Fold change jhd2δ vs WT

Size: px

Start display at page:

Download "Fold change jhd2δ vs WT"

Clifford Singleton
5 years ago
Views:

1 Strand a a a Fold change jhdδ v WT Fold change et1δ v WT Gene name YMR11C MTD SOM ARG YJR79W BNA. 1.9 YJR15W DSF YGL13C. 1. GON FLO SPO YSN FLO SKN YDR1W 1..1 Supplementary Figure 1. Lit of ene and antiene trancript counter-regulated by Set1 and Jhd. Fold change in ene () or antiene (a) trancript level for the indicated gene in jhdδ or et1δ mutant relative to the control wild type (WT) are hown. Fold change in trancript level were calculated uing equencing read obtained from three independent RNA ample each iolated for control WT and deletion mutant (jhdδ or et1δ). Red arrow denote down-regulation of the trancript in the mutant, and green arrow indicate up-regulation of the trancript in the mutant.

2 1.5-fold up-regulated Antiene 1.5-fold down-regulated Antiene jhdδ et1δ jhdδ et1δ Supplementary Figure. Venn diagram howing the number of up- or down-regulated antiene trancript unique to and common to jhdδ and et1δ mutant. Interection p-value <1 - (hypergeometric tet).

a jhdδ et1δ SER3 1.97 7.5 CHA1 1.9.3 Fold down-regulated relative to wild-type b Read 5 5 5 SRG1 SER3 WT jhdδ et1δ Supplementary Figure 3.

(a) Fold decreae in the RNAeq read for SER3 and CHA1 trancript in jhdδ or et1δ mutant relative to control wild type.

3 a jhdδ et1δ SER CHA Fold down-regulated relative to wild-type b Read SRG1 SER3 WT jhdδ et1δ Supplementary Figure 3. SER3 and CHA1 gene involved in erine metabolim are target gene of Set1 and Jhd. (a) Fold decreae in the RNAeq read for SER3 and CHA1 trancript in jhdδ or et1δ mutant relative to control wild type. (b) SRG1 trancription i unaffected by the abence of Set1 or Jhd. RNA-eq read obtained for SRG1 and SER3 trancript in control wild type (WT), jhdδ and et1δ are hown. SRG1 code for an uptream non-coding RNA involved in negatively regulating SER3 trancription.

4 a b Fold change in trancript level 3 1 PHO5 WT et1δ jhdδ et1δjhdδ et1-c119a jhd-h7a JHD WT DBP et1δ jhdδ et1δjhdδ et1-c119a jhd-h7a JHD Supplementary Figure. Set1 and Jhd control trancriptional repreion or attenuation at PHO5 and DBP gene. Fold-change in PHO5 and DBP ene trancript level in deletion mutant (et1δ, jhdδ and et1δjhdδ), catalytic-dead mutant (et1-c119a and jhd-h7a) or a train overexpreing Jhd (JHD) relative to the control WT train are hown. Error bar denote ±SEM from four independent experiment (n=). Statitical ignificance calculated uing Student t- tet, *p-value.5, **p-value <1 -.

5 Fold change in trancript level SER3 CHA1 PHO9 PHO5 LCP5 DBP Supplementary Figure 5. Hitone H3KR mutation alter target gene expreion. Fold-change in trancript level for the indicated target gene in the H3KR mutant relative to wild type H3 train are hown. Error bar denote ±SEM from four independent experiment (n=). Statitical ignificance calculated uing Student t-tet, *p-value <.5.

13 et1δ 71 53 1 99 1 3 FlagSET1 93 3 57 1 1 FlagSET1-G99E 1 9 7 5 15 b Antiene trancript up-regulated 1.5-fold relative to wild-type Antiene trancript down-regulated 1.

