Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments
|
|
- Reginald Armstrong
- 5 years ago
- Views:
Transcription
1 Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that can run 12 different tests on a blood sample and do one test per second. Point of Care Testing (PC) is now done at the bedside, in clinics and physician s offices, etc. These are typically used for screening and in some cases monitoring to guide therapy (IR), but are not used as a diagnostic test. PC tests are performed using smaller, less costly instruments and include blood chemistries, ABGs, coagulation tests, microbiology, and MI injury markers. Home Tests are now available for many of the common screening and monitoring tests. They include collection kits, where the patient collects a sample and mails to a central lab for analysis (occult blood, cholesterol, and TSH) and complete tests, where the patient performs the complete analysis (glucose, ovulation, pregnancy, even HIV ).
2 Screening tests are performed on healthy individual to detect disease at an early stage. They are quick, inexpensive, and reliable but do not provide a definitive answer. Examples include chemistry panel, lipid profile, TB skin test, fecal occult blood. Diagnostic tests are performed on at-risk individuals. They are used to confirm a suspected diagnosis. Remember, all lab results must be evaluated in the context of all other clinical evidence; lab errors, sample handling errors, general trends, patient-specific factors, etc. Some Terminology Analyte ~ the compound that is of interest in the analytic test Accuracy ~ how close is the measured value to the actual value Precision ~ how reproducible is the measurement Sensitivity ~ how good is the test at actually detecting the sample when it truly exists (minimal false negatives) Specificity ~ how good is the test at detecting only the desired sample (minimal false positives) Qualitative test ~ the result is reported as a yes or no result only Quantitative test ~ the result reports an exact numerical value Reference Range ~ a statistically derived numerical range of values that is typical in a normal individual. This is derived by testing a sample population and determining the mean and standard deviation of the measurement. ote that the reference range may show significant physiological variation (age, gender, ethnicity, etc.) and may vary from lab to lab.
3 Diagnostic Assays Spectroscopy (absorbance and fluorescence) ~ direct vs. indirect F e I I F e o r t h o - p h e n a n t h r o l i n e F e r r o u s t r i s - o - p h e n a n t h r o l i n e orange-red Coupled Enzyme Assays ~ typically measured spectrophotometrically. - H 3 + aspartate transaminase H 3 + aspartate α-ketoglutarate oxaloacetate glutamate malate dehydrogenase ADH + H + AD + - H - AD + in blue; ADH in red malate Agglutination Enzyme Linked ImmunoSorbant Assay (ELISA)
4 Flow Cytometry
5 Lab Values You Will eed to Know (i.e., memorize): Chem-7 a + K + Cl - HC 3 - BU Scr Glucose Chem-10 ABG Lipid Panel CBC w/ Dif Absolute eutrophil Count (AC) Serum Proteins/Enzymes Blood Sugar Lipids plus Ca 2+, Mg 2+, phosphorous Arterial ph, HC 3 -, p 2, pc 2 Base Excess (B.E.) Arterial oxygen saturation (Sa 2 ) Triglycerides Total Cholesterol LDL RBC, WBC, platelets Hb, Hct eutrophils, eutrophils absolute (AC) Eosinophils, Eosinophils absolute Basophils, Basophils absolute Lymphocytes, Lymphocytes absolute Monocytes, Monocytes absolute Total Protein Albumin International ormalized Ratio (IR) Prothrombin Time (PT) Alanine transaminase (ALT) Aspartate aminotransferase (AST) Serum bilirubin Urine bilirubin Glucose Triglycerides Total Cholesterol LDL
6 Study Guide Terms You eed to Know Accuracy Analyte egative control Positive control Precision Qualitative test Quantitative test Reference Range Semi-Quantitative test Sensitivity (false negatives) Specificity (false positives) You should be prepared to describe the difference between a clinical lab, a point of care test, and a home test. You should be prepared to contrast home collection and mail vs. complete home test. Be prepared to describe the difference between a Screening test and a Diagnostic test. How are they used? Lab values that you need to memorize will be indicated throughout the course. For all lab values discussed in class throughout the quarter, be prepared to recognize a patient lab value that is out of the range and why it is relevant to diagnosing a clinical problem and/or monitoring a therapeutic outcome.
NORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationVOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008
VOICE Screening Part 1 Visit Operational Walkthrough Johannesburg, South Africa November 2008 Protocol Requirements Administrative, Behavioral, and Regulatory Procedures Informed consent for screening
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationBIOCHEMISTRY of BLOOD
BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationDIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationThe following is a list of Fee-for-Service (FFS) outpatient laboratory Facility Approval Categories by fee item.
MINISTRY OF HEALTH FEE FOR SERVICE OUTPATIENT LABORATORY FACILITY APPROVAL CATEGORIES October 1, 2015 Revised March 15, 2019 Introduction The following is a list of Fee-for-Service (FFS) outpatient laboratory
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationPediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS
Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada
More informationPresented by Marcelo Cardona, MT(ASCP) Johns Hopkins University
Presented by Marcelo Cardona, MT(ASCP) Johns Hopkins University Alert or critical values represent those assay results that require prompt, rapid clinical attention to avert significant study-participant
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationDuring the past two decades,
Prospectively validated prediction of physiologic variables and organ failure in septic patients: The Systemic Mediator Associated Response Test (SMART) Gus J. Slotman, MD Objective: Conventional outcomes
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationPathophysiology I Liver and Biliary Disease
Pathophysiology I Liver and Biliary Disease The Liver The liver is located in the right upper portion of the abdominal cavity just beneath the right side of the rib cage. The liver has many functions that
More informationLab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure.
Patient Education Lab Values Explained Common Tests to Help Diagnose Kidney Disease Lab work, urine samples and other tests may be given as you undergo diagnosis and treatment for renal failure. The test
More informationWhat if you could help your team realise their health goals?
What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationProtein & Enzyme Lab (BBT 314)
Protein & Enzyme Lab (BBT 314) Experiment 3 A: Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Bioanalyzer Background: Alanine aminotransferase (glutamate pyruvate transaminase)
More informationHematology Revision. By Dr.AboRashad . Mob
1 1- Hb A2 is consisting of: a) 3 ά chains and 2 γ chains b) 2 ά chains and 2 β chains c) 2 ά chains and 2 δ chains** d) 2 ά chains and 3 δ chains e) 3 ά chains and 2 δ chains 2- The main (most) Hb found
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationADPedKD: detailed description of data which will be collected in this registry
ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationResearch Data Available
Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationProficiency Testing LABFACTS Requirements for good laboratory practice and COLA Laboratory Accreditation programs are underlined.
Proficiency Testing LABFACTS 8 INTRODUCTION Proficiency testing (PT) is an important aspect of an overall quality assurance program. PT serves as an external check to verify the accuracy of a 's results
More informationCLINICAL CHEMISTRY REAGENTS. Product Profile
Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationREGISTRATION IS OPEN FOR SPRING SEASON 2017 SPRING SPECIAL OLYMPICS REGISTRATION BOCCE TEAM STARTS 4/4 TRACK STARTS 4/6
GUTS March 8, 2017 2017 SPRING SPECIAL OLYMPICS REGISTRATION BOCCE TEAM STARTS 4/4 REGISTRATION IS OPEN FOR SPRING SEASON TRACK STARTS 4/6 We are glad to announce that Union County Special Olympics Track
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationAnnex to the Accreditation Certificate D-ML according to ISO 15189:2012
Deutsche Akkreditierungsstelle GmbH according to ISO 15189:2012 Period of validity: 31.10.2016 to 30.10.2021 Date of issue: 31.10.2016 Holder of certificate: Medlab Ghana Limited 17 Ridge Road, Roman Ridge,
More informationSupplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
More informationEpic Labs Orderable As STAT PRIORITY As of 06/22/2016
ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More informationAlaska Native Medical Center Anchorage, AK
ANMC Lab Test Requirements Key: Room Temp (20-25C), Refrigerated (2-8C), (-15 to -25C), Hr (Hours), D (Days), W (Weeks), Mo (Months), Yr (Years). Basic Processing Instructions: Centrifuge all blood specimens
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More information2014 Notice to Physicians
