Supplementary Appendix
|
|
- Timothy Perry
- 6 years ago
- Views:
Transcription
1 Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Goadsby PJ, Reuter U, Hallström Y, et al. A controlled trial of erenumab for episodic migraine. N Engl J Med 217;377: DOI: 1.156/NEJMoa175848
2 1 Table of Contents METHODS 3 Study Sites 3 Study Exclusion Criteria 3 Term Definition 5 Trial Assessments and Safety Evaluations 5 Statistical Analysis 6 Sample size 6 Primary and Continuous Secondary Endpoint Analysis 7 Sensitivity Analysis 8 SUPPLEMENTARY FIGURES 9 S1: Patient disposition 9 S2: Changes from baseline in monthly acute migraine specific medication treatment days 1 S3: Change from baseline in monthly MPFID-EA score 11 S4: Change from baseline in monthly MPFID-PI score 12 SUPPLEMENTARY TABLES 13 Table S1: Supplementary baseline characteristics 13 Table S2: Change from baseline in mean monthly migraine days, mean monthly acute migraine specific medication treatment days, mean MPFID domain scores (MPFID-PI and MPFID-EA), and 5% responder rates at weeks 4, 8, 12, 16, 2, and 24 14
3 2 Table S3: Serious adverse events 16 Table S4: Liver function abnormalities during the double-blind treatment phase 18 Supplementary References 2
4 3 Methods Study Sites Patients were enrolled from 121 sites across North America (Canada, USA), Europe (Austria, Belgium, Czech Republic, Finland, Germany, Netherlands, Poland, Slovakia, Sweden, and United Kingdom), and Turkey. Study Exclusion Criteria Patients were excluded if they had no therapeutic response in migraine prevention after an adequate therapeutic trial of >2 of the following medication categories: Category 1: Divalproex sodium, sodium valproate Category 2: Topiramate Category 3: Beta blockers Category 4: Tricyclic antidepressants Category 5: Serotonin-norepinephrine reuptake inhibitors Category 6: Flunarizine, verapamil Category 7: Lisinopril, candesartan No therapeutic response was defined as no reduction in headache frequency, duration, or severity after administration of the medication for 6 weeks at the generally accepted therapeutic dose(s) based on the investigator s assessment. Lack of sustained response to a medication and failure to tolerate a therapeutic dose was not considered to be no therapeutic response.
5 4 The following medications, devices, or procedures were excluded: Botulinum toxin (in the head and/or neck region) is excluded within 4 months before the start of the baseline phase and throughout the study Ergotamine derivatives, steroids, and triptans used for migraine prophylaxis are excluded within 2 months before the start of the baseline phase and throughout the study Devices and procedures used for migraine prophylaxis are excluded within 2 months before the start of the baseline phase and throughout the study Investigational medications and devices are excluded throughout the study Patients also must not have used investigational medications or devices for at least 9 days prior to screening Patients who were concomitantly using 2 of the following medications for migraine prevention within 2 months before the start of the baseline phase and throughout the study were excluded: Divalproex sodium, sodium valproate, topiramate, carbamazepine, gabapentin Beta blockers Tricyclic antidepressants Venlafaxine, desvenlafaxine, duloxetine, milnacipran Flunarizine, verapamil, lomerizine Lisinopril, candesartan Clonidine, guanfacine
6 5 Cyproheptadine Methysergide Pizotifen Butterbur, feverfew, magnesium ( 6 mg/day), riboflavin ( 1 mg/day) Use of one medication was permitted if the dose was stable within 2 months before the start of the baseline phase and throughout the study. Term Definition A migraine day in this study was defined as follows: Any calendar day in which the patient experiences a qualified migraine headache (onset, continuation, or recurrence of the migraine headache). A qualified migraine headache is defined as a migraine with or without aura, lasting for 3 minutes, and meeting at least one of the following criteria (a and/or b): a) 2 of the following pain features: unilateral, throbbing, moderate to severe, exacerbated with exercise/physical activity b) 1 of the following associated symptoms: nausea and/or vomiting, photophobia, and phonophobia Trial Assessments and Safety Evaluations A central laboratory was used to process samples for serum chemistry, urinalysis, and hematology.
