"Pseudomonas aeruginosa
|
|
- Kory Willis
- 6 years ago
- Views:
Transcription
1 1394/7/4: 1394/9/30: 1394 $!"/360 / Pseudomonas aeruginosa ETA oprl gyrb 2 1 "$! $%,. %.. +! *" &' () %!"!" $ Pseudomonas aeruginosa : <=> / 3.0 $%, 4 )* 4;" 49 0+: 4 / ) 4"76" ETA /oprl /gyrb.0: DE(Multiplex-polymerase chain reaction) Multiplex-PCRA $%, 3 4?0$ 4@ K"L 4 ;. 0< MJ!2 I +"= $! Pseudomonas aeruginosa 55 /"G1 -<>' <=> 3 : 4Q?0$ $=1 0: O4N 4. P", DNA.0: &"N;1 "!":" $6 M DE Cetrimide agar MacConkey agar.9 4"R1 ETA /oprl /gyrb $%,. 0G /94/50 /96/36 T"141 gyrb /ETA /oprl$%, 49 %S". %; == % M: &"N;1. 1G W V4 Pseudomonas aeruginosa +: 4 4!. 7 4;" " *@ ETA oprl $%, : " *@ ETA /oprl /gyrb $%, % $ 4;" 7 gyrb $%, $49 +"= $! Pseudomonas aeruginosa +: 4 9. %,/ /Pseudomonas aeruginosa: Pseudomonas aeruginosa %& ETA$oprL$gyrB ".'1 L=G 4$ /* ":M > :! :(360) 33 W1394 %G :S5 0; XE.- "."+, %*)'(!,< *%3 <) JKL9 Pseudomonas aeruginosa $% * 3 M: "Adhesions, Q "; *! ) & N7) O "3)P *!),$% 95 %,:.(3),% P *$& %Q $ A.7 ;P,< "Pseudomonas aeruginosa ;) 2V? "* %.7, >%. N7U.,$% EF) 2- *>, %& W A X 3.C D.(4-5),6 (Elongation factor \ *![&D *>,!% U4 *!.C DH< 3 oprl Pseudomonas aeruginosa?$@ *4A $% (Efflux pump).,$% ( *. U $%,$ $&6 Pseudomonas aeruginosa &' ( )$& *! $% "! ")$& 21 *!(1 $% "*..(1),& 7 ) "( )!*6.3 "4)% " "5 31 %6 >;, ">,,= *!9 $% : ;<% 1 B Pseudomonas aeruginosa?$@ *4A $%.(1) *4A $% %? $D.C D. 4.,$% %?!.C D 3?.C D. %E& ) F.C D "*.?$@ E7 *.?$@ *4A * GD 3.(2) %6.$H)<) B tsalehi@ut.ac.ir!" $ %& '() -1,-,-.&' + :
2 P. aeruginosa ETAoprLgyrB o *!>g43 3 $ J96 N@3 "@ "$$%, *$j&? 1393 ) 7 $' $% o '6 $% ; *!^9 *$ 4 3,W "!&..,6 >g43 *?$% 37 *% $% Cetrimide agar MacConkey agar "' $%,% P U ) 24 J, % P),W.,6 *3),? Pseudomonas aeruginosa * *) "Pseudomonas aeruginosa * $]:,q 55 )6 3 "(Triple sugar iron agar) TSI agar "&6 *!3 Q ',q '? 3,7 Simmons citrate agar.(13-15),)$ `) P *!* 3 DNA o 1) * *.,% P >%) (Cinna Pure DNA KIT-PR1613) *% $% < )$ % *: 6 Multiplex-PCR 3 $% )$ % *: "V% 10 J, % P) *?$% 95 $% L *: "r 30 J, % P) *?$% 94 *% $% ^7 *: "r 70 J, % P) *?$% 55 *% "(@ s 35 %,W ) V% 1 J, % P) *?$% 72 *% J, % P) *?$% 72 *% $% ' ^7 *: Jf 3 3. $% >%) %$ *! & D.% 51 ` 3 t41 o 1) (Genbank data base) )%K & D "Oligo DNASIS,q >, 1 V% 10 t` u!$; (Reverse primer) )%.D & D (Forward primer),? $%! & D u, C t<.,% P Q ;),6.(11) ) :% d 6. ( Q '? >,6 >%) *!c1 " < U 2 ; 1X. PCR buffer " < U 10/95 dntp ; (5 mix " < U b 5 0/ ; MgCl 2 Mm) (Deoxynucleotide triphosphate).c D $]: *Q "Pseudomonas aeruginosa F ) * GD F V < *!N7) $% ) oprl?$@ *4A *!.C D.%$% ( * * ( $% &' ( "Pseudomonas aeruginosa Pseudomonas aeruginosa *P )6 *,$% ^9.(2 "6-9),$ $ JW<b c *!Pa & *$% ` $ >,6 M: < 3 E) db) ) J%? ` * f >gd. e$; *$% "`..,6 $%!<$.(10-11) ),,? *!<; *7 3 6 *! $% $% 1 *$% E7 %Q.,6 >%) Pseudomonas aeruginosa 3 ;D ) 3 P DNA <W $' "! 3 )%. ).%6, gyrb gyra *!` ) (II <%. N' "3 P DNA *$@) *!` $% 3.(11-12),6!<$ E7 3 >%) "Pseudomonas aeruginosa *$ \$ $% gyrb "ETA "oprl ` 9 $% 4 (Multiplex-polymerase chain reaction) Multiplex -PCR * j? i14 K %& V 6$ W ") ) $% & N@3 * P A gyrb "ETA "oprl *!`.W "W<b. k,!.(11) %6 >,6,? Pseudomonas aeruginosa *!& $%.% < *!& 3 mb) EV JW<b l) " -Wb *W<b. $% < 21 *!& "0/05 EV V *b@,$% 95 & (Multiplex-polymerase chain reaction) Multiplex-PCR.1 gyrb-f gyrb-r ETA-F ETA-R oprl-f oprl-r Pa16s-F Pa16s-R (5 to 3 ) CCTGACCATCCGTCGCCACAAC CGCAGCAGGATGCCGACGCC GACAACGCCCTCAGCATCACCA CGCTGGCCCATTCGCTCCAGCG ATG GAAATGCTGAAATTCGGC CTTCTTCAGCTCGACGCGACG GGGGGATCTTCGGACCTCA TCCTTAGAGTGCCCACCCG gyrb gyrb ETA ETA oprl oprl (bp)