2014 Notice to Physicians August 20, 2014 Dear Physician, will only pay for tests that are deemed medically necessary. These regulations impact physicians who order the tests as well as the laboratories
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationAnnual Notice to Providers (2014)
8901 West Lincoln Avenue, West Allis, WI 53227 5400 Pearl, Rosemont, IL 60018 Annual Notice to Providers (2014) May 2014 Dear Physician/Client: The Medicare Program encourages clinical laboratories to
More informationAspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:
Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf
More information* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil
LL - LL-ROHINI (NATIONAL REFERENCE 136235212 Age Unknown Gender Unknown 5/6/2017 103400AM 5/6/2017 105702AM 5/6/2017 35028M Ref By Final Swasth lus Health Basic anel URINE EXAMINATION, ROUTINE; URINE,
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationAspartate Aminotransferase Test Code: AST
Aspartate Aminotransferase Test Code: AST Intended Use For in vitro diagnostic use only CARESIDE Aspartate Aminotransferase (AST) cartridges are used with the CARESIDE Analyzer to quantitatively measure
More informationIn Office Lab Testing
Effective January 1, 201, the lab services below can be performed and reimbursed in an office setting. All other office-based lab services must be submitted through our contracted laboratory providers.
More informationSPECTRA EAST, INC. Rockleigh, NJ
A2LA has accredited SPECTRA EAST, INC. Rockleigh, NJ for technical competence in the field of Medical Testing This laboratory is accredited in accordance with the recognized International Standard ISO/IEC
More informationBIOO RESEARCH PRODUCTS. Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:
BIOO RESEARCH PRODUCTS Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 BIOO Scientific 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure
More informationGeneral Chemistry Scheme Guide
General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....
More information1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00
Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationTotal Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment
Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment P.C.G. Gontard 1, L.I. Stankevich 1, B.G. Gorodetsky 1 SUMMARY Clinical laboratories across the globe operate in
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Goadsby PJ, Reuter U, Hallström Y, et al. A controlled trial
More informationUnclear ALT Yes Monthly for first 3 months, then every 3 months EFV: 6 weeks. count, chemistry Full blood count, Creatinine, ALT, AST
Supplementary Table S1: Monitoring strategies Study Time to toxic event Type of AE monitoring Frequency of AE monitoring Symptom* Laboratory Baseline Routine Boulle, 2008 Change NVP: 8 weeks Unclear ALT
More informationPFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550
More informationMipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3
(ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,
More informationBureau of Laboratory Quality Standards Page 1 of 13
Clinical Chemistry 1. Lithium Heparin Plasma Glucose Glucose Hexokinase : Cobas c6000,c8000 2. Lithium Heparin Plasma BUN Urease,Kinetic : Cobas c6000,c8000 3. Lithium Heparin Plasma Creatinine Enzymatic
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationExperiment 6. Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Biophotometer
Experiment 6 Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Biophotometer Background: Alanine aminotransferase (glutamate pyruvate transaminase) belongs to the group
More informationWelcome to Wellivo Global
Welcome to Wellivo Global Wellivo Global is established with the noble vision of financial freedom for the masses. We have clear cognizance of this goal from its very inception. Our aim is to provide a
More informationM. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS. Phil Collins. Flea. Robin Williams.
M. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS Phil Collins Flea Steve Jobs Sting Robin Williams BLOOD COMPONENTS 8% by weight; 4-6 liters by volume
More informationISO 15189:2012 Internationally-Recognized Accredited Laboratory. SPECTRA EAST, INC. Rockleigh, NJ
ISO 15189:2012 Internationally-Recognized Accredited Laboratory A2LA has accredited SPECTRA EAST, INC. Rockleigh, NJ for technical competence in the field of Clinical Testing This laboratory is accredited
More informationInterpreting Liver Function Tests
PSH Clinical Guidelines Statement 2017 Interpreting Liver Function Tests Dr. Asad A Chaudhry Consultant Hepatologist, Chaudhry Hospital, Gujranwala, Pakistan. Liver function tests (LFTs) generally refer
More information