Supplementary Figures for
|
|
- Griffin Hill
- 5 years ago
- Views:
Transcription
1 Supplementary Figures for SOX2 suppresses CDKN1A to sustain growth of lung squamous cell carcinoma Takuya Fukazawa 1, Minzhe Guo 4, 5, Naomasa Ishida 1, Tomoki Yamatsuji 1, Munenori Takaoka 1, Etsuko Yokota 1, Minoru Haisa 1, Noriko Miyake 3, Tomoko Ikeda 3, Tatsuo Okui 6, Nagio Takigawa 2, Yutaka Maeda 5 and Yoshio Naomoto 1 1 Department of General Surgery, 2 Department of General Internal Medicine 4, 3 Kawasaki Hospital Research Unit, Kawasaki Medical School, Okayama, Japan, ; 4 Department of Electrical Engineering and Computing Systems, University of Cincinnati, Cincinnati, Ohio, 45221; 5 Division of Pulmonary Biology, Cincinnati Children s Hospital Medical Center, Cincinnati, Ohio, ; 6 Division of Hematology and Oncology, Indiana University School of Medicine, Indianapolis, Indiana, Co-corresponding authors: Takuya Fukazawa, M.D., Ph.D. Department of General Surgery, Kawasaki Medical School Nakasange, Okayama , Japan Phone: ; Fax: Fukazawat@aol.com Yutaka Maeda, D.V.M, Ph.D. Perinatal Institute, Division of Neonatology, Perinatal and Pulmonary Biology Cincinnati Children's Hospital Medical Center and the University of Cincinnati College of Medicine Cincinnati, Ohio 45229, USA Tel: ; Fax: yutaka.maeda@cchmc.org
2 A Supplemental Figure 1! SOX2 CDKN1A B Supplementary Figure 1! Inversely related expression of SOX2 and CDKN1A in primary lung SCC A. Expression of SOX2 and CDKN1A was detected on serial sections of primary lung SCC by immunohistochemistry. Bar: 200 μm. B. 10 magnified views showing the expression of SOX2 as seen in A were randomly selected from lung SCC sections of each of 35 patients (out of 40). Lung SCC sections from 5 patients (out of 40) did not show the expression of SOX2. The number of CDKN1A (out of the 10 views) was counted for each serial section per patient that expressed SOX2. Among 350 SOX2 positive views, only 46 views (13.14%) were CDKN1A positive (copositive for SOX2 and CDKN1A). One-tailed binomial test showed that the probability of copositive was significantly less than 0.5 (p<4.50e-48), suggesting that expression of SOX2 and CDKN1A is inversely related in lung SCC. "
3 A Supplemental Figure 2! B C Supplemental Figure 2! SOX2 suppresses mesenchymal markers VIM and ZEB1 in EBC2 cells A. Expression of CDH1 (also known as E-cadherin; an epithelial marker) and VIM (also known as Vimentin; a mesenchymal marker) expression in lung SCC cells. CDH1 expression was detected by immunoblot analysis in EBC1, EBC2 and LK2 but not in H226 and SQ5 lung SCC cells. On the contrary, VIM expression was detected in CDH1-negative H226 and SQ5 cells but not in CDH1- positve in EBC1, EBC2 and LK2 lung SCC cells, indicating that the expression of CDH1 and VIM is mutually exclusive in lung SCC cells. B. ZEB1 was induced by SOX2 sirnas (sisox2 #1 and sisox2 #2) 48 hours after transfection in both EBC2 and LK2 lung SCC cells; however VIM was induced by the SOX2 sirnas only in EBC2 cells. Non-targeting sirna was used as a control (sictrl). C. Expression of ZEB1 was normalized by β-actin for each sample after the quantification using densitometric scanning with Adobe Photoshop CS5 Extended edition (Adobe Systems Inc., San Jose, CA, USA). Shown is the normalized expression of ZEB1 in EBC2 and LK2 lung SCC cells. ZEB1 was induced by the SOX2 sirnas in both EBC2 and LK2 cells."!
