expression 2 CT Mternl Tretment Mternl Tretment Mternl Tretment Figure 2 Messenger RNA levels of GLUT4, FABP4, CD36, HSL, ATGL nd LPL in offspring sucutneous dipose tissue. Mternl tretments: Control C Sows received 2.3 kg/dy food from dy 25 to 110 gesttion, E sows received 4.6 kg/dy food in erly (dys 25 to 50) gesttion, M sows received 4.6 kg/dy in mid gesttion (dys 50 to 80), EM sows received 4.6 kg/dy in erly nd mid gesttion (dys 25 to 80) nd L sows received 3.5 kg/dy from dys 80 to 110 of gesttion. Dt ws generted from n = 18 dipose smples per tretment. At lest 2 experimentl repets nd 4 technicl repets were performed on ech dipose smple. Reltive mount of mrna trget = 2 ΔCT where ΔCT = crossing threshold of Trget - crossing threshold of reference rplpo. Different superscripts within figure indicte significnt differences etween tretments, P < tissue of EM offspring hd significntly less PPARGC1A mrna trnscripts thn sucutneous dipose tissue from L offspring (P < 0.01) (Figure 3). Offspring orn to tretment E (4 fold decrese, P < 0.01) nd M (3,5 fold decrese, P < 0.05) hd lower levels, in dipose tissue, of the gene coding for Monocyte Chemottrctnt Protein-1 (MCP1) thn offspring orn to tretment C (Figure 3). MCP1 codes for cytokine with dipogenic functions nd mrna levels re positively correlted with oesity nd insulin de-regultion [44]. The cytokine IL-18 is produced y non ft cells in dipose tissue [45]. There ws gender y tretment interction for IL-18 mrna levels in sucutneous dipose tissue. Tretment E (1.5 fold decrese, P < 0.05), tretment M (1.6 fold decrese, P < 0.05) nd tretment L (1.7 fold decrese, P < 0.01) offspring hd lower levels of IL-18 mrna in their sucutneous dipose tissue thn offspring from tretment C (Figure 3). Tretment EM offspring hd elevted levels of PAI-1 mrna (2.4 fold increse, P < 0.001) in their sucutneous dipose tissue compred to tretment C offspring (Figure 4). This inflmmtory dipokine nd ngiogenic fctor is primrily relesed y non-ft cells in dipose tissue [46]. The dipocyte size mrker nd imprinted gene [47], MEST, ws incresed in tretment M (3.8 fold increses, P < 0.05) nd EM (4.8 fold increse, P < 0.01) offspring compred to tretment C offspring (Figure 4). Gender influenced CD36 mrna levels in sucutneous dipose tissue with femles exhiiting 1.3 fold higher levels thn mles (P < 0.001) (dt not shown). Sucutneous dipose tissue of femles lso hd higher levels of FABP4 (1.3 fold increse, P < 0.001) nd GLUT4 (1.7 fold increse, P < 0.01) mrna thn mles (dt not shown). Birth weight influenced levels of IL-18 mrna in sucutneous dipose tissue with hevy nd medium irth weight individuls exhiiting lower levels thn low irth weight offspring (1.3 nd 1.25 fold decrese, P < 0.05 respectively) (dt not shown).