7 6 The following analytes were evaluated by the central laboratory: Serum Chemistry: Sodium, potassium, chloride, bicarbonate, total protein, albumin, calcium, magnesium, phosphorus, glucose, blood urea nitrogen or urea, creatinine, uric acid, total bilirubin, direct bilirubin, Alkaline phosphatase, aspartate aminotransferase (serum glutamic oxaloacetic transaminase), alanine aminotransferase (serum glutamic pyruvic transaminase), cholesterol, high-density lipoprotein, low-density lipoprotein, triglycerides, creatine phosphokinase, estimated glomerular filtration rate modification of diet in renal disease Urinalysis: Specific gravity, ph, blood, protein, glucose, bilirubin, white blood cells (WBC), red blood cells (RBC), epithelial cells, bacteria, casts, crystals Hematology: RBC, hemoglobin, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, red cell distribution width, reticulocytes, platelets, WBC, WBC differential (bands/stabs, neutrophils, eosinophils, basophils, lymphocytes, monocytes, myeloblasts, promyelocytes, myelocytes, metamyelocytes, atypical lymphocytes), nucleated RBC Other laboratories were used to process further laboratory samples, including serum for antierenumab antibodies, urine for drug screening, and urine and serum for pregnancy testing. Statistical Analysis Sample Size A planned enrollment of 284 patients per treatment group provided 9% power to detect treatment differences of 1.12 monthly migraine days for erenumab 7 mg and 1.3 monthly
8 7 migraine days for erenumab 14 mg versus placebo, with a common standard deviation (SD) of 3.78, using two-sided tests at the 5% significance level. This sample size calculation assumed a 1% dropout rate. The assumed treatment effect was based on results observed in the phase 2 trial of erenumab in episodic migraine. 1 Primary and Continuous Secondary Endpoint Analysis The primary endpoint and continuous secondary endpoints were analyzed using a linear mixed-effects model including treatment group, baseline value, stratification factors, scheduled visit, and the interaction of treatment group with scheduled visit. Multiplicity Adjustment Method for the Primary and Secondary Endpoints To maintain the family-wise type 1 error rate of.5, a hierarchical gate-keeping procedure and Hochberg method was used. The primary endpoint was tested separately for each erenumab dose, at a significance level of.4 for erenumab 7 mg and.1 for erenumab 14 mg. The first-tier secondary endpoints were tested separately using the Hochberg method at a significance level of.4 for erenumab 7 mg and.1 for erenumab 14 mg, if the primary endpoint comparison was considered statistically significant. If the first tier secondary endpoints were significantly different from placebo for both doses of erenumab, the second tier secondary endpoints for the erenumab 14-mg group were tested at a significance level of.5. Otherwise, the erenumab 14-mg group was tested first at a significance level of.4 (if only 7 mg was significant) or.1 (if only 14 mg was significant), and the erenumab 7-mg group was tested only if both second tier endpoints for the erenumab 14-mg group were significantly different from placebo (significance levels carried over).
9 8 Sensitivity Analysis Sensitivity analyses for the primary endpoint and continuous secondary endpoints include the following: the same analysis using the per-protocol analysis set, the last observation carried forward to handle missing data with the analysis of covariance model, and multiple imputation with assumptions of missing at random and missing not at random to handle missing data. For the 5% reduction from baseline in mean monthly migraine days endpoint, sensitivity analyses include the following: Cochran-Mantel-Haenszel test using the per-protocol analysis set, generalized linear mixed-effects model without imputation of missing data, and logistic regression model for each visit after the missing data are imputed as nonresponse.
10 9 Supplementary Figures Figure S1. Patient disposition *Completing the study is defined as completing the 24-week double-blind treatment phase.
11 1 Figure S2: Changes from baseline in monthly acute migraine specific medication treatment days Figure S2 shows the least squares mean changes from baseline in monthly acute migraine specific medication treatment days during the double-blind treatment phase. Changes from baseline in mean monthly acute migraine specific medication treatment days over the last 3 months (months 4, 5, and 6) were significantly different from placebo for the erenumab 7-mg and 14-mg groups (P<.1 for both comparisons). Data were analyzed using a linear mixedeffects model including treatment group, baseline value, stratification factors, scheduled visit, and the interaction of treatment group with scheduled visit, and as observed with no imputation. Error bars represent 95% confidence intervals. Patients were dosed at day 1 (baseline) and months 1, 2, 3, 4, and 5. The figure is based on the efficacy analysis set.
