Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments

Size: px
Start display at page:

Download "Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments"

Transcription

1 Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that can run 12 different tests on a blood sample and do one test per second. Point of Care Testing (PC) is now done at the bedside, in clinics and physician s offices, etc. These are typically used for screening and in some cases monitoring to guide therapy (IR), but are not used as a diagnostic test. PC tests are performed using smaller, less costly instruments and include blood chemistries, ABGs, coagulation tests, microbiology, and MI injury markers. Home Tests are now available for many of the common screening and monitoring tests. They include collection kits, where the patient collects a sample and mails to a central lab for analysis (occult blood, cholesterol, and TSH) and complete tests, where the patient performs the complete analysis (glucose, ovulation, pregnancy, even HIV ).

2 Screening tests are performed on healthy individual to detect disease at an early stage. They are quick, inexpensive, and reliable but do not provide a definitive answer. Examples include chemistry panel, lipid profile, TB skin test, fecal occult blood. Diagnostic tests are performed on at-risk individuals. They are used to confirm a suspected diagnosis. Remember, all lab results must be evaluated in the context of all other clinical evidence; lab errors, sample handling errors, general trends, patient-specific factors, etc. Some Terminology Analyte ~ the compound that is of interest in the analytic test Accuracy ~ how close is the measured value to the actual value Precision ~ how reproducible is the measurement Sensitivity ~ how good is the test at actually detecting the sample when it truly exists (minimal false negatives) Specificity ~ how good is the test at detecting only the desired sample (minimal false positives) Qualitative test ~ the result is reported as a yes or no result only Quantitative test ~ the result reports an exact numerical value Reference Range ~ a statistically derived numerical range of values that is typical in a normal individual. This is derived by testing a sample population and determining the mean and standard deviation of the measurement. ote that the reference range may show significant physiological variation (age, gender, ethnicity, etc.) and may vary from lab to lab.

3 Diagnostic Assays Spectroscopy (absorbance and fluorescence) ~ direct vs. indirect F e I I F e o r t h o - p h e n a n t h r o l i n e F e r r o u s t r i s - o - p h e n a n t h r o l i n e orange-red Coupled Enzyme Assays ~ typically measured spectrophotometrically. - H 3 + aspartate transaminase H 3 + aspartate α-ketoglutarate oxaloacetate glutamate malate dehydrogenase ADH + H + AD + - H - AD + in blue; ADH in red malate Agglutination Enzyme Linked ImmunoSorbant Assay (ELISA)

4 Flow Cytometry

5 Lab Values You Will eed to Know (i.e., memorize): Chem-7 a + K + Cl - HC 3 - BU Scr Glucose Chem-10 ABG Lipid Panel CBC w/ Dif Absolute eutrophil Count (AC) Serum Proteins/Enzymes Blood Sugar Lipids plus Ca 2+, Mg 2+, phosphorous Arterial ph, HC 3 -, p 2, pc 2 Base Excess (B.E.) Arterial oxygen saturation (Sa 2 ) Triglycerides Total Cholesterol LDL RBC, WBC, platelets Hb, Hct eutrophils, eutrophils absolute (AC) Eosinophils, Eosinophils absolute Basophils, Basophils absolute Lymphocytes, Lymphocytes absolute Monocytes, Monocytes absolute Total Protein Albumin International ormalized Ratio (IR) Prothrombin Time (PT) Alanine transaminase (ALT) Aspartate aminotransferase (AST) Serum bilirubin Urine bilirubin Glucose Triglycerides Total Cholesterol LDL

6 Study Guide Terms You eed to Know Accuracy Analyte egative control Positive control Precision Qualitative test Quantitative test Reference Range Semi-Quantitative test Sensitivity (false negatives) Specificity (false positives) You should be prepared to describe the difference between a clinical lab, a point of care test, and a home test. You should be prepared to contrast home collection and mail vs. complete home test. Be prepared to describe the difference between a Screening test and a Diagnostic test. How are they used? Lab values that you need to memorize will be indicated throughout the course. For all lab values discussed in class throughout the quarter, be prepared to recognize a patient lab value that is out of the range and why it is relevant to diagnosing a clinical problem and/or monitoring a therapeutic outcome.

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

CTAD as a universal anticoagulant

CTAD as a universal anticoagulant Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of

More information

VOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008

VOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008 VOICE Screening Part 1 Visit Operational Walkthrough Johannesburg, South Africa November 2008 Protocol Requirements Administrative, Behavioral, and Regulatory Procedures Informed consent for screening

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

What Does My Blood Test Mean

What Does My Blood Test Mean What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential

More information

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150. Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,

More information

BIOCHEMISTRY of BLOOD

BIOCHEMISTRY of BLOOD BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

DIABETES AND LABORATORY TESTS. Author: Josephine Davis DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following

More information

* * Interpretation

* * Interpretation LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)

More information

The following is a list of Fee-for-Service (FFS) outpatient laboratory Facility Approval Categories by fee item.