3 P. aeruginosa $ Pseudomonas aeruginosa )* + ' " % & '.2 ( < U 0/6, DNA * & " )$ 25 (45) *! & D " < U 0/ < U 0/25 ; Taq polymerase N ; ' ' N Q: $% < U 20 +,-, $% 1 3$ P ` * $ 6 (11) /0 %$ BIORAD y % ` > g )% $% *; 5 (9) 1, 4 (7) (5) 5, 19 * 1 7 SPSS $ ; 3 >% ) *$ x $ 3,W *!>% %.,6 >% % P $ V )$ (version 19, SPSS Inc., Chicago, IL) P$ V 9 : Multiplex PCR \ $ 222 bp, < U< ) 63 gyrb *! ` N f 9 ;Q %$ *$ *! $ $% ) 6* ) 6 (, $% 100)! & * &! $% 956 bp, oprl ` * $ %, $% 96/36 "! * 7 & B &Q 3 ". &! ETA `,?, $% 94/5 504 bp, ( 3 =5 ( 3?* + +. ( % c! < *! & B. & %, W. 4. $ & 3 ) >% 3, 6$ * 6 & *, z J$., % >%, < (;E)). %$ + (polymerase chain reaction) PCR.)/ =5 >1 *+ 956 bp 504 bp 3397 bp 3222 bp * "! /360 P Q ) >, < 2,?., % P *3 ),? "MacConkey agar ^ 9 * $ )( Pseudomonas aeruginosa X 9. (, $% 1) N@3 (, $% 45) 4 Cetrimide agar ^ 9 * $.(1 U6), % 3ETA 3oprL $ & 3 >,6 *3 ),? * < ; 55 * $ $% >, 6 *$ j &? 2 1 :{., 6! & Multiplex-PCR L (100) < U 4 '?.,6 Q BIORAD > g )% $% Multiplex-PCR 10 (1) 2 (4) 2045! >% ) %$ 3., % P (! ") " 397 bp, ETA oprl gyrb 3PCR (3 ) / 33! & * 3N! D &g D ", % >,6 >% %.1,-( *5- /
4 P. aeruginosa ETAoprLgyrB.(17) ) 9?$ *$% 4 \$ 7 $%.7 ;P ` *$ $U&! kw4 ) )$ $% N@3 3 >,6 *3),? Pseudomonas aeruginosa *!),% ETA ` *$%!),$% 93/67 ",&! $% g@) ` *b) PCR \$ )7: A %% 4 : { V Pseudomonas aeruginosa *!) )6 $% $% K V% r ETA 3 )?.(1) % >%) Pseudomonas aeruginosa *!) i14 *!),$% 95 3 ( ; $U&! *W<b $% $% ". &!.(6) % ETA ` u$% "Pseudomonas aeruginosa Pa *$% oprl `,6 >,!4 $U&!. *W<b Pseudomonas aeruginosa )6 $% K )7:.D., " =: X9 JW<b ) { *7.(9),6 *b?!`. ;,6 U K Pa 3 "%$% J *%,: "& B *3),?.,6 $%$@ i14 '? <U< *!\$ *;? P, "' $% $% <U< *!\$ 3 >%) "&6 *!\$ E7 &? 3 )$& *!, < *!* i1 4 $% j ) ) \$, "Pseudomonas aeruginosa $% m9 \$ 51 Q $% i14 ". &!.%6 $& $% 4 $ 3 * P? Pseudomonas aeruginosa 3*$& $% r )6 *! ) $% * P(D *!\$ 51 $%,.,6 6% % $ l%) 21 "& '( )6$ 3 $ %@ *$;g)h) U4 & P,7 5? >a %P$)D *`< U 4!aD > P >g43 ]< l,' "*$1 = % " % V *$ X9. & : Q f ",%& $% (gyrb ` }L@ ) gyrb *!` "X9. $% 100 ; >%) %$ *!`. $% ;. 4 *!&. $% ) %? P ",$% 4 "..% >,6 *3),? seudomonas aeruginosa &? 3 $% %? *>,!% ; $%. j6 Pseudomonas aeruginosa 3 >%) *W<b "$U&! ml Q.,6 $% \$ 3 >%), )% Q. PCR ; oprl ETA *!` )6 ~ 3 "Multiplec-PCR =: X9 $%.(),6,$% 70 6 )7: *$%.,% P JEr $ \$. 3 '? A.7 ;P 3 $.< * Cerniglia Khan >%),%& i14 >%) Pseudomonas aeruginosa )6 '? $%.(16),>% ETA ` *$% "!&,$% 96 ETA ` % 3 >%) Pseudomonas aeruginosa )6 \$;P ETA 3 4 oprl ` P J$ oprl 6% 1&! ETA ` 96/36 =: X9 JW<b. {.(17),% P )$. $% oprl ` *3),?,$% F V < *!N7) $% oprl `.%,$% 94/5 %$ $ P i14 '? %$% ( * ) * GD *) 2,%% \$;P $U&! de Vos.(2) g@) *! 3 >,6,? Pseudomonas aeruginosa 3 $.< * X9. ". &!.,% oprl `,? g&! Pseudomonas aeruginosa *P )6 * OprL ` $7 )7: 3 `. ">, )% { XE %& >%) >% $%$@ Pseudomonas aeruginosa )6 * K.(2) ) j ) )6 * oprl ` 3 $U&! Xu `,%& >%) Pseudomonas aeruginosa $& $% Pseudomonas aeruginosa?$@ *4A.C DH< %6 *. j ) )6 Q 7) 3 E fe References 1. Girlich D, Naas T, Leelaporn A, Poirel L, Fennewald M, Nordmann P. Nosocomial spread of the integronlocated veb-1-like cassette encoding an extendedpectrum beta-lactamase in Pseudomonas aeruginosa in Thailand. Clin Infect Dis 2002; 34(5): de Vos D, Lim A, Jr., Pirnay JP, Struelens M, Vandenvelde C, Duinslaeger L, et al. Direct detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two outer membrane lipoprotein genes, opri and oprl. J Clin Microbiol 1997; 35(6): Procop GW. Molecular diagnostics for the detection and characterization of microbial pathogens. Clin 2046
5 P. aeruginosa ETAoprLgyrB Infect Dis 2007; 45(Suppl 2): S99-S Armstrong S, Yates SP, Merrill AR. Insight into the catalytic mechanism of Pseudomonas aeruginosa exotoxin A. Studies of toxin interaction with eukaryotic elongation factor-2. J Biol Chem 2002; 277(4): Hussein SN. Detection of Exo A and OPR I genes in Pseudomonas aeruginosa using polymerase chain reaction. Iraqi J Biotech 2013; 12(1): Amini B, Kamali M, Zarei Mahmod Abadi A, Mortazavi Y, Ebrahim Habibi A, Bayat E, et al. Cloning of catalytic domain of exotoxin A from Pseudomonas aeruginosa. J Zanjan Univ Med Sci 2010; 1(71): [In Persian]. 7. Aslani MM, Hahsemipour M, Nikbin VS, Shahcheraghi F, Eidi A, Sharafi Z. PCR identification of Pseudomonas aeruginosa based on two outermembrane lipoprotein opri, oprl, and exotoxin A gene. Yafteh 2009; 11(2): [In Persian].. Najafimosleh M, Rashnotaie S, Ghaznavi Rad E, Abtahi H, Taleie Gh. Designing of the specific DNA primers for detection of the exoa, oprl and algd pathogenicity genes for rapid diagnosis of Pseudomonas aeruginosa. Tehran Univ Med J 2013; 71(): [In Persian]. 