6 a SENSE ANTISENSE 1.5-fold change FDR 5% Total Up Down Total Up Down jhdδ et1δ FlagSET FlagSET1-G99E fold change FDR 1% Total Up Down Total Up Down jhdδ et1δ FlagSET FlagSET1-G99E b Antiene trancript up-regulated 1.5-fold relative to wild-type Antiene trancript down-regulated 1.5-fold relative to wild-type et1δ SET1 et1δ SET jhdδ SET1-G99E jhdδ SET1-G99E Supplementary Figure. Sene and antiene trancription are altered upon deletion of SET1 or JHD or following overexpreion of SET1 or hyperactive SET1-G99E. (a) The total number of ene or antiene trancript undergoing a 1.5-fold (at a fale dicovery rate (FDR) 5%) or a -fold (FDR 1%) change in expreion in the four indicated mutant compared to the control wild type are hown. The number of ene or antiene trancript either up- or downregulated in each of the four mutant train are alo indicated. (b) Four-way Venn diagram howing the number of unique or hared up- or down-regulated antiene trancript in each combination of the indicated deletion or overexpreion mutant train. Interection p-value <1 - (hypergeometric tet).

7 a GO term riboomal mall ubunit biogenei RNA proceing ncrna metabolic proce rrna proceing ncrna proceing rrna metabolic proce ribonucleoprotein complex biogenei riboome biogenei p-value 1 - glycogen bioynthetic proce b GO term polyaccharide metabolic proce cellular polyaccharide metabolic proce glucan metabolic proce energy derivation by oxidation of organic compound oxidation-reduction proce glycogen metabolic proce energy reerve metabolic proce p-value Supplementary Figure 7. Gene for glycogen metabolim and riboome biogenei are enitive to the deletion of SET1 or JHD or overexpreion of SET1 or hyperactive SET1- G99E. (a) GO term ignificantly enriched in the up-regulated ene trancript common to deletion (et1δ or jhdδ) and overexpreion mutant (SET1 or SET1-G99E). (b) GO term enriched in ene trancript down-regulated in all four mutant train.

8 kda α-h3kme1 α-h3kme α-h3kme3 α-h3 Supplementary Figure. H3K methylation occur in Candida glabrata. Wetern blot howing H3Kme1, H3Kme and H3Kme3 level in whole cell lyate prepared from S. cereviiae (experimental genome) and C. glabrata (reference genome). H3 erve a loading control. The full-image of the blot i alo hown and panel at the top are indicated.

9 a Common up-regulated gene in et1δ or jhdδ H3Kme1 H3Kme H3Kme3 [-log 1 (q-value)] b Common down-regulated gene in et1δ or jhdδ H3Kme1 H3Kme H3Kme3 [-log 1 (q-value)] jhdδ/wt Set1G99E/WT Supplementary Figure 9. Statitical ignificance are hown for the change in H3K methylation level at Set1 and Jhd co-repreed (a) or co-activated (b) target gene in jhdδ or Set1G99E mutant compared to wild type.

10 a Common up-regulated gene in et1δ or jhdδ b Common down-regulated gene in et1δ or jhdδ Normalized Read Count Normalized Read Count Midpoint - - Midpoint H3Kme1_WT H3Kme1_et1Δ H3Kme_WT H3Kme_et1Δ H3Kme3_WT H3Kme3_et1Δ Supplementary Figure 1. H3K methylation i abolihed at hared target gene in the et1δ mutant. Normalized read count profile for H3K monomethyl (me1), dimethyl (me) and trimethy (me3) mark acro bp region uptream (-) or downtream (+) of the TSS () at gene co-repreed (a) or co-activated (b) by Set1 and Jhd in BY71 (WT) and et1δ null mutant. Read count for et1δ null mutant and it control wild type train BY71 were obtained from publihed dataet of Chabbert et al (15).

WT et1δ jhdδ M 1 3 1 3 1 3 3 1 mononucleoome Supplementary Figure 11. Bulk chromatin tructure in wild type, et1δ and jhdδ train.

11 WT et1δ jhdδ M mononucleoome Supplementary Figure 11. Bulk chromatin tructure in wild type, et1δ and jhdδ train. A % agaroe gel tained with ethidium bromide and containing limited micrococcal nucleae (MNae) digeted DNA iolated from three independent culture each for the wild type (WT), et1δ and jhdδ train i hown. Thee MNae-digeted DNA were ubjected to library preparation. Adaptor-ligated DNA correponding to mononucleoome wa ize elected by gel purification and ubjected to next generation equencing. M, 1kb DNA ladder.