11 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 11 of 16 Offspring ACACB mrna reltive expression 2 CT c Offspring LEP mrna reltive expression 2 CT Mternl Tretment Mternl Tretment Offspring PPARGC1 mrna reltive expression 2 CT Offspring Cspse mrna reltive expression 2 CT Mternl Tretment Mternl Tretment Offspring MCP1 mrna reltive expression 2 CT Offspring IL-18 mrna reltive expression 2 CT Mternl Tretment Mternl Tretment Figure 3 Messenger RNA levels of ACACB, LEP, PPARGC1, Cspse, MCP1 nd IL-18 in offspring sucutneous dipose tissue. Mternl tretments: Control C Sows received 2.3 kg/dy food from dy 25 to 110 gesttion, E sows received 4.6 kg/dy food in erly (dys 25 to 50) gesttion, M sows received 4.6 kg/dy in mid gesttion (dys 50 to 80), EM sows received 4.6 kg/dy in erly nd mid gesttion (dys 25 to 80) nd L sows received 3.5 kg/dy from dys 80 to 110 of gesttion. Dt ws generted from n = 18 dipose smples per tretment. At lest 2 experimentl repets nd 4 technicl repets were performed on ech dipose smple. Reltive mount of mrna trget = 2 ΔCT where ΔCT = crossing threshold of Trget - crossing threshold of reference rplpo. Different superscripts within figure indicte significnt differences etween tretments, P < Discussion Incresing mternl food llownce in lte gesttion shifted the offspring sucutneous dipocyte focus to ccumultion of ft. Douling mternl food llownce for 55 dys in gesttion, comining oth erly nd mid gesttion time periods, elevted lipogenic, nutrient trnsporters, lipolysis nd dipocyte size mrkers in offspring sucutneous dipose tissue. This dds credence to the suggestion tht strict dherence to gesttionl weight gin guidelines re required for helthy weight mothers to protect their offspring ginst dipocyte dysfunction [2,5]. Douling food llownces t different times of gesttion did not result in ft mothers per se, s ckft increses remined within the norml rnge (<9 mm ckft increse with mesurement of < 21 mm t frrowing) [31]. Although control sows gined 63.9 kg y dy 110 of 115 dys gesttion, the ckft gin ws less thn expected t modest 2.4 mm. However, nd s expected, mothers from different tretments differed in their gesttionl weight gin ptterns. In greement with other studies, overfed mothers did not result in offspring irth weight differences [48-50]. Effect of overfeeding mothers in lte gesttion The lrgest mternl weight gin in lte gesttion occurred in tretment L mothers (36.2 kg from dy 80 to 110 gesttion). Excess nutrition during lte gesttion is predicted to exert the gretest influence on sucutneous dipose function s the timing coincides with its rpid development, differentition nd mturtion. Offspring orn to tretment L sows hd similr weight t irth to controls ut were lighter y dolescence (dy 118 nd 159 dy). However crcss weight, ckft thickness nd % len were unchnged for tretment L offspring suggesting lighter weights of internl orgns nd/or viscerl ft. The sucutneous dipose depot from tretment L offspring exhiited is towrds ft

12 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 12 of 16 d c c Offspring PAI1mRNA reltive expression 2 CT c Offspring MEST mrna reltive expression 2 CT Mternl Tretment Mternl Tretment Figure 4 Messenger RNA levels of PAI1 nd MEST in offspring sucutneous dipose tissue. Mternl tretments: Control C Sows received 2.3 kg/dy food from dy 25 to 110 gesttion, E sows received 4.6 kg/dy food in erly (dys 25 to 50) gesttion, M sows received 4.6 kg/dy in mid gesttion (dys 50 to 80), EM sows received 4.6 kg/dy in erly nd mid gesttion (dys 25 to 80) nd L sows received 3.5 kg/dy from dys 80 to 110 of gesttion. Dt ws generted from n = 18 dipose smples per tretment. At lest 2 experimentl repets nd 4 technicl repets were performed on ech dipose smple. Reltive mount of mrna trget = 2 ΔCT where ΔCT = crossing threshold of Trget - crossing threshold of reference rplpo. Different superscripts within figure indicte significnt differences etween tretments, P < storge nd nutrient trnsport. Incresed food intke in lte gesttion incresed mrna levels of ll the lipogenesis mrkers tested (CD36, ACACB nd LPL) with ACACB mrna levels significntly higher in tretment L offspring thn ll other offspring in the study. Significntly higher GLUT4 mrna levels in the sucutneous dipose tissue of tretment L offspring compred to ll other dipose smples suggests incresed levels of glucose entering the L dipocyte. Elevted levels of FABP4 mrna suggests more non-esterified fts my e trnsported to dipocyte memrnes [37]. Although mrna of the mjor lipolytic enzyme, HSL, ws