12 11 Figure S3: Change from baseline in monthly MPFID-EA score Figure S3 shows the least squares mean change from baseline in monthly MPFID-EA score during the double-blind treatment phase. Changes from baseline in mean MPFID-EA score over the last 3 months (months 4, 5, and 6) were significantly different from placebo for the erenumab 7-mg and 14-mg groups (P<.1 for both comparisons). Data were analyzed using a linear mixed-effects model including treatment group, baseline value, stratification factors, scheduled visit, and the interaction of treatment group with scheduled visit, and as observed with no imputation. The error bars represent 95% confidence intervals. Patients were dosed at day 1 (baseline) and months 1, 2, 3, 4, and 5. The figure is based on the efficacy analysis set. MPFID-EA, Migraine Physical Function Impact Diary-Impact on Everyday Activities.
13 12 Figure S4: Change from baseline in monthly MPFID-PI score Figure S4 shows the least squares mean changes from baseline in monthly mean MPFID-PI score during the double-blind treatment phase. Changes from baseline in mean MPFID-PI score over the last 3 months (months 4, 5, and 6) were significantly different from placebo for the erenumab 7-mg and 14-mg groups (P<.1 for both comparisons). Data were analyzed using a linear mixed-effects model including treatment group, baseline value, stratification factors, scheduled visit, and the interaction of treatment group with scheduled visit, and as observed with no imputation. Error bars represent 95% confidence intervals. Patients were dosed at day 1 (baseline) and months 1, 2, 3, 4, and 5. The figure is based on the efficacy analysis set. MPFID-PI, Migraine Physical Function Impact Diary-Physical Impairment.
14 13 Supplementary Tables Table S1: Supplementary baseline characteristics Placebo (N = 319) Erenumab 7 mg (N = 317) Erenumab 14 mg (N = 319) Race no. (%) White 277 (86.8) 281 (88.6) 293 (91.8) Black or African American 24 (7.5) 24 (7.6) 18 (5.6) Other* 18 (5.6) 12 (3.8) 8 (2.5) Body mass index kg/m 2, mean±sd 27.14± ± ±6.22 *Other includes Asian, native Hawaiian and other Pacific Islander, multiple ethnic origins, American Indian or Alaska Native, or other.
15 14 Table S2: Change from baseline in mean monthly migraine days, mean monthly acute migraine specific medication treatment days, mean MPFID domain scores (MPFID-PI and MPFID-EA), and 5% responder rates at weeks 4, 8, 12, 16, 2, and 24
