Silencing neurotransmission with membrane-tethered toxins

Size: px
Start display at page:

Download "Silencing neurotransmission with membrane-tethered toxins"

Transcription

1 nature methods Silencing neurotransmission with membrane-tethered toxins Sebastian Auer, Annika S Stürzebecher, René Jüttner, Julio Santos-Torres, Christina Hanack, Silke Frahm, Beate Liehl & Inés Ibañez-Tallon Supplementary figures and text: Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Expression analysis of t-toxins in cultured mammalian cells. T-toxin expression does not interfere with sodium currents or action potential generation in neurons of rat hippocampus culture. T-toxin expression does not impair neuronal survival in infected rat hippocampus culture. RT-PCR analyses show expression of MVIIA-G transcripts exclusively in DRGs of Tg(Scn10a-MVIIA-G)109Iit mice. Overview of generated tethered toxins targeting voltage-gated Ca 2+ -channels. Passive membrane properties of t-toxin infected neurons remain unaltered. Used primers for RT-PCR and quantitative real-time PCR.

2 Supplementary Figure 1 Expression analysis of t-toxins in cultured mammalian cells. (a) HeLa cells transduced with MVIIA-PE (upper panel) or MVIIA-PC (lower panel) show direct fluorescence and are positive for flag immunostaining without cell permeabilization. Scale bars, 10 µm. (b) Western Blot analysis directed against the flag-tag of protein extracts from transduced HEK293T cells shows expected molecular weights of expressed t-toxins (PE: 36,5 kda, MVIIA-PE: 39,2 kda, AgaIVA-VG: 38 kda and 36 kda (double band indicates unprocessed peptide containing the hydrophobic signal sequence for GPI attachment and the mature cleaved GPI-form).

3 Supplementary Figure 2 T-toxin expression does not interfere with sodium currents or action potential generation in neurons of rat hippocampus culture. (a) Representative sodium currents induced by depolarizing pulses from -70 to +20 mv show no differences between control (noninfected) and MVIIA-PE + AgaIVA-VG infected cells. (b) Sodium current maximal amplitudes were unaltered between control (non-infected) and MVIIA-PE + AgaIVA-VG infected cells. p=0.48, n=10 cells each. (c) Representative example traces of spiking behavior in control (non-infected), no toxin- PE, MVIIA-PE + AgaIVA-VG infected cells and cells with application of soluble MVIIA + AgaIVA indicating unaltered action potential firing properties in current clamp recordings. (d) Spiking behavior by application of depolarizing current to infected hippocampal neurons shows no significant differences between no toxin-pe and MVIIA-PE + AgaIVA-VG expressing cells (n=7 for each).

4 Supplementary Figure 3 T-toxin expression does not impair neuronal survival in infected rat hippocampus culture. (a) No neuronal cell death due to t-toxin expression was observed in hippocampal neurons by monitoring with the neuronal marker (NeuN) 6 days after infection and quantification of surviving neurons with respect to control conditions (non-infected) (data of three independent experiments). (b) Fluorescence images showing NeuN stained neurons (red), GFP expression (green) and merge. Scale bars, 50 µm. Supplementary Figure 4 RT-PCR analyses show expression of MVIIA-G transcripts exclusively in DRGs of Tg(Scn10a-MVIIA-G)109Iit mice. Scn10a transcripts, which encode for Na v 1.8, were detected only in dorsal root ganglia (DRG) of wildtype (wt) and transgenic (Tg) mice. Cacna1B transcripts, which encode for Ca v 2.2 were detected in all tissue but skin. Positive control: Actb transcripts, encoding for ß-Actin. sk: skin, sc: spinal cord, bs: brain stem, ctx: cortex.