4 A Supplemental Figure 3! EBC2 LK2 H226 HFF1 B EBC2 LK2 C EBC2 LK2 Tumor volume mm 3 u sictrl! n sisox2 #1 sisox2 #2 Days Tumor volume mm 3 u sictrl! n sisox2 #1 sisox2 #2 Days Supplemental Figure 3! SOX2 is required for cell viability, colony formation and tumor growth of lung SCC cells in vitro and in vivo A. SOX2 sirnas (sisox2 #1 and sisox2 #2) inhibited the cell growth of SOX2- expressing lung EBC2 and LK2 lung SCC cells. In contrast, SOX2 sirnas did not affect cell viability in SOX2-negative H226 lung SCC cells and in normal human foreskin fibroblast (HFF1) cells. Non-targeting sirna was used as a control (sictrl). Cell viability was assessed using a TC20 automated cell counter 48 hours after sirna transfection. Statistical significance was defined as p < 0.01 (*). B. Colony formation of LK2 and EBC2 lung SCC cells treated with 100 pmol of SOX2 sirnas. Non-targeting sirna was used as control (sictrl). 14 days after treatments, cells were fixed and stained with Diff-Quik. Mean colony number was derived from quantitation of triplicate dishes for each treatment and was arbitrarily set to 100%. Statistical significance was defined as p < 0.01 (*). C. Volume of the tumors derived from EBC2 and LK2 lung SCC cells transfected with SOX2 sirnas is shown. The volume was monitored over time (days) after inoculation of tumor cells. Six mice were studied in each group. Tumor growth is expressed as mean tumor volume; bars represent SD. Statistical significance was defined as p < 0.01 (*)."
5 Supplemental Figure 4! EBC2 * * Supplemental Figure 4! Silencing SOX2 induced CDKN1A mrna in EBC2 lung SCC cells in the presence of cycloheximide EBC2 cells were treated with 10 μm of cycloheximide for 15 minutes, then 100 pmol of SOX2 sirnas were transfected. Non-targeting sirna was used as control (sictrl). Total RNAs were extracted 48 hours after transfection. Real time PCR was performed as described in Materials and Methods.
6 Supplemental Figure 5! Supplemental Figure 5! Validation of sirnas targeting CDKN1A CDKN1A was suppressed by two different CDKN1A sirnas (sicdkn1a #1 and sicdkn1a #2) in A549 lung carcinoma cells and EBC1 lung SCC cells. Cells were harvested at 48 hours after 100 pmol of sirna transfection. Protein expression was confirmed by immunoblot as described in Materials and Methods.
7 Supplemental Figure 6! sictrl sisox2 #1 sisox2 #2 EBC2 4.31% 5.31% 6.99% Annexin Ⅴ FITC Annexin Ⅴ FITC Annexin Ⅴ FITC LK2 0.02% 0.00% 0.01% Annexin Ⅴ FITC Annexin Ⅴ FITC Annexin Ⅴ FITC Supplementary Figure 6! SOX2 does not influence apoptosis in lung SCC cells Representative flow cytometric analysis of apoptotic cells 48 hours after SOX2 sirna (sisox2 #1 and sisox2 #2) transfection in LK2 and EBC2 lung SCC cells. Non-targeting sirna was used as a control (sictrl). Silencing SOX2 induced little apoptosis (Annexin V positive/ negative population) in both LK2 and EBC2 lung SCC cells.