16 Month 1 Placebo (n = 316) Erenumab 7 mg (n = 312) Erenumab 14 mg (n = 318) Month 2 Placebo (n = 316) Erenumab 7 mg (n = 312) Erenumab 14 mg Monthly migraine days.9 ( 1.3,.5) 2.32 ( 2.73, 1.92) 2.72 ( 3.12, 2.32) 1.39 ( 1.8,.99) 2.93 ( 3.34, 2.52) 3.1 ( 3.5, 2.7) (n = 318) Month 3 Placebo (n = 316) 1.71 >5% responder rate Monthly acute migraine specific medication treatment days 49 (15.5).3 (.28,.22) 12 (32.7).78 ( 1.3,.53) 113 (35.5) 1.4 ( 1.65, 1.15) 77 (24.4).34 (.59,.9) 124 (39.7) 1.1 ( 1.35,.85) 143 (45.) 1.56 ( 1.81, 1.31) 83 (26.3).33 ( 2.12, 1.3) (.58,.8) Erenumab 7 mg (41.3) 1.12 (n = 312) ( 3.38, 2.56) ( 1.37,.87) Erenumab 14 mg (48.1) 1.56 (n = 318) ( 3.91, 3.1) ( 1.81, 1.31) Month 4 Placebo (28.8).19 (n = 316) ( 2.35, 1.52) (.45,.6) Erenumab 7 mg (41.) 1.8 (n = 312) ( 3.5, 2.67) ( 1.33,.82) Erenumab 14 mg (49.7) 1.56 (n = 318) ( 3.93, 3.11) ( 1.81, 1.31) Month 5 Placebo (29.1).4 (n = 316) ( 2.29, 1.46) (.66,.14) Erenumab 7 mg (47.1) 1.17 (n = 312) ( 3.75, 2.93) ( 1.43,.92) Erenumab 14 mg (48.1) 1.61 (n = 318) ( 4.15, 3.33) ( 1.87, 1.36) Month 6 Placebo (n = 316) (29.4).1 ( 2.8, 1.25) (.25,.26) Erenumab 7 mg (47.1) 1.14 (n = 312) ( 3.67, 2.84) ( 1.4,.89) Erenumab 14 mg (49.1) 1.67 (n = 318) ( 4.17, 3.35) ( 1.92, 1.41) Data are least squares mean (95% confidence interval) or no. (%). MPFID-PI score 1.58 ( 2.43,.73) 3.29 ( 4.15, 2.44) 3.72 ( 4.57, 2.88) 2.2 ( 2.87, 1.17) 4.15 ( 5.1, 3.29) 4.64 ( 5.49, 3.79) 2.39 ( 3.25, 1.53) 4.13 ( 4.99, 3.26) 4.87 ( 5.73, 4.2) 2.51 ( 3.38, 1.64) 4.13 ( 4.99, 3.26) 4.73 ( 5.58, 3.87) 2.61 ( 3.49, 1.74) 4.44 ( 5.31, 3.57) 4.96 ( 5.82, 4.9) 2.1 ( 2.89, 1.14) 4.15 ( 5.3, 3.28) 4.75 ( 5.62, 3.88) 15 MPFID-EA score 2.32 ( 3.16, 1.49) 4.24 ( 5.8, 3.4) 4.59 ( 5.43, 3.76) 2.89 ( 3.73, 2.5) 5.16 ( 6., 4.32) 5.6 ( 6.43, 4.76) 3.35 ( 4.2, 2.5) 5.35 ( 6.2, 4.5) 5.74 ( 6.58, 4.89) 3.52 ( 4.37, 2.67) 5.39 ( 6.24, 4.54) 5.77 ( 6.62, 4.93) 3.47 ( 4.32, 2.61) 5.68 ( 6.53, 4.82) 6.4 ( 6.88, 5.19) 2.9 ( 3.76, 2.4) 5.48 ( 6.34, 4.62) 5.78 ( 6.64, 4.93) MPFID-EA, Migraine Physical Function Impact Diary-Impact on Everyday Activities; MPFID-PI, Migraine Physical Function Impact Diary-Physical Impairment.
17 16 Table S3: Serious adverse events Placebo (N = 319) Erenumab 7 mg (N = 314) Erenumab 14 mg (N = 319) Number of patients reporting serious adverse events, n (%) 7 (2.2) 8 (2.5) 6 (1.9) Serious adverse events, n1 (%) Noncardiac chest pain Cholelithiasis 2 (<1) Ankle fracture Cerebral venous thrombosis * Clostridium difficile colitis * Viral gastroenteritis Kidney infection * Pyelonephritis * Sepsis * Spinal pain Vestibular neuronitis Back pain Migraine Ovarian cyst Post-traumatic neck syndrome Acute pyelonephritis Arthralgia Endometriosis Fall Hypersensitivity
18 17 Intentional overdose Osteoarthritis This table is based on the safety analysis set. N = number of patients in the analysis set; n = number of patients reporting at least one occurrence of the adverse event; n1 = number of serious adverse events reported. One or more adverse events could be reported by a single patient. *All 5 adverse events (cerebral venous thrombosis, Clostridium difficile colitis, kidney infection, pyelonephritis, and sepsis) were reported in a single patient.
