Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were

Transcription

1 Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression system and left to develop for 7 days. (a) Transverse brainstem section stained with DAPI (blue, stains nucleous), GFP (green, transfection) and PH3 (Red, stains cells in mitosis) showing an aberrant growth of the floor of the IV ventricle containing epithelial malformations and ectopic lumens, note that only an small fraction of the cells expressing β-catenin S33Y are mitotically active. (b) Enlargement of the area indicated by a dotted square in a. Arrows indicate ectopic lumens an epithelium aberrations. Arrowhead points to a group of cells in mitosis. Scale bar is 150 µm.

2 Supplementary Figure 2. sβ-catenin expression induce severe malformations of the neuroepithelium in the hindbrain. HH-12 chicken embryos were electroporated for 48h with β-catenin S33Y. Transverse sections at three different levels of the hindbrain were stained with antibodies against GFP (green, transfection, all), plus Phalloidin (red) and DAPI (blue) in a,b,g,h or PH3 (red) and apkc (blue) in c,f or Sox2 (red) and HuCD (blue) in d or N-Cadherin (red) and apkc (blue) in e. Arrows in b,e,f,h indicate invaginations. In c the arrow indicates an invaginations containing ectopic mitosis (labelled with PH3). In d the arrow indicates groups of precursors (Sox2+) ectopically located at the marginal zone. Pictures in b and h are higher magnification captures of the areas indicated by dotted squares in a and g, respectively. Scale bar is 50 µm.

3 Supplementary Figure 3. sβ-catenin maintains the stemness of neuroblasts (a) Transverse sections of HH-12 chicken neural tubes stained with antibodies against GFP (Green, transfection), Sox2 (Red, progenitor marker), HuCD (Blue, neural differentiation marker) and N-Cadherin (Blue, AJs marker) 48h after electroporation with β-catenin S33Y. (b,c) Percentage of Sox2+ (b) and HuCD+ (c) cells among the control (pcig) or β- Catenin S33Y transfected cells. Because neurogenesis follows a Dorso-Ventral gradient at these developmental stages, the data was analyzed in three differentiated regions: Dorsal, Medial and Ventral. The effect of β-catenin S33Y was more prominent at the ventral neural tube where neurogenesis was more intense. The bargraph represents the mean±sd of at least three independent experiments. A minimum of 200 GFP+ cells were counted for each data point. Scale bar is 50 µm. Supplementary Figure 4. MYCN or CiclinD1 do not cause neuroepithelial aberrations. MYCN, CiclinD1 or a combination of both were electroporated in HH12 chicken embryos for 48h. Both molecules increased the thickness of the neuroepithelium without causing growth aberrations. Scale bar is 50 µm.

4 a b Supplementary Figure 5. pcig electroporation do not alter apico-basal distance. Chicken embryos were analyzed 16, 24, 36 or 48h after electroporation with pcig vector. Transverse sections were stained with antibodies against GFP (Green, transfection) and Phalloidin (Red). Panel a shows a scheme of how the apico-basal distance was measured. For each section, the mean of the apico-basal distance measured at three different dorsoventral levels was calculated in electroporated an non electroporated sides. Panel b shows a dot chart of apical-basal distances at different times after transfection. Scale bar is 50 µm. Supplementary Figure 6. βcatenin S33Y ΔαCat does not bind αcatenin. The association of αcatenin-rfp to βcatenin S33Y FLAG (stable βcat), βcatenin S33Y ΔCT FLAG (no transcriptional activity) or βcatenin S33Y ΔαCat FLAG (αcatenin binding domain deleted) was studied by immunoprecipitation/western blot in transiently transfected HEK293 cells. Antibodies against GFP were used as negative control.

5 Supplementary Figure 7. Overexpression of N-Cadherin, p120 CTN or Par3 do not cause epithelial aberrations. HH12 chicken neural tubes were analyzed 39h after electroporation with N-Cadherin GFP, p120 CTN GFP or Par3 GFP. Transverse sections were stained with antibodies against GFP (Green, shows the cellular distribution of the molecules) and Phalloidin (Red, labels F-actin). None of these molecules caused growth aberrations. Scale bar is 50 µm.

6 Supplementary Figure 8. Active forms of apkc induce neuroepithelial malformations resembling those induced by sβ-catenin. Transverse sections at three different levels of the hindbrain of HH-12 chicken neural tubes 48h after electroporation with apkcζ-δnt. The sections were stained with antibodies against GFP (green, transfection, all), plus PH3 (red) and apkc (blue) a,b,c,i or Sox2 (red) and HuCD (blue) in e or N-Cadherin (red) and apkc (blue) in or in g. Invaginations are indicated by a rrows in g,h and by arrowheads in c,i. Ectopic mitosis are indicated by arrows in a,b,c,d,i,j. Ectopic precursors in the marginal zone are indicated by arrow in e,f. Pictures in b,d,f,h,j are higher magnification captures of the areas indicated by dotted squares in a,c,e,g,i respectively. In some of the high magnification pictures one or two channels have been omitted for clarity. Scale bar is 50 µm.

7 Supplementary Figure 9. Cells expressing apkc ΔNT remain as progenitors and they do not differentiate. HH12 chicken neural tubes were analyzed 39h after electroporation with apkcζ ΔNT. Transverse sections were stained with antibodies against GFP (Green, transfection), HuCD (Red, neural differentiation marker) or Sox2 (Blue, progenitor marker). Scale bar is 50 µm.

8 Supplementary Figure 10. Full gel scans of westerns shown in figure 5a. Pools of 2, 4 or 6 control or sβ-catenin electroporated embryos, were lysed and separated in 8% SDSpolyacrylamide gels. The resulting nitrocellulose membranes were excised in three parts and blotted with the indicated antibodies. Note that anti apkc blot had previously been blotted with anti β-catenin. Only lanes containing 2 embryos were used for quantification.

9 PRKCI F: ttccagtctgggtcttcagg PRKCZ F: ccagaagatggaggaagctg GAPDH F: cctctctggcaaagtccaag R: gcaagagtgcagtccaacaa R: ttgcaggtcagtggaacaag R: catctgcccatttgatgttg Supplementary Table 1: Sequence of primers used for rtrt-pcr.