The following is a list of Fee-for-Service (FFS) outpatient laboratory Facility Approval Categories by fee item. MINISTRY OF HEALTH FEE FOR SERVICE OUTPATIENT LABORATORY FACILITY APPROVAL CATEGORIES October 1, 2015 Revised March 15, 2019 Introduction The following is a list of Fee-for-Service (FFS) outpatient laboratory

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300 Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This

More information

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada

More information

Presented by Marcelo Cardona, MT(ASCP) Johns Hopkins University

Presented by Marcelo Cardona, MT(ASCP) Johns Hopkins University Presented by Marcelo Cardona, MT(ASCP) Johns Hopkins University Alert or critical values represent those assay results that require prompt, rapid clinical attention to avert significant study-participant

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Routine Clinic Lab Studies

Routine Clinic Lab Studies Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection

More information

During the past two decades,

During the past two decades, Prospectively validated prediction of physiologic variables and organ failure in septic patients: The Systemic Mediator Associated Response Test (SMART) Gus J. Slotman, MD Objective: Conventional outcomes

More information

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Total Cholesterol A Type of Fat. LDL Bad Cholesterol. HDL Good Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely

More information

Pathophysiology I Liver and Biliary Disease

Pathophysiology I Liver and Biliary Disease Pathophysiology I Liver and Biliary Disease The Liver The liver is located in the right upper portion of the abdominal cavity just beneath the right side of the rib cage. The liver has many functions that

More information

Lab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure.

Lab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure. Patient Education Lab Values Explained Common Tests to Help Diagnose Kidney Disease Lab work, urine samples and other tests may be given as you undergo diagnosis and treatment for renal failure. The test

More information

What if you could help your team realise their health goals?

What if you could help your team realise their health goals? What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Protein & Enzyme Lab (BBT 314)

Protein & Enzyme Lab (BBT 314) Protein & Enzyme Lab (BBT 314) Experiment 3 A: Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Bioanalyzer Background: Alanine aminotransferase (glutamate pyruvate transaminase)

More information

Hematology Revision. By Dr.AboRashad . Mob

Hematology Revision. By Dr.AboRashad  . Mob 1 1- Hb A2 is consisting of: a) 3 ά chains and 2 γ chains b) 2 ά chains and 2 β chains c) 2 ά chains and 2 δ chains** d) 2 ά chains and 3 δ chains e) 3 ά chains and 2 δ chains 2- The main (most) Hb found

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

ADPedKD: detailed description of data which will be collected in this registry

ADPedKD: detailed description of data which will be collected in this registry ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

Results Report. Welcome to Your ABT Report!

Results Report. Welcome to Your ABT Report! Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be

More information

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

ROUTINE LAB STUDIES. Routine Clinic Lab Studies ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not

More information

Proficiency Testing LABFACTS Requirements for good laboratory practice and COLA Laboratory Accreditation programs are underlined.

Proficiency Testing LABFACTS Requirements for good laboratory practice and COLA Laboratory Accreditation programs are underlined. Proficiency Testing LABFACTS 8 INTRODUCTION Proficiency testing (PT) is an important aspect of an overall quality assurance program. PT serves as an external check to verify the accuracy of a 's results

More information

CLINICAL CHEMISTRY REAGENTS. Product Profile

CLINICAL CHEMISTRY REAGENTS. Product Profile Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

REGISTRATION IS OPEN FOR SPRING SEASON 2017 SPRING SPECIAL OLYMPICS REGISTRATION BOCCE TEAM STARTS 4/4 TRACK STARTS 4/6

REGISTRATION IS OPEN FOR SPRING SEASON 2017 SPRING SPECIAL OLYMPICS REGISTRATION BOCCE TEAM STARTS 4/4 TRACK STARTS 4/6 GUTS March 8, 2017 2017 SPRING SPECIAL OLYMPICS REGISTRATION BOCCE TEAM STARTS 4/4 REGISTRATION IS OPEN FOR SPRING SEASON TRACK STARTS 4/6 We are glad to announce that Union County Special Olympics Track

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Annex to the Accreditation Certificate D-ML according to ISO 15189:2012

Annex to the Accreditation Certificate D-ML according to ISO 15189:2012 Deutsche Akkreditierungsstelle GmbH according to ISO 15189:2012 Period of validity: 31.10.2016 to 30.10.2021 Date of issue: 31.10.2016 Holder of certificate: Medlab Ghana Limited 17 Ridge Road, Roman Ridge,

More information

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

Supplementary Note Details of the patient populations studied Strengths and weakness of the study Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined

More information

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016 ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE

More information

Alaska Native Medical Center Anchorage, AK

Alaska Native Medical Center Anchorage, AK ANMC Lab Test Requirements Key: Room Temp (20-25C), Refrigerated (2-8C), (-15 to -25C), Hr (Hours), D (Days), W (Weeks), Mo (Months), Yr (Years). Basic Processing Instructions: Centrifuge all blood specimens