12 a b [-log 1 (q-value)] [-log 1 (q-value)] c d [-log 1 (q-value)] [-log 1 (q-value)] jhdδ/wt et1δ//wt Supplementary Figure 1. Statitical ignificance are hown for the hitone turnover change at Set1 and Jhd co-repreed (a) or co-activated (b) target gene, all yeat ribi gene (c) and acro all yeat gene (d) in jhdδ or et1δ mutant compared to wild type.

Nucleoome occupancy (MNae-eq read) H3K methylation occupancy Enzyme occupancy Fold change in H3K methylation in jhdδ/wt Fold change in H3K methylation In et1δ/wt Change in nucleoome occupancy RNA-eq

13 Nucleoome occupancy (MNae-eq read) H3K methylation occupancy Enzyme occupancy Fold change in H3K methylation in jhdδ/wt Fold change in H3K methylation In et1δ/wt Change in nucleoome occupancy RNA-eq read 35 WT 3 H3Kme1 3 H3Kme 3 H3Kme3 15 Jhd 15 Set1 +3 ΔH3Kme ΔH3Kme 3 +3 ΔH3Kme ΔH3Kme1 +1 ΔH3Kme +1 ΔH3Kme3 + Δ(jhdΔ WT) + Δ(et1Δ WT) 1 WT 1 jhdδ 1 et1δ Pho binding ite PHO9 Supplementary Figure 13. Occupancy of a PHO9 promoter nucleoome containing the Pho binding ite i reduced in et1δ or jhdδ mutant. Change to H3K methylation level, nucleoomal occupancy and trancript at the PHO9 gene in jhdδ or et1δ are hown. The normal nucleoomal, H3K methylation, Jhd and Set1 occupancie at thee gene are alo hown: Read for mononucleoomal DNA in wild type (WT) how the native chromatin organization (brown). Read for H3K monomethyl (me1, magenta), H3K dimethyl (me, cyan) and H3K trimethyl (me3, green) mark in WT how their ditribution over the PHO9 gene. Jhd (black) and Set1 (pink) occupancy (qpoi) in WT train at the PHO9 gene are hown. Fold change in the level of H3Kme1, H3Kme and H3Kme3 mark in jhdδ or et1δ relative to that in WT are hown. Fold change in H3K methylation in et1δ relative to WT wa calculated uing data from Chabbert et al (15). Increae or decreae in a given H3K methyl mark in the mutant i hown in red or blue, repectively. Mononucleoomal DNA from WT were ubtracted from thoe obtained from jhdδ or et1δ and viualized uing a genome brower. Gain or lo in nucleoome occupancy in the mutant i repreented in red or blue, repectively. RNA-eq read for PHO9 trancript level in WT, jhdδ or et1δ train are alo hown (orange). Schematic diagram at top how the nucleoome organization over promoter and TSS region of the PHO9 gene. Circle, well-poitioned promoter nucleoome; black arrow, TSS; and pink box, Pho binding ite, predicted from the publihed tudie of Badi et al. () and Harbion et al. (). Grape colored arrow and dotted line indicate decreae in nucleoomal occupancy at one of the two predicted Pho binding ite.

a Nucleoome occupancy (MNae-eq read) H3K methylation occupancy Enzyme occupancy Fold change in H3K methylation in jhdδ/wt Fold change in H3K methylation In et1δ/wt 35 WT 5 H3Kme1 5 H3Kme 5 H3Kme3 Jhd

jhdδ/wt Fold change in H3K methylation In et1δ/wt 35 WT 5 H3Kme1 5 H3Kme 5 H3Kme3 Jhd Set1 15 15 +3 ΔH3Kme1 3 +3 ΔH3Kme 3 +3 ΔH3Kme3 3 +1 ΔH3Kme1 +1 ΔH3Kme +1 ΔH3Kme3 Change in nucleoome occupancy