19 18 Table S4: Liver function abnormalities during the double-blind treatment phase Erenumab Erenumab Placebo 7 mg 14 mg (N = 319) (N = 314) (N = 319) n/n1 (%) n/n1 (%) n/n1 (%) Patients with ALT or AST >3 ULN (post-baseline) 1/315 (.3) 1/312 (.3) /317 (.) Baseline value: 1 ULN 1/284 (.4) /288 (.) /291 (.) >1 ULN to 3 ULN /31 (.) 1/23 (4.3) /26 (.) >3 ULN / (-) /1 (.) / (-) Patients with ALT or AST >5 ULN (post-baseline) /315 (.) 1/312 (.3)* /317 (.) Baseline value: 1 ULN /284 (.) /288 (.) /291 (.) >1 ULN to 3 ULN /31 (.) 1/23 (4.3) /26 (.) >3 ULN to 5 ULN / (-) /1 (.) / (-) Patients with TBL >1 ULN (post-baseline) 1/315 (3.2) 9/312 (2.9) 1/317 (3.2) Baseline value: 1 ULN 4/37 (1.3) 4/37 (1.3) 4/31 (1.3) >1 ULN 6/8 (75.) 5/5 (1.) 6/7 (85.7) Patients with TBL >1.5 ULN (post-baseline) 1/315 (.3) 3/312 (1.) 1/317 (.3) Baseline value: 1 ULN /37 (.) 1/37 (.3) /31 (.) >1 ULN to 1.5 ULN 1/8 (12.5) 2/5 (4.) 1/7 (14.3) Patients with TBL >2 ULN (post-baseline) /315 (.) 1/312 (.3) /317 (.) Baseline value: 1 ULN /37 (.) 1/37 (.3) /31 (.) >1 ULN to 1.5 ULN /8 (.) /5 (.) /7 (.) Patients with ALP >1.5 ULN (post-baseline) /315 (.) 1/312 (.3) /317 (.)
20 19 Baseline value: 1.5 ULN /315 (.) 1/312 (.3) /317 (.) This table is based on the safety analysis set. *Occurred during safety follow-up, 16 weeks after the last dose of erenumab. The patient had to discontinue erenumab treatment after the week 12 dose due to use of a prohibited medication (prednisolone). No subject met the laboratory criteria for Hy s Law. 2 ALT, alanine aminotransferase; ALP, alkaline phosphatase; AST, aspartate aminotransferase; N, number of patients in the analysis set; n, number of patients who met the criteria; N1, number of patients with available data during post-baseline for all patients or by baseline subgroups; % = n/n1*1; TBL, total bilirubin; ULN, upper limit of normal.
21 2 Supplementary References 1. Sun H, Dodick DW, Silberstein S, et al. Safety and efficacy of AMG 334 for prevention of episodic migraine: a randomised, double-blind, placebo-controlled, phase 2 trial. Lancet Neurol 216;15: US FDA. Guidance for Industry: Drug Induced Liver Injury: Pre-marketing Clinical Evaluation July 29 Drug Safety. Accessed 21 July 216.
Synopsis. Adalimumab M Clinical Study Report R&D/09/060. (For National Authority Use Only) to Part of Dossier: Name of Study Drug:
Synopsis Abbott Laboratories Name of Study Drug: Individual Study Table Referring to Part of Dossier: Volume: (For National Authority Use Only) Name of Active Ingredient: Page: Title of Study: A Multi-Center,
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and
More informationMedical Policy An independent licensee of the Blue Cross Blue Shield Association
CGRP Page 1 of 8 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: CGRP (calcitonin gene-related peptide) Prime Therapeutics will review Prior Authorization requests
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationSummary ID#7029. Clinical Study Summary: Study F1D-MC-HGKQ
CT Registry ID# 7029 Page 1 Summary ID#7029 Clinical Study Summary: Study F1D-MC-HGKQ Clinical Study Report: Versus Divalproex and Placebo in the Treatment of Mild to Moderate Mania Associated with Bipolar
More informationIndividual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:
SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating
More informationA Controlled Trial of Erenumab for Episodic Migraine
The new england journal of medicine Original Article A Controlled Trial of Erenumab for Episodic Migraine Peter J. Goadsby, M.D., Ph.D., Uwe Reuter, M.D., Yngve Hallström, M.D., Gregor Broessner, M.D.,
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationProduct: Denosumab (AMG 162) Synopsis Clinical Study Report: Date: 29 July 2008
Name of Sponsor: Amgen Inc., Thousand Oaks, CA Name of Finished Product: Denosumab (AMG 162) Name of Active Ingredient: Fully human monoclonal antibody to receptor activator for nuclear factor-κb ligand
More informationGet ahead of the ACHE: Monoclonal Antibodies in Migraine Prevention
Get ahead of the ACHE: Monoclonal Antibodies in Migraine Prevention Amanda Janisch, PharmD PGY2 Ambulatory Care Pharmacy Resident MCHS SWMN, Mankato, MN 2018 MFMER slide-1 Disclosures No financial interest
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationMedical Policy An independent licensee of the Blue Cross Blue Shield Association
CGRP Page 1 of 13 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: CGRP (calcitonin gene-related peptide) Prime Therapeutics will review Prior Authorization requests