9. Nikbin VS, Aslani MM, Sharafi Z, Hashemipour M, Shahcheraghi F, Ebrahimipour GH. Molecular identification and detection of virulence genes among Pseudomonas aeruginosa isolated from different infectious origins. Iran J Microbiol 2012; 4(3): Singh A, Goering RV, Simjee S, Foley SL, Zervos MJ. Application of molecular techniques to the study of hospital infection. Clin Microbiol Rev 2006; 19(3): Salman M, Ali A, Haque A. A novel multiplex PCR for detection of Pseudomonas aeruginosa: A major cause of wound infections. Pak J Med Sci 2013; 29(4): Daikos GL, Lolans VT, Jackson GG. Alterations in outer membrane proteins of Pseudomonas aeruginosa associated with selective resistance to quinolones. Antimicrob Agents Chemother 19; 32(5): Brooks GF, Butel JS, Morse SA. Jawetz, Melnick, and Adelberg's medical microbiology. 23 th ed. New York, NY: McGraw-Hill Medical; p Farmer JJ, Herman LG. Pyocin typing of Pseudomonas aeruginosa. J Infect Dis 1974; 130(Suppl) :S43-S Tang YW, Stratton ChW. Advanced techniques in diagnostic microbiology. New York, NY: Springer; Khan AA, Cerniglia CE. Detection of Pseudomonas aeruginosa from clinical and environmental samples by amplification of the exotoxin A gene using PCR. Appl Environ Microbiol 1994; 60(10): Xu J, Moore JE, Murphy PG, Millar BC, Elborn JS. Early detection of Pseudomonas aeruginosa-- comparison of conventional versus molecular (PCR) detection directly from adult patients with cystic fibrosis (CF). Ann Clin Microbiol Antimicrob 2004; 3: Yousefi Mashouf R, Esmaeili R, Yousef Alikhani M, Ghanbari M. Evaluation of exotoxin A gene and frequency of polymerase chain reaction sensitivity in detection of pseudomonas aeruginosa isolated from burn patients. Tehran Univ Med J 2014; 72(3): [In Persian]. 2047
6 Journal of Isfahan Medical School Received: Vol. 33, No. 360, 4 th Week, January 2016 Accepted: Molecular Detection of the Genes gyrb, oprl, ETA, in Pseudomonas Aeruginosa Strains Isolated from Clinical Samples of Karaj City Health Centers, Iran Abstract Mahsa Ataee-Ashtiani MSc 1, Taghi Zahraei-Salehi PhD 2 Background: Pseudomonas aeruginosa is one of the most important factors for nosocomial infections, particularly in immunosuppressed patients such as children. Study on the genes gyrb, oprl, ETA, is essential to develop prevention programs; in this study, we tried to the study these genes in an Iranian population using multiplex-polymerase chain reaction (multiplex PCR) method. Methods: 55 different strains of Pseudomonas aeruginosa from clinical specimens collected from Karaj City Health Centers, Iran, after cultivation on the cetrimid agar and MacConkey agar media were detected via biochemical tests. DNA was extracted from bacterial genomics and the sequencing of target genes gyrb, oprl, ETA, was amplified. Findings: Molecular test results showed that the frequencies of oprl, ETA, gyrb and genes were 96.36, 94.50, 100 and 100 percent, respectively. Conclusion: The results show that the genes oprl and ETA are more sensitive and less specific for detecting Pseudomonas aeruginosa; but, using the genes gyrb and has the most specificity. Simultaneous use of the genes oprl, ETA, and gyrb would provide enough sensitivity to detect Pseudomonas aeruginosa from clinical specimens. Keywords: Pseudomonas aeruginosa,, Gene Original Article Citation: Ataee-Ashtiani M, Zahraei-Salehi T. Molecular Detection of the Genes gyrb, oprl, ETA, in Pseudomonas Aeruginosa Strains Isolated from Clinical Samples of Karaj City Health Centers, Iran. J Isfahan Med Sch 2016; 33(360): Department of Microbiology, Saveh Branch, Islamic Azad University, Saveh, Iran 2- Professor, Department of Microbiology, School of Vetrinary Medicine, University of Tehran, Tehran, Iran Corresponding Author: Taghi Zahraei-Salehi PhD, tsalehi@ut.ac.ir 204
Downloaded from ismj.bpums.ac.ir at 10: on Friday March 8th 2019
- ( ) - * :... (MDR) (ESBLs: Extended-Spectrum Beta Lactamases). :.. (CLSI:Clinical and Laboratory Standards Institute). ESBL. combined disk method ESBL : / / / / / B / ( /). / / combined disk method.