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationTMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationCase Report Evaluation of intra-ductal cancer spread using contrast superb micro-vascular imaging (SMI) a case report
Kawasaki Medical Journal 43(1):35-41,2017 doi:10.11482/kmj-e43(1)35 35 Case Report Evaluation of intra-ductal cancer spread using contrast superb micro-vascular imaging (SMI) a case report Sayaka SAKURAI
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationTargeted silencing of SOX2 by an artificial transcription factor showed antitumor effect in lung and esophageal squamous cell carcinoma
/, 2017, Vol. 8, (No. 61), pp: 103063-103076 Targeted silencing of SOX2 by an artificial transcription factor showed antitumor effect in lung and esophageal squamous cell carcinoma Etsuko Yokota 1, Tomoki
More informationIrf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%
Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationNature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationGiant gastrointestinal stromal tumor of the jejunum resected after treatment with imatinib
Int Canc Conf J (2012) 1:41 46 DOI 10.1007/s13691-011-0007-9 CASE REPORT Giant gastrointestinal stromal tumor of the jejunum resected after treatment with imatinib Kaori Shigemitsu Takako Yamada Shinichiro
More informationTitle page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in
Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationInvolvement of FKBP6 in hepatitis C virus replication
Supplementary Information Involvement of FKBP6 in hepatitis C virus replication Hirotake Kasai 1,*, Kunihiro Kawakami 2,*, Hiromasa Yokoe 3, Kentaro Yoshimura 4, Masanori Matsuda 5, Jun Yasumoto 1, Shinya
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationSupplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
More informationHIF-1-mediated metabolic reprogramming reduces ROS levels and facilitates
HIF-1-mediated metabolic reprogramming reduces ROS levels and facilitates the metastatic colonization of cancers in lungs Authors: Tao ZHAO 1,2,3, Yuxi ZHU 1,2,4, Akiyo MORINIBU 1,2, Minoru KOBAYASHI 1,2,
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationSamali A Figure S1.
Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationSREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer
SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer Supplementary Material Supplementary Methods Supplementary References Supplementary Figure
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSupplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
More informationSupplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
More informationSupplementary Figures for
mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,
More informationSupplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationSupplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.
Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. (a) Western blotting analysis showing degradation of
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
More informationSupplementary Information
Supplementary Information Temozolomide suppresses MYC via activation of TAp63 to inhibit progression of human glioblastoma Tomohiro Yamaki, Yusuke Suenaga, Toshihiko Iuchi, Jennifer Alagu, Atsushi Takatori,
More informationSupplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationFoxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition.
Manuscript EMBO-2012-82682 Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition. David Balli, Vladimir Ustiyan, Yufang Zhang, I-Ching Wang, Alex J. Masino,
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 7 28 7 630 ~ 636 NTera-2 ** ** * 410081 COX-2 NTera-2 MTT NTera-2 NTera-2 Hoechest 33258
More informationInhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties
SUPPLEMENTAL INFORMATION Inhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties Anurag N Paranjape 1, *, Rama Soundararajan 1, *, Steven
More informationAntiproliferative effect of the HSP90 inhibitor NVP-AUY922 is determined by the expression of PTEN in esophageal cancer
ONCOLOGY REPORTS 29: 45-50, 2013 Antiproliferative effect of the HSP90 inhibitor NVP-AUY922 is determined by the expression of PTEN in esophageal cancer XIAO-HONG BAO 1, MUNENORI TAKAOKA 2, HUI-FANG HAO
More informationDoxorubicin up-regulates CXCR4 via mir200c/zeb1-dependent mechanism in human cardiac mesenchymal progenitor cells
Cell Death and Disease Doxorubicin up-regulates CXCR4 via mir200c/zeb1-dependent mechanism in human cardiac mesenchymal progenitor cells Sara Beji 1 *, Giuseppina Milano 2,3 *, Alessandro Scopece 2, Lucia
More informationCD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal
CD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal transition and breast cancer progression Rhonda L. Brown,, Jing Yang, Chonghui Cheng J Clin Invest. 2011;121(3):1064-1074.
More informationNature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy
More informationTherapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad
More informationCase Report A Case of Cholesterol Crystal Embolization with Hemorrhagic Intestinal Ulcer
Kawasaki Medical Journal 43(1):29-34,2017 doi:10.11482/kmj-e43(1)29 29 Case Report A Case of Cholesterol Crystal Embolization with Hemorrhagic Intestinal Ulcer Tomoki YAMATSUJI 1), Kazuhiro YOSHIDA 1),
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationSUPPLEMENTAL TEXT AND FIGURES
SUPPLEMENTAL TEXT AND FIGURES Prrx1 isoform switching regulates pancreatic cancer invasion and metastatic colonization Shigetsugu Takano, Maximilian Reichert, Basil Bakir, Koushik K. Das, Takahiro Nishida,
More informationThe encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
More informationPro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
More informationEffects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More information