More informationPreventive treatment of migraine. Rebecca Burch, MD Brigham and Women s Faulkner Hospital Harvard Medical School Boston, MA
Preventive treatment of migraine Rebecca Burch, MD Brigham and Women s Faulkner Hospital Harvard Medical School Boston, MA No disclosures Disclosures Many preventive treatments for migraine are not FDA-approved
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationMEASURE #3: PREVENTIVE MIGRAINE MEDICATION PRESCRIBED Headache
MEASURE #3: PREVENTIVE MIGRAINE MEDICATION PRESCRIBED Headache Measure Description Percentage of patients age 18 years old and older diagnosed with migraine headache whose migraine frequency is 4 migraine
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationPFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550
More informationHow do we treat migraine? New SIGN Guidelines
How do we treat migraine? New SIGN Guidelines Managing your migraine Migraine Trust, Edinburgh 2018 Callum Duncan Consultant Neurologist Aberdeen Royal Infirmary Chair SIGN Guideline 155 Premonitory Mood
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationStrategies in Migraine Care
Strategies in Migraine Care Julie L. Roth, MD Rhode Island Hospital Assistant Professor, Neurology The Warren Alpert Medical School of Brown University March 28, 2015 Financial Disclosures None. Objectives
More informationSupplementary Online Content
Supplementary Online Content Dodick DW, Silberstein SD, Bigal ME, et al. Effect of Fremanezumab Compared With Placebo for Prevention of Episodic Migraine: A Randomized Clinical Trial. JAMA. doi:10.1001/jama.2018.4853
More informationStudy No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationMed Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments
Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that
More informationClinical Trial Synopsis
Clinical Trial Synopsis Title of Study: A Phase III, Open-Label, Fixed-Dose Study to Determine the Safety of Long-Term Administration of TAK-375 in Subjects With Chronic Insomnia Protocol Number: Name
More informationStudy Code: Date: 27 July 2007
These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription Sponsor/company: Generic drug name:
More informationSubject: Aimovig (erenumab) Original Effective Date: 7/10/2018. Policy Number: MCP-320. Revision Date(s):
Subject: Aimovig (erenumab) Original Effective Date: 7/10/2018 Policy Number: MCP-320 Revision Date(s): Review Date(s): MCPC Approval Date: 7/10/2018 DISCLAIMER This Molina Clinical Policy (MCP) is intended
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationPFIZER INC. These results are supplied for informational purpose only. Prescribing decisions should be made based on the approved package insert.
Public Disclosure Synopsis Protocol A3924 4 November 24 Final PFIZER INC. These results are supplied for informational purpose only. Prescribing decisions should be made based on the approved package insert.
More informationSee Important Reminder at the end of this policy for important regulatory and legal information.
Clinical Policy: (Aimovig) Reference Number: CP.PHAR.128 Effective Date: 07.10.18 Last Review Date: 08.18 Line of Business: Commercial, Medicaid Revision Log See Important Reminder at the end of this policy
More informationDOWNLOAD OR READ : MIGRAINE HEADACHE PREVENTION AND MANAGEMENT 1ST EDITION PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : MIGRAINE HEADACHE PREVENTION AND MANAGEMENT 1ST EDITION PDF EBOOK EPUB MOBI Page 1 Page 2 migraine headache prevention and management 1st edition migraine headache prevention and pdf
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationEpic Labs Orderable As STAT PRIORITY As of 06/22/2016
ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID
More informationSummary ID# Clinical Study Summary: Study B4Z-JE-LYBD
CT Registry ID#5286 Page 1 Summary ID# 5286 Clinical Study Summary: Study B4Z-JE-LYBD An Open Label, Dose-Titration Safety Study of Hydrochloride in Outpatient Japanese Children with Attention-Deficit/Hyperactivity
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More informationH.6.G.2 Non-MAC Studies
Page 63 H.6.G.2 Non-MAC Studies H.6.G.2.A Non-MAC Studies at the 600 mg dose A 600 mg dose of azithromycin was given in two non-mac studies (354/354A and 167). Please note: Study 354/354A enrolled a mixture
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Chen CL, Lin GA, Bardach NS, et al. Preoperative medical testing
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationPrimary Endpoint The primary endpoint is overall survival, measured as the time in weeks from randomization to date of death due to any cause.