More informationPROTEUS-PROVIDENCIA-MORGANELLA GENERA
Gram-negative rods Proteus & Pseudomonas DR. HUDA ABO-ALEES 2014-2015 Objectives: Describe the morphology & physiology for Proteus & Pseudomonas. Determine the virulence factors of proteus and pseudomonas.
More informationIsolation and identification of Mycoplasma gallisepticum in chickensbn from industrial farms in Kerman province
Available online at http://www.ijabbr.com International journal of Advanced Biological and Biomedical Research Volume 2, Issue 1, 2014: 100-104 Isolation and identification of Mycoplasma gallisepticum
More informationMultidrug Resistant Pseudomonas aeruginosa. Presenter: Andrew Webb Block Lecturer: George Zhanel Date: 10 January 2019
Multidrug Resistant Pseudomonas aeruginosa Presenter: Andrew Webb Block Lecturer: George Zhanel Date: 10 January 2019 1 Pseudomonas aeruginosa Not a member of human microbiome Inhabitant of soil and moist
More informationINVESTIGATION THE PREVALENCE OF MUTATIONS IVS 10 AND R158Q IN A NUMBER OF IRANIAN PATIENTS WITH PKU
: 293-297 ISSN: 2277 4998 INVESTIGATION THE PREVALENCE OF MUTATIONS IVS 10 AND R158Q IN A NUMBER OF IRANIAN PATIENTS WITH PKU SHIRIN JAHANBAZI, FATEMEHKESHAVARZI* Department of Biology, Sanandaj Branch,
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationbla TEM bla CTX-M محمد مرتضي اردوني Extended-spectrum beta-lactamases ESBL Avian pathogenic Escherichia coli ESBLs (ESBLs)
bla bla -M 2 محمد مرتضي اردوني () -M ESBL bla bla -M -M bla bla -M Extended-spectrum beta-lactamases ESBL bla bla -M Avian pathogenic AEC Escherichia coli پست الکترونيک نويسندهي مسؤول: mjahantig@yahoo.com
More information91/8/1: 91/5/4: 191$% & '/210 / 4 "#! 2 1 +",.( ) &' " % $ #!!"! : /) 4?! >! " (.= 1;;
More information1) 1) 1) 2) 2) (ICU) Key words: (ICU), ( ) 1 30 TEL: FAX: Vol. 17 No
2007 277 1) 1) 1) 2) 2) 3) 4) 5) 6) 1) 2) 3) 4) 5) 6) 18 10 17 19 8 20 16 7 1 (ICU) 20 2x 1.6 2.2 2SD 14 1 4 1 10 7 3 2 9 7.6; 95 2.37 24.62 6 4 5 1 DNA SpeI 9 2 A 7 B 2 A 3 B 1 ICU ICU 7 20 10 5 Key words:
More informationStudy on Efficacy of Hepatitis B Immunization in Vaccinated Beta thalassemia Children in Tehran
Original Article Iran J Pediatr Jun 2010; Vol 20 (No 2), Pp:211-215 Study on Efficacy of Hepatitis B Immunization in Vaccinated Beta thalassemia Children in Tehran Zohreh Sharifi*, phd; Saeideh Milani,
More informationStudy on Serotype and Apx Toxins Type of Actinobacillus pleuropneumoniae Strains Isolated from Shandong Province
2005,38(11):2349-2354 Scientia Agricultura Sinica Apx 271018 : 85 APP PCR APX 20 5 APP 7 6 5 5 3 4 4 3 8 2 7 5 APP PCR APP 4 (Apx) 3 4 8 APP Apx 5 Apx 7 20 APP APP 99.5 ~100 APP Apx 5 APP PCR : Study on
More informationNew genomic typing method MLST
New genomic typing method MLST Bon KIMURA fingerprinting PFGE DNA multilocus sequence typingmlst alleles PFGE MLST 1990 PCR 1 PCR DNA PFGE 1 PFGE RAPDrandomly amplified polymorphic DNA 3 AFLPAmplified
More information2. No.38, Apt. Yas 8, Keshvari Town, Third Abshar Ave., Isfahan, Iran. Phone: Mobile:
Curriculum Vitae December 2011 Personal Information First name: Ahmad Surname: Salamian Gender: Male Nationality: Iranian Date of Birth: 07.06.1982 Address: 1. Department of Cell and Molecular Biology,
More informationPCR CRP ESR CBC. universal PCR CBC ESR CRP PCR CRP.