5 Supplementary Table 1 Overview of generated tethered toxins targeting voltage-gated Ca 2+ - channels. The optimization process required a variety of combinations including the toxin domain 1-5, the fluorescent reporter proteins, the epitope tag, the transmembrane or GPI anchoring sequences and linker peptides for surface expression. Expression analyses of t-toxins were carried out by Western Blot and/or immunofluorescence in injected oocytes, transduced HEK293T and HeLa cells and rat hippocampus neuronal cultures. Subsequent electrophysiological recordings in Xenopus laevis oocytes, Ca v 2.2 expressing stably transfected HEK293 cells and rat hippocampus culture were used for assessing the toxin functionality. Three transmembrane domains were tested: the TM domain of NYD-SP16 6, the β1-subunit of Na v channels 7 and the TM domain of the PDGF receptor (PDGF-R). As flexible linker, a sequence with glycine-asparagine repeats (23 aa) was used. The sequence of the integrated export ER signal (EResc) used in some constructs was FCYENEV.

6 Supplementary Table 2 Passive membrane properties of t-toxin infected neurons remain unaltered. The capacitance as well as the membrane resistance of hippocampal neurons infected with the control lentivirus (no toxin-pe) or with the t-toxin lentiviruses MVIIA-PE and AgaIVA-VG, show no significant difference to non-infected control cells, indicating that t-toxin expression does not impair neuronal membrane properties.

7 Supplementary Table 3 Used primers for RT-PCR and quantitative real-time PCR.

8 SUPPLEMENTARY REFERENCES 1. Olivera, B.M., et al. Neuronal calcium channel antagonists. Discrimination between calcium channel subtypes using omega-conotoxin from Conus magus venom. Biochemistry 26, (1987). 2. Olivera, B.M., McIntosh, J.M., Cruz, L.J., Luque, F.A. & Gray, W.R. Purification and sequence of a presynaptic peptide toxin from Conus geographus venom. Biochemistry 23, (1984). 3. Hillyard, D.R., et al. A new Conus peptide ligand for mammalian presynaptic Ca2+ channels. Neuron 9, (1992). 4. Mintz, I.M., et al. P-type calcium channels blocked by the spider toxin [omega]-aga- IVA. Nature 355, (1992). 5. Mintz, I.M., Venema, V.J., Adams, M.E. & Bean, B.P. Inhibition of N- and L-type Ca2+ channels by the spider venom toxin omega-aga-iiia. Proc Natl Acad Sci U S A 88, (1991). 6. Cheng, L.J., et al. NYD-SP16, a novel gene associated with spermatogenesis of human testis. Biol Reprod 68, (2003). 7. Zimmer, T., Biskup, C., Bollensdorff, C. & Benndorf, K. The beta1 subunit but not the beta2 subunit colocalizes with the human heart Na+ channel (hh1) already within the endoplasmic reticulum. J Membr Biol 186, (2002).

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Early electrophysiological recordings from neurons, muscle and endocrine cells revealed

Early electrophysiological recordings from neurons, muscle and endocrine cells revealed CHAPTER 5 Molecular Properties of Voltage-Gated Calcium Channels Terrance P. Snutch, Jean Peloquin, Eleanor Mathews and John E. McRory Native Voltage-Gated Ca Channels Early electrophysiological recordings

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'-

Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'- Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'- hydroxyl-n-isobutyl-2,6,8,10-dodeca-tetraenamide) and (bottom) hydroxy-β-sanshool (2E,6E,8E,10E)-2'-hydroxyl-N-isobutyl-

More information

Voltage Gated Ion Channels

Voltage Gated Ion Channels Voltage Gated Ion Channels The Machines That Make It Possible... Topics I Introduction Electrochemical Gradients Passive Membrane Properties Action Potential Voltage-Gated Ion Channels Ligand-Gated Ion

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Charlie Taylor, PhD CpTaylor Consulting Chelsea, MI, USA

Charlie Taylor, PhD CpTaylor Consulting Chelsea, MI, USA Contribution of Calcium Channel α 2 δ Binding Sites to the Pharmacology of Gabapentin and Pregabalin Charlie Taylor, PhD CpTaylor Consulting Chelsea, MI, USA Disclosure Information Charlie Taylor, PhD