14 a Nucleoome occupancy (MNae-eq read) H3K methylation occupancy Enzyme occupancy Fold change in H3K methylation in jhdδ/wt Fold change in H3K methylation In et1δ/wt 35 WT 5 H3Kme1 5 H3Kme 5 H3Kme3 Jhd Set ΔH3Kme ΔH3Kme 3 +3 ΔH3Kme ΔH3Kme1 +1 ΔH3Kme +1 ΔH3Kme3 b Nucleoome occupancy (MNae-eq read) H3K methylation occupancy Enzyme occupancy Fold change in H3K methylation in jhdδ/wt Fold change in H3K methylation In et1δ/wt 35 WT 5 H3Kme1 5 H3Kme 5 H3Kme3 Jhd Set ΔH3Kme ΔH3Kme 3 +3 ΔH3Kme ΔH3Kme1 +1 ΔH3Kme +1 ΔH3Kme3 Change in nucleoome occupancy RNA-eq read Δ(jhdΔ WT) jhdδ et1δ + + Δ(et1Δ WT) 15 WT Change in nucleoome occupancy RNA-eq read Δ(jhdΔ WT) + Δ(et1Δ WT) 15 WT jhdδ et1δ LCP5 DBP Supplementary Figure 1. Set1 and Jhd co-regulate H3K methylation, nucleoomal occupancy and expreion of candidate Ribi gene, LCP5 and DBP. (a-b) Change in H3K methylation level, nucleoomal occupancy and trancript level for LCP5 and DBP gene in jhdδ or et1δ are hown. The normal nucleoomal, H3K methylation, Jhd and Set1 occupancie at thee gene are alo hown. Read for mononucleoomal DNA in wild type (WT) how the native chromatin organization (brown). Read for H3K monomethyl (me1, magenta), H3K dimethyl (me, cyan) and H3K trimethyl (me3, green) mark in WT how their ditribution over the LCP5 and DBP gene. Jhd (black) and Set1 (pink) occupancy (qpoi) in WT train at the LCP5 and DBP gene are hown. Fold change in the level of H3Kme1, H3Kme and H3Kme3 mark in jhdδ or et1δ relative to that in WT are hown. Fold change in H3K methylation in et1δ relative to WT wa calculated uing data from Chabbert et al (15). Increae or decreae in a given H3K methyl mark in the mutant i hown in red or blue, repectively. Mononucleoomal DNA from WT were ubtracted from thoe obtained from jhdδ or et1δ and viualized uing a genome brower. Gain or lo in nucleoome occupancy in the mutant i repreented in red or blue, repectively. RNA-eq read for LCP5 and DBP trancript level in WT, jhdδ or et1δ train are alo hown (orange).

15 a 1 Cluter 1 Cluter Cluter 3 Cluter Cluter 5 Cluter Normalized Read Count b H3Kme1_WT H3Kme1_jhdΔ H3Kme_WT H3Kme_jhdΔ H3Kme3_WT H3Kme3_jhdΔ Cluter 1 Cluter Cluter 3 Cluter Cluter 5 Cluter Normalized Read Count H3Kme1_WT H3Kme1_et1Δ H3Kme_WT H3Kme_et1Δ H3Kme3_WT H3Kme3_et1Δ c 1 Cluter 1 Cluter Cluter 3 Cluter Cluter 5 Cluter Normalized Read Count H3Kme1_WT H3Kme1_Set1G99E H3Kme_WT H3Kme_Set1G99E H3Kme3_WT H3Kme3_Set1G99E Supplementary Figure 15. Deletion of JHD or SET1 or the expreion of hyperactive Set1- G99E alter H3K methylation level at all ix k-mean cluter. Normalized read count profile for H3Kme1, H3Kme and H3Kme3 mark acro bp region uptream (-) or downtream (+) of the TSS () at gene within the ix k-mean cluter (Fig. a-b) in control wild type (WT), jhdδ or et1δ null mutant and hyperactive Set1-G99E expreing train are hown. Read count for et1δ null mutant and it control wild type train BY71were obtained from publihed dataet of Chabbert et al (15).