169-175 1387 3 66 CBC ESR CRP CBC ESR CRP :... universal 100 :.. (1-120) 12/50 3-36 %65 :. CRP ESR CBC. 38/9±0/6. %45. 12 (%22) (%24) (%29) CRP ESR WBC. 19 universal :... : 1 2* -1-2 * : 66428996 : email:
More informationTable S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationHIV . HIV-1 HIV. . NJplot. Nested RT-PCR . CRF35-AD
(-) HIV-1 POL HIV.. HIV-1 HIV Nested RT- HIV-1. PTZ-57RT PCR.. ClustalW /. NJplot Nested RT-PCR.. CRF35-AD. CRF35-AD. HIV1 : // : // : : PhD : - PhD - HIV-1 POL. HIV.. HIV-1 PCR CRFs= ) (Criculating Recombinant
More information"Calreticulin Mutation Analysis in Iranian patients suffering from Essential thrombocythemia and Primary Myelofibrosis
"Calreticulin Mutation Analysis in Iranian patients suffering from Essential thrombocythemia and Primary Myelofibrosis Dr Behzad Poopak, DCLS PhD. Associate professor of fhematology Islamic Azad University
More informationUse of pyrosequencing in clinical microbiology laboratory
Use of pyrosequencing in clinical microbiology laboratory Student: CHEUNG Yuk Yam, Andy Supervisor: Prof Mamie HUI Joint Graduate Seminar Dec 2014 Department of Microbiology, Faculty of Medicine, The Chinese
More informationRapid Diagnosis and Detection of Drug Resistance in Tuberculosis
Rapid Diagnosis and Detection of Drug Resistance in Tuberculosis YAM Wing-Cheong 任永昌 Department of Microbiology The University of Hong Kong Tuberculosis Re-emerging problem in industrialized countries
More informationResearch Article Concomitant Colonization of Helicobacter pylori in Dental Plaque and Gastric Biopsy
Pathogens, Article ID 871601, 4 pages http://dx.doi.org/10.1155/2014/871601 Research Article Concomitant Colonization of Helicobacter pylori in Dental Plaque and Gastric Biopsy Amin Talebi Bezmin Abadi,
More informationEuropean-wide distribution of Pseudomonas aeruginosa clone C
CONCISE COMMUNICATION European-wide distribution of Pseudomonas aeruginosa clone C S. D. Dinesh 1, H. Grundmann 2, T. L. Pitt 3 and U. RoÈmling 4, 1 Research Group `Clonal Variability', Division of Cell
More informationMolecular diagnostics in cystic fibrosis microbiology
Molecular diagnostics in cystic fibrosis microbiology Jane L. Burns, MD Seattle Children s Hospital Center for CF Microbiology University of Washington CF microbiology Key concepts Phenotypic adaptations
More informationof clinical laboratory diagnosis in Extra-pulmonary Tuberculosis
New approaches and the importance of clinical laboratory diagnosis in Extra-pulmonary Tuberculosis Bahrmand.AR, Hadizadeh Tasbiti.AR, Saifi.M, Yari.SH, Karimi.A, Fateh.A, Tuberculosis Dept. Pasteur Institute
More informationInvestigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains
Investigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains Name: Claire Ostertag-Hill Mentor: Dr. Ling Jin Bovine herpesvirus Bovine herpesvirus-1 (BHV-1) Pathogen
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationInfection & Chemotherapy. Original Article
Original Article http://dx.doi.org/10.3947/ic.2015.47.2.98 Infect Chemother 2015;47(2):98-104 ISSN 2093-2340 (Print) ISSN 2092-6448 (Online) Infection & Chemotherapy Spread of Efflux Pump Overexpressing-Mediated
More informationProbing protein interactions in living cells of Pseudomonas aeruginosa by chemical cross-linking
Probing protein interactions in living cells of Pseudomonas aeruginosa by chemical cross-linking Arti Navare, Richard Siehnel, Kirsten Beck, Alejandro Wolf-Yadlin, Pradeep Singh, James E. Bruce University
More informationCurriculum Vita. Work: Mycobacteriology Dept.of Pasteur Institute of Iran,Tehran Tel/fax: (+98) E.mail:
Curriculum Vita First Name: Farid Last Name: Abdolrahimi Date of birth: 22.03.1971 Place of Birth: Tonekabon - Iran Nationality: Iranian Position Title: M.Sc. in Mycobacteriology Dept. Address: Work: Mycobacteriology
More informationThe diagnostic value of gyrb RFLP PCR. Mycobacteria in patients with clinical. in Mazandaran
Mazandaran University of Medical Sciences The diagnostic value of gyrb RFLP PCR test t in differentiation between pathogenic Mycobacteria in patients with clinical suspicions spicions of tuberculosis in
More information(UI Urine incontinence)! " # $% &'! ( ) * " " +, -. &/ !!" # $%& /'0 = ='' &!( )'*(" &%: "## $ "% % &' ( )* .!
39/0/5: 39//8:! "#/7 / 6 4 3!!" # $%& /'0 -. (SI Stress incontinence) '' &!( )'*("&%!%!" #$ :!*8>4 &'!% = / ;
More informationPOTENTIAL SOURCES OF TRANSMISSION OF HOSPITAL ACQUIRED INFECTIONS IN THE VOLTA REGIONAL HOSPITAL IN GHANA
March 2011 Volume 45, Number 1 GHANA MEDICAL JOURNAL POTENTIAL SOURCES OF TRANSMISSION OF HOSPITAL ACQUIRED INFECTIONS IN THE VOLTA REGIONAL HOSPITAL IN GHANA D. N. A. TAGOE 1,2, S.E BAIDOO 1,2, I. DADZIE
More informationThe Relationship between Cell Surface Hydrophobicity and Antibiotic Resistance of Streptococcal Strains Isolated from Dental Plaque and Caries
Iranian Journal of Basic Medical Sciences Vol. 10, No. 4, Winter 2008, 251-255 Received: January 24, 2008; Accepted: March 9, 2008 The Relationship between Cell Surface Hydrophobicity and Antibiotic Resistance
More informationSimultaneous and Rapid Detection of Causative Pathogens in Community-acquired Pneumonia by Real-time PCR (1167)
From the Japanese Association of Medical Sciences The Japanese Association for Infectious Diseases Simultaneous and Rapid Detection of Causative Pathogens in Community-acquired Pneumonia by Real-time PCR
More information(PFGE) Clostridium di$cile
2009 205 (PFGE) Clostridium di$cile 1) 3) 2) 2) 2) 2, 4) 5) 1) 2) 3) 4) 5) 21 5 22 21 8 31 2004 1 2008 12 5 Clostridium di$cile (C. di$cile) 340 248 A /B 141 (56.9) A /B 26 (10.5) A /B 81 (32.7) 136 (PFGE)
More informationHost-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic
Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic Scott V. Edwards Department of Organismic and Evolutionary Biology Harvard University Cambridge, MA USA http://www.oeb.harvard.edu/faculty/edwards