elevted in tretment L offspring sucutneous dipose compred to control offspring, mrna of the rte limiting enzyme ATGL which governs tricylglycerol store moiliztion ws not. No differences were oserved for diposity, dipocyte size nd inflmmtion indictors. Over nd undernutrition in lte gesttion in sheep interfered with offspring sucutneous to viscerl ft rtios [14]. Pregnnt ewes fed 150% food lloction from dy 115 gesttion to term (dy 150) gve irth to offspring who hd similr ody weights nd growth rtes from irth to dy 30 ut incresed sucutneous ft mss (40 g/kg versus 22.1 g/kg) [51]. However, indictors of lipogenesis (PPARy, LPL nd G3PDH mrna) remined unchnged [51]. Although discrepncies re evident with our study, nutritionl intervention in lte gesttion in oth studies did indicte enhnced ft storge ility in the sucutneous dipose depot. Offspring from our study were fed d liitum. However, it cn e postulted tht high ft or energy dense dietry chllenge in dult offspring would mplify the ft storge is. Rts orn to overfed mothers hd incresed ody weights, dipose weights, serum glucose, serum insulin, serum leptin, serum non esterified ftty cids nd dipose triglycerides compred to controls. The introduction of cfeteri diet from wening to dulthood significntly mplified these differences [10]. Effect of overfeeding mothers in oth mid nd erly gesttion Douling food intke in oth erly nd mid gesttion time periods, resulted in the heviest nd fttest mothers t prturition. EM mothers gined 36.2 kg in erly gesttion (dy 25 50). This ws followed in mid gesttion y similr weight gins to control mothers leding to n overll gesttionl weight gin of 91.4 kg with totl ckft increse of 7.2 mm. Such ckft gins equte to similr study where mothers received 42 MJ DE/ dy from dy 21 gesttion to prturition [48]. In oth studies, offspring orn to overfed mothers with significnt gesttionl weight gins did not differ to control offspring in irth weight, weight gin from irth to dolescence, food intke nd crcss trits t dolescence [48]. Only when chllenged with high energy diet postwening, did Arentson-Lntz et l. oserve incresed fsting glucose nd insulin plsm levels in 84 dy old offspring whose mothers were overfed compred to controls [48]. At the trnscriptionl level, our EM offspring sucutneous dipose tissue differed significntly from controls with incresed levels of ll lipogenic (CD36, ACACB nd LPL), nutrient trnsporters (FABP4 nd GLUT4) nd lipolysis (HSL nd ATGL) indictors tested. Noticely, HSL levels were the highest reported in the study. Adipose dysfunction is lso indicted y elevted levels of MEST nd PAI-1 compred to controls [18].

13 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 13 of 16 However, this dipocyte dysfunction my require high ft or energy dense dietry chllenge to ffect ody weight prmeters. The longer length of the dietry intervention s well s the timing my hve contriuted to the significnt differences oserved. Long et l. reported tht foetl sucutneous dipose tissue from multiprous ewes, who received 150% food lloction ove requirements throughout gesttion, hd elevted levels of CD36, GLUT4, FASN, ACC nd CD36 mrna with ccompnying increses in proteins CD36, FATP1, FATP4, GLUT4 nd ltered ftty cid composition compred to controls, lthough ody weight ws unchnged [52]. In greement with our study, no differences in ody weight from irth to dulthood were oserved in femle offspring orn to ewes who received 200% food llownce in erly nd 140% food llownce in mid gesttion compred to those who received the recommended llownce [53]. In ddition, Munoz et l oserved tht the mle offspring orn to overfed ewes hd similr crcss weight, ft depth, retroperitonel ft level nd perinephric ft level to control offspring [53]. Gesttionl overnutrition vi mternl intrgstric cnnultion resulted in rts, t wening ge, of similr ody weight nd % ft mss ut enhnced heptic lipogenic signlling compred to control offspring [20]. Adult offspring orn to sows on high protein gesttionl diet (30%) ut norml food intke levels (34 MJ DE/dy) exhiited no differences in ody weight, ckft thickness, perirenl ft %, ommentl ft %, dipocyte re nd LEP mrna levels in sucutneous dipose tissue compred to controls [54]. However metolic nd lipid trnsport differences were oserved in the proteome of the ckft sucutneous dipose depot of these offspring s erly s 1 dy old, compred to their controls [55]. In humns there is well-recognised ssocition etween mternl gesttionl weight gin nd infnt irth weight [56-58]. In ddition Hull et l. reported tht mothers with