16 H3Kme1 H3Kme H3Kme3 Cluter 1 [-log 1 (q-value)] Cluter [-log 1 (q-value)] Cluter 3 [-log 1 (q-value)] Cluter [-log 1 (q-value)] Cluter 5 [-log 1 (q-value)] Cluter [-log 1 (q-value)] jhdδ/wt Set1G99E/WT Supplementary Figure 1. Statitical ignificance are hown for the change in H3K methylation level at the ix gene cluter in jhdδ or Set1G99E mutant compared to control wild type.

a 1 Rpo1 occupancy b Rpb3 occupancy (log enrichment) Rpb3 occupancy (log enrichment) 1...... - - 1...... - - 1. Rpo1 occupancy (log enrichment) Rpo1 occupancy (log enrichment) 1...... - - 1...... - - 1. Cluter 1 Cluter 3 Rpb3 occupancy (log enrichment).

17 a 1 Rpo1 occupancy b Rpb3 occupancy (log enrichment) Rpb3 occupancy (log enrichment) Rpo1 occupancy (log enrichment) Rpo1 occupancy (log enrichment) Cluter 1 Cluter 3 Rpb3 occupancy (log enrichment) Rpo1 occupancy (log enrichment) Cluter Rpb3 occupancy (log enrichment) Rpo1 occupancy (log enrichment) Cluter Rpb3 occupancy (log enrichment) Rpb3 occupancy (log enrichment) Rpo1 occupancy (log enrichment) Rpo1 occupancy (log enrichment) Cluter 5 Cluter Relative to TSS Relative to TSS Supplementary Figure 17. Occupancy and ditribution of Rpb3 and Rpo1 at all ix k- mean cluter. (a) Heat map for Rpo1 occupancy within the ix k-mean cluter, uing data from Venter and Pugh (9), i hown. Rpo1 occupancy above global mean i in orange. The mean occupancy profile over each of the ix k-mean cluter (hown in Fig. a-b) are hown for two RNA polymerae II (Pol) ubunit, Rpb3 and Rpo1 (Venter and Pugh, 9). Dotted line mark TSS (). In the chematic at the bottom, circle denote the poition of -1, +1 and coding region nucleoome and the arrow denote the TSS.

18 WT et1δ jhdδ Cluter 1 Cluter Cluter 3 H3 turnover (log) Midpoint Midpoint Midpoint Cluter Cluter 5 Cluter H3 turnover (log) Midpoint Midpoint Midpoint Supplementary Figure 1. Set1 and/or Jhd control nucleoomal turnover at gene within the ix k-mean cluter. Mean profile for hitone H3 turnover acro bp region uptream (-) or downtream (+) of the TSS () at gene within the ix k-mean cluter (Fig. a-b) are hown in wild type (WT), et1δ and jhdδ train.

19 Cluter 1 Cluter Cluter 3 [-log 1 (q-value)] Cluter Cluter 5 Cluter [-log 1 (q-value)] jhdδ/wt et1δ//wt Supplementary Figure 19. Statitical ignificance are hown for the hitone turnover change at the ix k-mean cluter in jhdδ or et1δ mutant compared to wild type.

20 H3Kme1 H3 H3Kme H3Kme3 Supplementary Figure. Full-length image of the blot hown in Fig. a. Panel diplayed in Fig. a are hown within rectangle.

21 H3Kme1 H3Kme H3Kme3 H3 Supplementary Figure 1. Full-length image of the blot hown in Fig. d. Panel diplayed in Fig. d are hown within rectangle.

22 H3Kme1 H3Kme H3Kme3 V5 Flag H3 Supplementary Figure. Full-length image of the blot hown in in Fig. c. Panel hown are within rectangle.