More informationAssociation between ESBL Production and the Presence of maga Gene among the Clinical Isolates of Klebsiella pneumoniae
Infect Epidemiol Med. 2017 Spring; Volume 3, Issue 2: 46-50 DOI: 10.18869/modares.iem.3.2.46 Original article Association between ESBL Production and the Presence of maga Gene among the Clinical Isolates
More informationEnrichment culture of CSF is of limited value in the diagnosis of neonatal meningitis
Enrichment culture of CSF is of limited value in the diagnosis of neonatal S. H. Chaudhry, D. Wagstaff, Anupam Gupta, I. C. Bowler, D. P. Webster To cite this version: S. H. Chaudhry, D. Wagstaff, Anupam
More informationThe Bacteriology of Bronchiectasis in Australian Indigenous children
The Bacteriology of Bronchiectasis in Australian Indigenous children Kim Hare, Amanda Leach, Peter Morris, Heidi Smith-Vaughan, Anne Chang Presentation outline What is bronchiectasis? Our research at Menzies
More informationCell counting (EtBr) Before cell-lysis. Cell-lysis by 3% SDS beads beating. After cell-lysis
Key words Sample Cell counting (EtBr) DNA extraction Cell-lysis by 3% SDS beads beating Before cell-lysis After cell-lysis Cell-lysis efficiency (Maintained70%) PCR PCR amplification of partial fragments
More informationValidation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1
I. Objectives Validation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1 1. To ensure stability of RNA (highly thermolabile and degradatively
More informationMRP1 polymorphisms (T2684C, C2007T, C2012T, and C2665T) are not associated with multidrug resistance in leukemic patients
MRP1 polymorphisms (T2684C, C2007T, C2012T, and C2665T) are not associated with multidrug resistance in leukemic patients F. Mahjoubi, S. Akbari, M. Montazeri and F. Moshyri Clinical Genetics Department,
More information466 Biomed Environ Sci, 2014; 27(6):
466 Biomed Environ Sci, 2014; 27(6): 466-470 Letter to the Editor Modification and Evaluation of Brucella Broth Based Campylobacter jejuni Transport Medium * BAI Yao 1,2,$, CUI Sheng Hui 3,$, XU Xiao 3,
More informationMassoud Houshmand National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran
QUID 2017, pp. 669-673, Special Issue N 1- ISSN: 1692-343X, Medellín-Colombia NON-GENE REGION AND INFLUENCES TUMOR CHARACTERISTICS BY LOW-RISK ALLELES IN BREAST CANCER (Recibido el 21-06-2017. Aprobado
More informationPRESENTER: DENNIS NYACHAE MOSE KENYATTA UNIVERSITY
18/8/2016 SOURCES OF MICROBIAL CONTAMINANTS IN BIOSAFETY LABORATORIES IN KENYA PRESENTER: DENNIS NYACHAE MOSE KENYATTA UNIVERSITY 1 INTRODUCTION Contamination occurs through avoidable procedural errors
More information#Corresponding author: Pathology Department, Singapore General Hospital, 20 College. Road, Academia, Level 7, Diagnostics Tower, , Singapore
AAC Accepts, published online ahead of print on 21 October 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.01754-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 Title: Escherichia
More informationRelationship between SPOP mutation and breast cancer in Chinese population
Relationship between SPOP mutation and breast cancer in Chinese population M.A. Khan 1 *, L. Zhu 1 *, M. Tania 1, X.L. Xiao 2 and J.J. Fu 1 1 Key Laboratory of Epigenetics and Oncology, The Research Center
More informationEffect of Azithromycin plus Rifampin versus That of Azithromycin Alone on the Eradication of Chlamydia pneumoniae
Antimicrobial Agents and Chemotherapy, June 1999, p. 1491-1493, Vol. 43, No. 6 0066-4804/99/$04.00+0 Copyright 1999, American Society for Microbiology. All rights reserved. Effect of Azithromycin plus
More informationALERT. Clinical microbiology considerations related to the emergence of. New Delhi metallo beta lactamases (NDM 1) and Klebsiella
ALERT Clinical microbiology considerations related to the emergence of New Delhi metallo beta lactamases (NDM 1) and Klebsiella pneumoniae carbapenemases (KPC) amongst hospitalized patients in South Africa
More informationIsolation and Genotyping of Acanthamoeba Strains from Corneal Scraps
Isolation and Genotyping of Acanthamoeba Strains from Corneal Scraps MirMostafa Ghamilouie, MSc 1 Zarrintaj Valadkhani, PhD 1 Firoozeh Rahimi, MD 2 Fariba Khoshzaban, PhD 3 Zohreh Aghighi, MSc 1 Nayerreh
More informationin the Gastrointestinal and Reproductive Tracts of Quarter Horse Mares
Influence of Probiotics on Microflora in the Gastrointestinal and Reproductive Tracts of Quarter Horse Mares Katie Barnhart Research Advisors: Dr. Kimberly Cole and Dr. John Mark Reddish Department of
More informationCytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance
SUPPORTING INFORMATION Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M42F): Acid-mediated intra-molecular cycloadditions enhance chemical diversity Zhuo Shang, Ritesh Raju,
More informationImpact of the isolation medium for detection of carbapenemase-producing Enterobacteriaceae using an updated version of the Carba NP test
Published in which should be cited to refer to this work. Impact of the isolation medium for detection of carbapenemase-producing Enterobacteriaceae using an updated version of the Carba NP test Carbapenem
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationFoundations in Microbiology
Foundations in Microbiology Fifth Edition Talaro Chapter 13 Microbe Human Interactions: Infection and Disease Chapter 13 2 3 Infection a condition in which pathogenic microbes penetrate host defenses,
More informationRelationship between Age and Peripheral White Blood Cell Count in Patients with Sepsis
IJPM Relationship between Age and Peripheral White Blood Cell Count in Patients with Sepsis Zohreh Aminzadeh 1, Elham Parsa 2 Original Article 1 MD, MPH, Associate Professor, Infectious Disease and Tropical
More informationPD Targets for Various Infection Types: Stasis vs. 1-Log Kill vs. 2 Log Kill
PD Targets for Various Infection Types: Stasis vs. 1-Log Kill vs. 2 Log Kill G.L. Drusano, M.D. Professor and Director Institute for Therapeutic Innovation University of Florida To have insight into appropriate