helthy BMI pre-pregnncy, who gined more thn the recommended weight during gesttion, gve irth to infnts with similr infnt ft mss ut greter ft free mss to mothers with n pproprite gesttionl weight gin [59]. In other studies, mothers who gined more thn 16 kg during pregnncy incresed the odds rtio of their children eing overweight y the ge of 8 yers, lthough the mothers BMI pre-pregnncy ws not ccounted for [60]. Wrotnik et l. reported significnt increse in the numer of children overweight t the ge of 7 when their helthy BMI mothers gined excessive weight during pregnncy compred to mothers of similr BMI who gined pproprite weight [58]. Excessive gesttionl weight gin in helthy prepregnncy weight mothers incresed the odds rtio y 1.5 fold for greter diposity in dult dughters [57]. Effect of overfeeding mothers in mid gesttion Douling food llownce in mid gesttion resulted in 43.5 kg weight gin etween dys 50 nd 80 compred to 18.7 kg gin in control sows for the sme time period. However, these M sows hd reduced weight gin in lte gesttion compred to controls (11.69 kg versus 20.9 kg). Tretment M offspring demonstrted erly postntl weight gin during the suckling period. At slughter, these M dolescent offspring hd lighter crcss weight, reduced ckft nd incresed len met % compred to tretment C offspring. Sucutneous dipose tissue in tretment M offspring exhiited ft storge rther thn lipogensis is. Incresed mternl food intke during foetl sucutneous lipid deposition my lter ft cell ility to store nd relese ftty cids. Ft storge indictors (CD36, LPL nd ACACB) nd the dipocyte size mrker MEST were upregulted in tretment M offspring compred to their control counter prts. Lower levels of MCP1 nd IL-18 implied lower level of T-lymphocyte nd mcrophge infiltrtion [44,45]. This greed with lower ckft mesurements s there is positive ssocition etween these mrkers nd diposity levels [44,45]. However, there is disconnect etween the lipogenic is of the sucutneous dipose depot nd the unchnged LEP mrna levels nd reduced ckft level. Although mesurement of mrna levels of lipogenic genes is resonle indiction of lipogenic ctivity [61], the ctul lipogenic ctivity of the sucutneous dipocyte ws not mesured. In previous study, incresed levels of CD36 nd GLUT4 mrna prlleled with incresed levels CD36 nd GLUT4 peptide in sucutneous dipose tissue of lm foetuses whose mothers were overfed 150% requirements from 60 dys pre conception to term [52]. Mle lm foetuses in lte gesttion (dy 135 of 150 dys gesttion) hd lighter crcss weights (3.56 kg versus 4.12 kg) [52]. In greement with our study, providing cows with extr nutrition in mid gesttion (dy gesttion) resulted in mle offspring with similr irth weights ut incresed wening weights (256 kg versus kg) compred to controls [62]. By slughter ge, these offspring hd incresed verge dily gin (1.656 kg/dy versus kg/ dy), live weight (543.9 kg versus kg), 12th ri ft thickness (1.51 cm versus 1.11 cm) nd hot crcss weight (348 kg versus 330 kg) compred to control offspring [62]. There ws no difference in longissimus muscle re or fire type ut there ws tendency to hve incresed numer of sucutneous dipocytes [62]. In our study, incresed food llownce in mid gesttion did not ffect offspring totl fire numer, type, or secondry to primry fire rtio [26,27]. Therefore, lthough tretment M delivers incresed mternl nutrition t time when offspring secondry muscle fires re formed, the incresed len oservtions is proly direct result of

14 Gilin et l. Reproductive Biology nd Endocrinology (2015) 13:16 Pge 14 of 16 offspring ft depth. In contrst, Ceriuselo et l. reported reduction in porcine muscle fire numer, prticulrly type IIB, in dult offspring of mothers overfed (60 MJ ME/ dy) from dy 45 to 85 gesttion [50]. In greement with our study, overfeeding in mid gesttion did trnsiently lter food intke nd verge dily gin mesurements during growth ut dolescent offspring hd similr ody weight, crcss weight nd len % to controls [50]. The significntly lower weight gin in the lst trimester t time of rpid dipose expnsion my hve lso contriuted to the offspring reduced ckft nd elevted lipogenic iomrkers. Undernutrition in the lst trimester resulted in offspring with reduced sucutneous ckft lyer in lm offspring t dolescence (6 months of ge) [63] nd reduced sucutneous ft pds in young rt offspring (24 dys old) [61]. Effect of overfeeding mothers in erly gesttion Douling food in erly gesttion resulted in 35 kg weight gin from dy 25 to 50 gesttion compred to 8 kg in control sows for the sme time period. However