CASE STUDY Randomized, Double-Blind, Phase III Trial of NES-822 plus AMO-1002 vs. AMO-1002 alone as first-line therapy in patients with advanced pancreatic cancer This is a multicenter, randomized Phase
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Randomized Controlled Trial of to Increase Serum Bicarbonate in Chronic Kidney Disease Patients David A. Bushinsky a, Thomas Hostetter b, Gerrit Klaerner c, Yuri Stasiv c, Claire
More informationSYNOPSIS 2/198 CSR_BDY-EFC5825-EN-E02. Name of company: TABULAR FORMAT (For National Authority Use only)
SYNOPSIS Title of the study: A randomized, double-blind, placebo-controlled, parallel-group, fixed-dose (rimonabant 20 mg) multicenter study of long-term glycemic control with rimonabant in treatment-naïve
More informationS^t _j4 A-N.1^.^ A _ WE 2
S^t _j4 A-N.1^.^ A _ WE 2 Name of Sponsor: Amgen Inc. Name of Finished Product: Denosumab (AMG 162) Name of Active Ingredient: Fully human monoclonal antibody to RANKL Title of Study: A Randomized Study
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationSubject: CGRP Inhibitors
ARCHIVED (NOT ACTIVE RETIRED) Archived: 08/01/18 09-J2000-98 Original Effective Date: 06/15/18 Reviewed: 05/09/18 Revised: 08/01/18 Next Review: ARCHIVED (NOT ACTIVE RETIRED) Subject: CGRP Inhibitors THIS
More informationPFIZER INC. THERAPEUTIC AREA AND FDA APPROVED INDICATIONS: See United States Package Insert (USPI)
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. For publications based on this study, see associated bibliography.
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationEvaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.
5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:
More informationSupplementary Online Content
Supplementary Online Content Block GA, Bushinsky DA, Cunningham J, et al. Effect of etelcalcetide vs placebo on serum parathyroid hormone in patients receiving hemodialysis with secondary hyperparathyroidism:
More informationSponsor. Novartis Pharmaceuticals Corporation Generic Drug Name. Agomelatine Therapeutic Area of Trial. Major depressive disorder Approved Indication
Clinical Trial Results Database Page 1 Sponsor Novartis Pharmaceuticals Corporation Generic Drug Name Therapeutic Area of Trial Major depressive disorder Approved Indication Investigational drug Study
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationSupplemental Table 1: Moderate and severe definitions of Celiac Disease Symptom Diary
Supplemental Table 1: Moderate and severe definitions of Celiac Disease Symptom Diary symptoms CDSD Symptom Diarrhea Constipation Abdominal Pain Bloating Nausea Tiredness Moderate Once or twice between
More information(For National Authority Use Only) Name of Study Drug: to Part of Dossier:
2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: Niaspan Name of Active Ingredient: Page: Niacin extended-release
More informationPaliperidone: Clinical Protocol R076477SCH4012, CR Amendment INT-1
Paliperidone: Clinical Protocol R076477SCH4012, CR013771 Amendment INT-1 A Randomized, Double-Blind, Placebo- and Active-Controlled, Parallel-Group Study to Evaluate the Efficacy and Safety of a Fixed
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More information(For National Authority Use Only) Name of Study Drug: to Part of Dossier:
2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: ABT-335 Name of Active Ingredient: Page: ABT-335, A-7770335.115
More informationSubject ID: I N D # # U A * Consent Date: Day Month Year
IND Study # Eligibility Checklist Pg 1 of 15 Instructions: Check the appropriate box for each Inclusion and Exclusion Criterion below. Each criterion must be marked and all protocol criteria have to be
More informationEXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information
EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information NAME DIAGNOSIS PROTOCOL OF EVALUATION for Chronic Lymphatic Leukemia (CLL) GENERAL INFORMATION (ALL information required!!)