More informationKit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product
More informationHepatitis B Virus Genemer
Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures
More informationDownloaded from unmf.umsu.ac.ir at 20: on Friday March 22nd 2019
*2 1 1392/03/19 1392/01/20 :... :. (P
More informationOligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA
Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based
More informationEvaluation of X-ray protective shielding used in dental offices in Kerman, Iran, in 2014
Received: 17 May 2016 Accepted: 3 Dec. 2016 Evaluation of X-ray protective shielding used in dental offices in Kerman, Iran, in 2014 Abstract Jahangir Haghani DDS, MSc 1, Maryam Raoof DDS, MSc 2, Maryam
More information*+, - .!"#$% &'
139//6: 139//: 139 %& #$!"/5 / #!"!" )&&# ( '&%$ $ 1 *+, - &3# + "'.!"0!",/.!/-# &, - + ()* %!# & &'!"# $ : -B A$@ / &, /5), &$># &3# $ /?!.5 %! =* : ;< 9 /5), $ + 56,.- + ()* G$! E,0F = 3 (5, - B E,0F
More informationSuper Bugs vs Super Heroes: A Wound Care Perspective
Super Bugs vs Super Heroes: A Wound Care Perspective IPAC GTA Annual Education Day October 3 rd 2017 Zaynab Sheraly RN, BScN, MHSC, IIWCC Nicholas Joachimides RN, BScN, CRN(c), IIWCC, MClSc, MSc This document
More informationProgress in varicella vaccine research
40 1, 1, 1, 2 1., 230032; 2., 10032 : - ( VZV) VZV 1995,, Oka,,, VZV : - ; Oka ; Progress in varicella vaccine research GAN Lin 1, WANG Ming-Li 1, Jason Chen 1, 2 1. Department of Microbiology, Anhui Medical
More informationUnderstanding Gallibacterium-Associated Peritonitis in the Commercial Egg-Laying Industry
Understanding Gallibacterium-Associated Peritonitis in the Commercial Egg-Laying Industry Timothy J. Johnson A, Lisa K. Nolan B, and Darrell W. Trampel C A University of Minnesota, Department of Veterinary
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationGenotype Variation in H. Pylori Isolates from Iranian Patients by RAPD-PCR
Genotype Variation in H. Pylori Isolates by RAPD-PCR Genotype Variation in H. Pylori Isolates from Iranian Patients by RAPD-PCR Siavoshi F Department of Microbiology, Faculty of Science, Tehran University
More informationDoes Extending Clostridium Difficile Treatment In Patients Who Are Receiving Concomitant Antibiotics Reduce The Rate Of Relapse?
ISPUB.COM The Internet Journal of Infectious Diseases Volume 15 Number 1 Does Extending Clostridium Difficile Treatment In Patients Who Are Receiving Concomitant Antibiotics Reduce The Rate Of Relapse?
More informationRevised AAC Version 2» New-Data Letter to the Editor ACCEPTED. Plasmid-Mediated Carbapenem-Hydrolyzing β-lactamase KPC-2 in
AAC Accepts, published online ahead of print on 3 December 2007 Antimicrob. Agents Chemother. doi:10.1128/aac.01180-07 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationMolecular tests for rapid detection of rifampicin and isoniazid resistance in Mycobacterium tuberculosis.
Title Molecular tests for rapid detection of rifampicin and isoniazid resistance in Mycobacterium. Author(s) Ho, PL; Yam, WC; Leung, CC; Yew, WW; Mok, TYW; Chan, KS; Tam, CM Citation Hong Kong Medical
More informationORIGINAL ARTICLE /j x
ORIGINAL ARTICLE 10.1111/j.1469-0691.2007.01939.x Comparison of type III secretion system virulence among fluoroquinolonesusceptible and -resistant clinical isolates of Pseudomonas aeruginosa A. Wong-Beringer
More informationIntroduction of Pseudomonas aeruginosa into a
APPLIED MICROBIOLOGY, Oct. 1972, p. 567-570 Copyright 0 1972 American Society for Microbiology Vol. 24, No. 4 Printed in U.S.A. Introduction of Pseudomonas aeruginosa into a Hospital via Vegetables SPYROS
More informationHuman Immunodeficiency Virus-1 (HIV-1) Genemer. Primer Pair for amplification of HIV-1 Specific DNA Fragment
Product Manual Human Immunodeficiency Virus-1 (HIV-1) Genemer Primer Pair for amplification of HIV-1 Specific DNA Fragment Catalog No.: 60-2002-10 Store at 20 o C For research use only. Not for use in
More informationMycoplasma Total Solution. Mycoplasma Detection Mycoplasma Elimination Mycoplasma Prevention Cell Freezing Medium (Mycoplasma Free)
Mycoplasma Total Solution Mycoplasma Detection Mycoplasma Elimination Mycoplasma Prevention Cell Freezing Medium (Mycoplasma Free) Mycoplasma Detection Mycoplasma Detection CellSafe s Mycoplasma Detection
More informationInvestigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small Cell Lung Cancer
Original Article Middle East Journal of Cancer; January 2018; 9(1): 13-17 Investigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small
More informationOriginal Article Identification of Different Serotypes of Infectious Bronchitis Viruses in Allantoic Fluid Samples with Single and Multiplex RT- PCR
Iranian Journal of Virology 2009;3(2): 24-29 2009, Iranian Society for Virology Original Article Identification of Different Serotypes of Infectious Bronchitis Viruses in Allantoic Fluid Samples with Single
More informationWHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx
WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx 0145-027-00 Abstract The Abbott RealTime HIV-1 (m2000sp) assay with product code 2G31 (which
More informationConstruction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
More informationmental health WHO well-being
- ± Ryff Beck OxfordSnyder Simpson p< NFIRMSEA= AGFI= [] positive psychology " " " " "" Snyder mental health WHO well-being - health psychology email:mahmadi_1362@yahoo.com " Snyder agency pathwaysgoal-directed
More informationTranslocation Studies Mid-Term Review (MTR) Meeting Marseille, France
Marie Curie Actions Research Training Networks (RTN) Translocation Studies Mid-Term Review (MTR) Meeting Marseille, France F. Vidal-Aroca, M.G.P. Page and J. Dreier Background Deteriorating situation regarding
More information*!) ) + * #!!",- Downloaded from yafte.lums.ac.ir at 20: on Friday March 22nd #$ # A6 AL 18 &) :.