this erly nd sustntil weight gin ws followed y mrginl weight gin in mid gesttion. Offspring orn to these E sows hd different postntl growth rtes compred to C offspring. At dolescence, E offspring were 7.6 kg lighter with 1.2 mm less ckft tht offspring orn to C sows. However lipogenesis nd lipolysis mrkers in sucutneous dipose tissue of E offspring remined similr to control individuls. In ddition, no differences in MEST mrna levels or LEP mrna would suggest no difference in diposity or dipocyte size [47]. This indictes tht sucutneous dipocyte function is unchnged to controls. Erly gesttionl weight gin is unlikely to impct on the metolism of offspring sucutneous dipose tissue s porcine sucutneous ft cell differentition egins fter dy 45 gesttion [28]. Insted extr nutrition in erly gesttion my lter () skeletl muscle physiology nd/or () numer of committed dipocyte precursor cells to either sucutneous or viscerl ft depots. Although tretment E offspring hd similr % len nd muscle depth to C offspring, we previously oserved tht E offspring hd incresed semitendinosis type II oxidtive muscle fires [26], clcenurin mrna [27] nd reduced semimemrnous intrmusculr ft [27]. Previous studies of over nutrition, under nutrition or low protein diet in erly gesttion resulted in modifictions to muscle weight [64], fire numer [49], dipose yield [49], sucutneous nd viscerl ft levels [12,64-66]. Conclusions In conclusion, incresing gesttionl weight gin in erly gesttion ltered offspring postntl growth rte. Incresing mternl food llownce in lte gesttion ppered to shift the offspring dipocyte focus towrds ft ccretion. Incresing mternl food llownce in erly nd mid gesttion comined, resulted in offspring whose sucutneous dipose tissue, t dolescence, exhiited elevted mrna levels of lipogenic, nutrient trnsporters, lipolysis nd dipocyte size indictors compred to controls. The present study provides dditionl evidence tht mothers, who gin more thn the recommended weight gin in mid nd lte gesttion, put their offspring dipose tissue t risk of dysfunction. Arevition BMI: Body mss index. Competing interests The uthors declre tht they hve no competing interests. Authors contriutions PGL, CD nd LG secured funding for this study. PGL nd LG were responsile for reserch conception nd tril design. LBMcN nd PGL were responsile for the niml tril nd smpling. LG, PL, ECG nd FB performed RT-PCR experiments nd dt nlysis. DB provided sttisticl dvice in experimentl design nd provided sttisticl nlysis. LG, CD, ECG nd FB drfted the mnuscript. All uthors red nd pproved the finl mnuscript. Acknowledgements We thnk the stff of the Pig Development Deprtment, Animl nd Grsslnd Reserch nd Innovtion Centre, Tegsc for cre nd feeding of the nimls used in this study. This reserch ws funded y Tegsc, under the Ntionl Development Pln. LBMcN ws in receipt of Tegsc Wlsh Fellowship. Nestle hosted LG on sticl nd funded the RT-PCR cost. Author detils 1 Tegsc Food Reserch Centre, Mooreprk, Fermoy, Co.Cork, Irelnd. 2 Nestlé Reserch Centre, Nutrition & Helth Reserch Deprtment, Vers-Chez-les-Blnc, Lusnne, Switzerlnd. 3 Animl nd Grsslnd Reserch nd Innovtion Centre, Tegsc, Mooreprk, Fermoy, Co. Cork, Irelnd. Received: 10 Novemer 2014 Accepted: 12 Ferury 2015 References 1. Wijnhoven TM, vn Rij JM, Spinelli A, Strc G, Hsspidou M, Spiroski I, et l. WHO europen childhood oesity surveillnce inititive: ody mss index nd level of overweight mong 6-9-yer-old children from school yer 2007/2008 to school yer 2009/2010. BMC Pulic Helth. 2014;14: Admo KB, Ferrro ZM, Brett KE. Cn we modify the intruterine environment to hlt the intergenertionl cycle of oesity? Int J Environ Res Pulic Helth. 2012;9(4): Alfrdhi MZ, Oznne SE. Developmentl progrmming in response to mternl overnutrition. Front Genet. 2011;2: Ojh S, Sroh V, Symonds ME, Budge H. Excess nutrient supply in erly life nd its lter metolic consequences. Clin Exp Phrmcol Physiol. 2013;40(11): Ojh S, Roinson L, Symonds ME, Budge H. Suoptiml mternl nutrition ffects offspring helth in dult life. Erly Hum Dev. 2013;89(11): Breton C. The hypothlmus-dipose xis is key trget of developmentl progrmming y mternl nutritionl mnipultion. J Endocrinol. 2013;216(2):R Muhlhusler B, Smith SR. Erly-life origins of metolic dysfunction: role of the dipocyte. Trends Endocrinol Met. 2009;20(2): Lfontn M. Adipose tissue nd dipocyte dysregultion. Dietes Met. 2014;40(1): Poston L. Mternl oesity, gesttionl weight gin nd diet s determinnts of offspring long term helth. Best Prct Res Clin Endocrinol Met. 2012;26(5):