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More information10/17/2017 CHRONIC MIGRAINES BOTOX: TO INJECT OR NOT INJECT? IN CHRONIC MIGRAINE PROPHYLAXIS OBJECTIVES PATIENT CASE EPIDEMIOLOGY EPIDEMIOLOGY
BOTOX: TO INJECT OR NOT INJECT? IN CHRONIC MIGRAINE PROPHYLAXIS OBJECTIVES JENNIFER SHIN, PHARMD PGY2 AMBULATORY CARE PHARMACY RESIDENT COMMUNITYCARE HEALTH CENTERS PHARMACOTHERAPY ROUNDS OCTOBER 20, 2017
More informationTriptans: Nonresponse, Recurrence, and Serious AEs for Many Patients
Efficacy, Safety, and Tolerability of Rimegepant 75 mg, an Oral CGRP Receptor Antagonist, for the Acute Treatment of Migraine: Results from a Phase 3, Double-Blind, Randomized, Placebo-Controlled Trial,
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationI have no financial relationships to disclose. I will not discuss investigational use of medication in my presentation.
I have no financial relationships to disclose. I will not discuss investigational use of medication in my presentation. In 1962, Bille published landmark epidemiologic survey of headache among 9,000 school
More information2.0 Synopsis. Choline fenofibrate capsules (ABT-335) M Clinical Study Report R&D/06/772. (For National Authority Use Only) Name of Study Drug:
2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: Choline Fenofibrate (335) Name of Active Ingredient:
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationEfficacy and Safety of Diclofenac Potassium 25 mg Tablet Taken Three Times Daily in Subjects With Acute Joint Pain
Page 1 of 8 A service of the U.S. National Institutes of Health Try our beta test site Trial record 1 of 1 for: 853-P-401 Previous Study Return to List Next Study Efficacy and Safety of Taken Three Times
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationIndividual Study Table Referring to Part of Dossier: Use Only) Name of Study Drug:
2.0 Synopsis AbbVie Inc. Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: Adalimumab (Humira ) Page: Name of Active Ingredient: Adalimumab
More informationSupplementary Online Content
Supplementary Online Content Powles T, O Donnell PH, Massard C, et al. Efficacy and safety of durvalumab in locally advanced or metastatic urothelial carcinoma: updated results from a phase 1/2 openlabel
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationStudy No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
More informationLost in Translation: Making Sense of Clinical Treatment Guidelines
Lost in Translation: Making Sense of Clinical Treatment Guidelines Charles E. Argoff, MD, CPE Disclosures: Charles Argoff Financial Disclosure: Consultant: Teva, Daiichi Sakyo, Pfizer, Nektar, Purdue,
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More information1/25/2018 ARE CGRP ANTAGONISTS ANY BETTER THAN CURRENT EVIDENCE BASED TREATMENTS? Disclosures: Objectives: Headache Division
ARE CGRP ANTAGONISTS ANY BETTER THAN CURRENT EVIDENCE BASED TREATMENTS? Lawrence C Newman, MD, FAHS, FAAN Clinical Professor of Neurology Disclosures: Advisory Board: Alder, Allergan, Amgen, Lilly, Supernus,
More informationGSK Medicine: Study Number: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Smith TJ, Kahaly GJ, Ezra DG, et al. Teprotumumab for thyroid-associated
More information10/19/2018. Disclosures MIGRAINE PROPHYLAXIS. Objectives. Definitions Slide. What do you think the aooe stands for at the end of erenumab-aooe?
Disclosures MIGRAINE PROPHYLAXIS Erenumab-aooe (AIMOVIG TM ) Calcitonin Gene Related Peptide Receptor Antagonist No conflicts of interest to disclose Chelsey Roscoe, PharmD PGY1 Resident - CTVHCS 2 3 Definitions
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationDuring the past two decades,
Prospectively validated prediction of physiologic variables and organ failure in septic patients: The Systemic Mediator Associated Response Test (SMART) Gus J. Slotman, MD Objective: Conventional outcomes
More informationStudy No.: Title: Rationale: Phase: Study Period: Study Design: Centers: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
More informationClinical Trial Synopsis TL-OPI-518, NCT#
Clinical Trial Synopsis, NCT# 00225264 Title of Study: A Double-Blind, Randomized, Comparator-Controlled Study in Subjects With Type 2 Diabetes Mellitus Comparing the Effects of Pioglitazone HCl vs Glimepiride
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationProvided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
More informationProduct: Denosumab (AMG 162) Clinical Study Report: month Primary Analysis Date: 21 November 2016 Page 1
Date: 21 November 2016 Page 1 2. SYNOPSIS Name of Sponsor: Amgen Inc., Thousand Oaks, CA, USA Name of Finished Product: Prolia Name of Active Ingredient: denosumab Title of Study: Randomized, Double-blind,
More information