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

2014 Notice to Physicians

2014 Notice to Physicians 2014 Notice to Physicians August 20, 2014 Dear Physician, will only pay for tests that are deemed medically necessary. These regulations impact physicians who order the tests as well as the laboratories

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Annual Notice to Providers (2014)

Annual Notice to Providers (2014) 8901 West Lincoln Avenue, West Allis, WI 53227 5400 Pearl, Rosemont, IL 60018 Annual Notice to Providers (2014) May 2014 Dear Physician/Client: The Medicare Program encourages clinical laboratories to

More information

Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:

Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf

More information

* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil

* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil LL - LL-ROHINI (NATIONAL REFERENCE 136235212 Age Unknown Gender Unknown 5/6/2017 103400AM 5/6/2017 105702AM 5/6/2017 35028M Ref By Final Swasth lus Health Basic anel URINE EXAMINATION, ROUTINE; URINE,

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Aspartate Aminotransferase Test Code: AST

Aspartate Aminotransferase Test Code: AST Aspartate Aminotransferase Test Code: AST Intended Use For in vitro diagnostic use only CARESIDE Aspartate Aminotransferase (AST) cartridges are used with the CARESIDE Analyzer to quantitatively measure

More information

In Office Lab Testing

In Office Lab Testing Effective January 1, 201, the lab services below can be performed and reimbursed in an office setting. All other office-based lab services must be submitted through our contracted laboratory providers.

More information

SPECTRA EAST, INC. Rockleigh, NJ

SPECTRA EAST, INC. Rockleigh, NJ A2LA has accredited SPECTRA EAST, INC. Rockleigh, NJ for technical competence in the field of Medical Testing This laboratory is accredited in accordance with the recognized International Standard ISO/IEC

More information

BIOO RESEARCH PRODUCTS. Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:

BIOO RESEARCH PRODUCTS. Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: BIOO RESEARCH PRODUCTS Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 BIOO Scientific 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure

More information

General Chemistry Scheme Guide

General Chemistry Scheme Guide General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....

More information

1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00

1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00 Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000

More information

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of

More information

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment P.C.G. Gontard 1, L.I. Stankevich 1, B.G. Gorodetsky 1 SUMMARY Clinical laboratories across the globe operate in

More information

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Goadsby PJ, Reuter U, Hallström Y, et al. A controlled trial

More information

Unclear ALT Yes Monthly for first 3 months, then every 3 months EFV: 6 weeks. count, chemistry Full blood count, Creatinine, ALT, AST

Unclear ALT Yes Monthly for first 3 months, then every 3 months EFV: 6 weeks. count, chemistry Full blood count, Creatinine, ALT, AST Supplementary Table S1: Monitoring strategies Study Time to toxic event Type of AE monitoring Frequency of AE monitoring Symptom* Laboratory Baseline Routine Boulle, 2008 Change NVP: 8 weeks Unclear ALT

More information

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550

More information

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3 (ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,

More information

Bureau of Laboratory Quality Standards Page 1 of 13

Bureau of Laboratory Quality Standards Page 1 of 13 Clinical Chemistry 1. Lithium Heparin Plasma Glucose Glucose Hexokinase : Cobas c6000,c8000 2. Lithium Heparin Plasma BUN Urease,Kinetic : Cobas c6000,c8000 3. Lithium Heparin Plasma Creatinine Enzymatic

More information

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used

More information

Experiment 6. Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Biophotometer

Experiment 6. Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Biophotometer Experiment 6 Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Biophotometer Background: Alanine aminotransferase (glutamate pyruvate transaminase) belongs to the group

More information

Welcome to Wellivo Global

Welcome to Wellivo Global Welcome to Wellivo Global Wellivo Global is established with the noble vision of financial freedom for the masses. We have clear cognizance of this goal from its very inception. Our aim is to provide a

More information

M. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS. Phil Collins. Flea. Robin Williams.

M. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS. Phil Collins. Flea. Robin Williams. M. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS Phil Collins Flea Steve Jobs Sting Robin Williams BLOOD COMPONENTS 8% by weight; 4-6 liters by volume

More information

ISO 15189:2012 Internationally-Recognized Accredited Laboratory. SPECTRA EAST, INC. Rockleigh, NJ

ISO 15189:2012 Internationally-Recognized Accredited Laboratory. SPECTRA EAST, INC. Rockleigh, NJ ISO 15189:2012 Internationally-Recognized Accredited Laboratory A2LA has accredited SPECTRA EAST, INC. Rockleigh, NJ for technical competence in the field of Clinical Testing This laboratory is accredited

More information

Interpreting Liver Function Tests

Interpreting Liver Function Tests PSH Clinical Guidelines Statement 2017 Interpreting Liver Function Tests Dr. Asad A Chaudhry Consultant Hepatologist, Chaudhry Hospital, Gujranwala, Pakistan. Liver function tests (LFTs) generally refer

More information