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

s u p p l e m e n ta ry i n f o r m at i o n

s u p p l e m e n ta ry i n f o r m at i o n Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)

More information

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1 The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

Structure, function and therapeutic potential of omega conopeptides: Novel blockers of neuronal calcium channels

Structure, function and therapeutic potential of omega conopeptides: Novel blockers of neuronal calcium channels Proc. Indian Acad. Sci. (Chem. Sci.), Vol. 106, No. 6, November 1994, pp. 1383-1387. 9 Printed in India. Structure, function and therapeutic potential of omega conopeptides: Novel blockers of neuronal

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following

More information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,

More information

Supplementary Figure 1

Supplementary Figure 1 Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke

Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke SUPPLEMENTARY INFORMATION doi:10.1038/nature09511 Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke Pre Post 7-days Systolic Diastolic BPM Systolic Diastolic BPM Systolic

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature588 SUPPLEMENTARY INFORMATION Supplemental Information Sensory neuron sodium channel Na v 1.8 is essential for pain at cold temperatures Katharina Zimmermann*, Andreas Leffler*, Alexandru

More information

Dep. Control Time (min)

Dep. Control Time (min) aa Control Dep. RP 1s 1 mv 2s 1 mv b % potentiation of IPSP 2 15 1 5 Dep. * 1 2 3 4 Time (min) Supplementary Figure 1. Rebound potentiation of IPSPs in PCs. a, IPSPs recorded with a K + gluconate pipette

More information

Cellular Neurobiology BIPN140. 1st Midterm Exam October 18 th, Tuesday Material covered: Lectures 1-6 & Reading

Cellular Neurobiology BIPN140. 1st Midterm Exam October 18 th, Tuesday Material covered: Lectures 1-6 & Reading Cellular Neurobiology BIPN140 1st Midterm Exam October 18 th, Tuesday Material covered: Lectures 1-6 & Reading Review session October 17 th 3500 Pacitic Hall, 6-8 pm (access code is 127895) Come with questions!

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Distinction among Neuronal Subtypes of Voltage-Activated Sodium Channels by -Conotoxin PIIIA

Distinction among Neuronal Subtypes of Voltage-Activated Sodium Channels by -Conotoxin PIIIA The Journal of Neuroscience, January 1, 2000, 20(1):76 80 Distinction among Neuronal Subtypes of Voltage-Activated Sodium Channels by -Conotoxin PIIIA Patrick Safo, 1 Tamara Rosenbaum, 1 Anatoly Shcherbatko,

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Bidirectional optogenetic modulation of the tonic activity of CEA PKCδ + neurons in vitro. a, Top, Cell-attached voltage recording illustrating the blue light-induced increase in

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol.

Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol. Supplementary Figures 1-11 Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol. (a), Voltage-clamp recordings from CA1 pyramidal neurons

More information

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department

More information

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

A. List of selected proteins with high SILAC (H/L) ratios identified in mass Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses Yichen Shi 1,2, Peter Kirwan 1,2, James Smith 1,2, Hugh P.C. Robinson 3 and Frederick

More information

How Nicotinic Signaling Shapes Neural Networks

How Nicotinic Signaling Shapes Neural Networks How Nicotinic Signaling Shapes Neural Networks Darwin K. Berg Division of Biological Sciences University of California, San Diego Nicotinic Cholinergic Signaling Uses the transmitter ACh to activate cation-selective

More information

Ube3a is required for experience-dependent maturation of the neocortex

Ube3a is required for experience-dependent maturation of the neocortex Ube3a is required for experience-dependent maturation of the neocortex Koji Yashiro, Thorfinn T. Riday, Kathryn H. Condon, Adam C. Roberts, Danilo R. Bernardo, Rohit Prakash, Richard J. Weinberg, Michael

More information

Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were

Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Neocortex Zbtb20 / NFIA / Sox9

Neocortex Zbtb20 / NFIA / Sox9 Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive

More information

Page 1 of 5 Bruce Palmer Bean, PH.D. Title Professor of Neurobiology Institution Harvard Medical School Department Neurobiology Address Harvard Medical School Neurobiology Rm 301 220 Longwood Ave Boston,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

TRPA1 channels regulate astrocyte resting calcium. and inhibitory synapse efficacy through GAT-3

TRPA1 channels regulate astrocyte resting calcium. and inhibitory synapse efficacy through GAT-3 TRPA1 channels regulate astrocyte resting calcium and inhibitory synapse efficacy through GAT-3 * 1 Eiji Shigetomi, * 1 Xiaoping Tong 3 Kelvin Y. Kwan, 3 David P. Corey & 1,2 Baljit S. Khakh Ψ 1 Departments

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Etv4 BU EMM Etv5 BC MMM UI-M-BH3- Elk1 BC MMM

Etv4 BU EMM Etv5 BC MMM UI-M-BH3- Elk1 BC MMM Supplementary Tables In situ hybridization probes Genbank Gene Accession Number Clone ID Cat. No Etv1 BC005645 PCR Etv4 BU053662 5062538 EMM1002-5544031 Etv5 BC034680 4036564 MMM1013-7511524 Fev AI876263

More information

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

Supplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit

Supplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit Supplementary information The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit Anna Raffaello 1,4, Diego De Stefani 1,4, Davide Sabbadin 2, Enrico

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial

More information

Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human

Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97

More information

MCB II MCDB 3451 Exam 1 Spring, minutes, close everything and be concise!

MCB II MCDB 3451 Exam 1 Spring, minutes, close everything and be concise! MCB II MCDB 3451 Exam 1 Spring, 2016 50 minutes, close everything and be concise! Name ID NOTE: QUESTIONS ARE NOT ALL WORTH THE SAME POINTS Total (100) Grade EXAM 1, 2016 MCBII Name 1. Which is UNIQUE

More information

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/2/e1602038/dc1 Supplementary Materials for Mitochondrial metabolic regulation by GRP78 Manoj Prasad, Kevin J. Pawlak, William E. Burak, Elizabeth E. Perry, Brendan

More information

PhD Thesis / Tesi Doctoral

PhD Thesis / Tesi Doctoral PhD Thesis / Tesi Doctoral INTRATHECAL ADMINISTRATION OF AAVrh10 CODING FOR β GLUCURONIDASE CORRECTS BIOCHEMICAL AND HISTOLOGICAL HALLMARKS OF MUCOPOLYSACCHARIDOSIS TYPE VII MICE AND IMPROVES BEHAVIOR

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

SUPPLEMENTARY INFORMATION. The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat. Sensor in Nociceptive Neurons

SUPPLEMENTARY INFORMATION. The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat. Sensor in Nociceptive Neurons SUPPLEMENTARY INFORMATION The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat Sensor in Nociceptive Neurons Hawon Cho, Young Duk Yang, Jesun Lee, Byeongjoon Lee, Tahnbee Kim Yongwoo Jang,

More information

Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell

Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell 2 Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell Experimenter) including the MultiClamp 700B, Digidata 1440A,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

MOLECULAR AND CELLULAR NEUROSCIENCE

MOLECULAR AND CELLULAR NEUROSCIENCE MOLECULAR AND CELLULAR NEUROSCIENCE BMP-218 November 4, 2014 DIVISIONS OF THE NERVOUS SYSTEM The nervous system is composed of two primary divisions: 1. CNS - Central Nervous System (Brain + Spinal Cord)

More information

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Arcuate ChIEF-tdTomato neurons expressed TH These micrographs show that TH-Cre-ChIEF-tdTomato (magenta), expressed by AAV in a TH-Cre mouse, were immunostained with TH (green) in

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Astrocyte signaling controls spike timing-dependent depression at neocortical synapses

Astrocyte signaling controls spike timing-dependent depression at neocortical synapses Supplementary Information Astrocyte signaling controls spike timing-dependent depression at neocortical synapses Rogier Min and Thomas Nevian Department of Physiology, University of Berne, Bern, Switzerland

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information