23 Supplementary Table 1. Saccharomyce cereviiae train ued Strain Genotype Source FY Mat a hta1-htb1δ hta-htbδ ly-1δhi3δ ura3-5 psab [HTA1-HTB1 (CEN URA3)] (1) HTABWT HTA1-HTB1 (CEN HIS3); derived from FY () YZS515 Mat a ura3-5 leu-3,11 hi3 trp1δ et1δ::kanmx (3) YZS5 jhdδ::kanmx; derived from FY () YMC ADH1p-FlagSET1::URA3 HTA1-HTB1 (CEN HIS3); derived from HTABWT Thi tudy YMC3 ADH1p-FlagSET1G99E::URA3 HTA1-HTB1 (CEN HIS3); derived from HTABWT Thi tudy YMC ADH1p-JHD-9myc::URA3 HTA1-HTB1 (CEN HIS3); derived from HTABWT Thi tudy YMC et1δ::kanmx HTA1-HTB1 (CEN HIS3); derived from HTABWT () YMC5 jhdδ::natmx et1δ::kanmx HTA1-HTB1 (CEN HIS3); derived from YMC Thi tudy YMC7 jhdδ::kanmx HTA1-HTB1 (CEN HIS3); derived from YZS5 () YMC7 ADH1p-jhdH7A-9myc::URA3 HTA1-HTB1 (CEN HIS3); derived from YMC7 Thi tudy YMC Jhd-1V5::KanMX; derived from FY () YMC5 Jhd-1V5::KanMX HTA1-HTB1 (CEN HIS3); derived from YMC () YMC17 V5-Set1::URA3; derived from HTABWT Thi tudy YMC1 P TDH3 -Cre-EBD7::URA3; derived from HTABWT Thi tudy YMC1 HHT1-V5-LoxP-HphMX-LoxP-FLAG; derived from YMC1 Thi tudy YMC1 (hht-hhf)δ::natmx; derived from YMC1 Thi tudy YMC15 et1δ::kanmx; derived from YMC1 Thi tudy YMC1 jhdδ::kanmx; derived from YMC1 Thi tudy 1. Hirchhorn, J. N., Bortvin, A. L., Ricupero-Hovae, S. L., and Winton, F. (1995) A new cla of hitone HA mutation in Saccharomyce cereviiae caue pecific trancriptional defect in vivo. Mol Cell Biol 15, Huang, F., Ramakrihnan, S., Pokhrel, S., Pflueger, C., Parnell, T. J., Katen, M. M., Currie, S. L., Bhachech, N., Horikohi, M., Grave, B. J., Cairn, B. R., Bhakara, S., and Chandraekharan, M. B. (15) Interaction of the Jhd H3K demethylae with chromatin i controlled by hitone HA urface and retricted by HB ubiquitination. J Biol Chem 9, Huang, F., Chandraekharan, M. B., Chen, Y. C., Bhakara, S., Hiebert, S. W., and Sun, Z. W. (1) The JmjN domain of Jhd i important for it protein tability, and the plant homeodomain (PHD) finger mediate it chromatin aociation independent of H3K methylation. J Biol Chem 5, 5-51

24 Supplementary Table. Primer ued in qrt-pcr Primer Sequence PHO5 Sene For CAGATACGTCATTAACGATGCTGTT PHO5 Sene Rev CCGGCTACTCTCTTTTCAGCA PHO5 Antiene For CCTCGACTTAGCAAAACATCA PHO5 Antiene Rev CGCACATGCCAAATTATCAA PHO9 Sene For TCAATTGAACTAGCTGTTGCTATTACT PHO9 Sene Rev AACCAACAGCGACAATACCA PHO9 Antiene For GTCACTCATTCTATGACAATTCATGT PHO9 Antiene Rev TAAGCCCGGTTTTCGATATGA 5 -SER3-For GACCAAGAGAACACTGTGCGTGTG 3 -SER3-Rev GAGATCTTAGCAGAGGTTTGATTTAG 5 -CHA1-For TTGTAATAGAGGACAAAGATGTTATTG 3 -CHA1-Rev AAATTGTCAGCGACTTCTATTACAGG LCP5-For CAGAGAAGGAACGTAGAGTCACTTC LCP5-Rev TACAGTCTCCTTTGAGCTCTATCCC DBP-For CATAGATCTGGTCGTACGGCCC DBP-Rev TCAAGAGCGCAAACTTTTCCCGTC

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the