$!!" # #%& $ ' (#)!"# *!) ) + * #!!",- 3 2* 1.+ +, ( +, ' ()* $ %& #!".+ +, ( +, ' ()* $ %& #!" %/ %*.+ 122* 122* ' ()* $ %& #!" %%* 74 *'' / 96 '$ / 5 # / %$ # /! 96/10/27: 96/9/4: (,69 6%7- (GPX) (6%7
More informationIDENTIFICATION OF THE asta GENE IN ENTEROTOXIGENIC ESCHERICHIA COLI STRAINS RESPONSIBLE FOR DIARRHEA IN PIGS
Bull. Vet. Inst. Pulawy 47, 9-15, 2003 IDENTIFICATION OF THE asta GENE IN ENTEROTOXIGENIC ESCHERICHIA COLI STRAINS RESPONSIBLE FOR DIARRHEA IN PIGS JACEK OSEK Department of Microbiology, National Veterinary
More informationRole of efflux pump inhibitor in decreasing antibiotic cross-resistance of Pseudomonas aeruginosa in a burn hospital in Iran
Original Article Role of efflux pump inhibitor in decreasing antibiotic cross-resistance of Pseudomonas aeruginosa in a burn hospital in Iran Mahshid Talebi-Taher 1, Ali Majidpour 1, Abbas Gholami 2, Samira
More informationStudy of Ciprofloxacin Resistant Escherichia coli (CREC) in Type 2 Diabetic Patients with Symptomatic Urinary Tract Infections
Study of Ciprofloxacin Resistant Escherichia coli (CREC) in Type 2 Diabetic Patients with Symptomatic Urinary Tract Infections MSc Abstract: Background: Type 2 diabetes is the most common form of diabetes
More information320 MBIO Microbial Diagnosis. Aljawharah F. Alabbad Noorah A. Alkubaisi 2017
320 MBIO Microbial Diagnosis Aljawharah F. Alabbad Noorah A. Alkubaisi 2017 Pathogens of the Urinary tract The urinary system is composed of organs that regulate the chemical composition and volume of
More informationAmoyDx TM BRAF V600E Mutation Detection Kit
AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background
More informationTorres, Brian Carlmichael L., Ma. Luisa G. Daroy, Juan s. Lopez, Vanessa Oh, Marie Joan Loy, Prospero ma. Tuaño, and Ronald R. Matias Research and
Torres, Brian Carlmichael L., Ma. Luisa G. Daroy, Juan s. Lopez, Vanessa Oh, Marie Joan Loy, Prospero ma. Tuaño, and Ronald R. Matias Research and Biotechnology Division and International Eye Institute
More informationProduct # Kit Components
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information
More informationGenetic analysis of virulence and pathogenicity features of uropathogenic Escherichia coli isolated from patietns with neurogenic bladder
Romanian Biotechnological Letters Vol. 14, No. 6, 2009, pp. 4900-4905 Copyright 2009 Bucharest University Printed in Romania. All rights reserved Romanian Society of Biological Sciences ORIGINAL PAPER
More informationHIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis
Product Manual HIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis For research use only. Not for use in diagnostic procedures for clinical purposes Catalog
More informationSupplementary Information
Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang
More informationInteraction Effect of Sucrose, Salicylic Acid and 8- hydroxyquinoline Sulfate on Vase-life of Cut Gerbera Flowers
Current Agriculture Research Journal Vol. 1(1), 39-43 (2013) Interaction Effect of Sucrose, Salicylic Acid and 8- hydroxyquinoline Sulfate on Vase-life of Cut Gerbera Flowers SAMANEH BANAEE 1, EBRAHIM
More informationTopical antimicrobial agents in wound care. Professor Val Edwards-Jones Manchester Metropolitan University UK
Topical antimicrobial agents in wound care Professor Val Edwards-Jones Manchester Metropolitan University UK Antimicrobial agents Antibacterial agents Antifungal agents Antiviral agents Antiparasitic agents?others
More informationMalaysian Journal of Microbiology
Malaysian Journal of Microbiology, Vol 9(2) 2013, pp. 184-188 http://dx.doi.org/10.21161/mjm.46912 Malaysian Journal of Microbiology Published by Malaysian Society for Microbiology (In since 2011) SHORT
More informationHepatitis B virus X gene in the development of hepatocellular carcinoma. Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p.
Title Hepatitis B virus X gene in the development of hepatocellular carcinoma Author(s) Ma, NF; Lau, SH; Hu, L; Dong, SS; Guan, XY Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p. 44-47
More informationDetection of equine infectious anemia nucleic acid in asymptomatic carrier horses by nested PCR
Asian Biomedicine Vol. 4 No. 6 December 2010; 971-975 Brief communication (Original) Detection of equine infectious anemia nucleic acid in asymptomatic carrier horses by nested PCR Sunutcha Suntrarachun
More informationOriginal Article Blood-based DNA methylation of DNA repair genes in the non-homologous end-joining (NEHJ) pathway in patient with glioma
Int J Clin Exp Pathol 2015;8(8):9463-9467 www.ijcep.com /ISSN:1936-2625/IJCEP0011215 Original Article Blood-based DNA methylation of DNA repair genes in the non-homologous end-joining (NEHJ) pathway in
More informationThe effects of self-care training on quality of life in patients with multiple sclerosis
Original Article The effects of self-care training on quality of life in patients with multiple sclerosis Mohammad Sahebalzamani 1, Maryam Zamiri 2, Farnoosh Rashvand 3 ABSTRACT Background: Multiple sclerosis
More informationNo Significant Association between Human Papillomavirus and Breast Cancer, Sanandaj, Iran
RESEARCH ARTICLE No Significant Association between Human Papillomavirus and Breast Cancer, Sanandaj, Iran Maryam Karimi 1, Mazaher Khodabandehloo 2 *, Bahram Nikkhoo 3, Ebrahim Ghaderi 4 Abstract Background
More informationRespiratory Pathogen Panel TEM-PCR Test Code:
Respiratory Pathogen Panel TEM-PCR Test Code: 220000 Tests in this Panel Enterovirus group Human bocavirus Human coronavirus (4 types) Human metapneumovirus Influenza A - Human influenza Influenza A -
More information