Molecular analysis of ras oncogenes in CIN III and in stage I and II invasive squamous cell carcinoma of the uterine cervix
|
|
- Luke Miles
- 5 years ago
- Views:
Transcription
1 576 Deprtment of Pthology, Cornell University Medicl College, New York, USA J J O Lery I Silv V Uhlmnn K Luttich Deprtment of Pthology, University of SheYeld, SheYeld, UK R J Lnders Deprtment of Pthology, University College Cork, Irelnd M Crowley I Hely Correspondence to: DrJJO Lery,Deprtment of Pthology, The Coombe Women s Hospitl, Dublin, Republic of Irelnd. Accepted for publiction 5 Februry 1998 Moleculr nlysis of rs oncogenes in CIN III nd in stge I nd II invsive squmous cell crcinom of the uterine cervix J J O Lery, R J Lnders, I Silv, V Uhlmnn, M Crowley, I Hely, K Luttich Abstrct Aim To exmine the prevlence of genitl type humn ppillom virus (HPV) nd muttions t codons 12, 13, nd 61 in H, Ki, nd N-rs in CIN III nd erly invsive squmous cell crcinoms of the cervix. Methods Prevlence of HPV ws exmined in 20 CIN III nd 20 stge I nd II cervicl crcinoms, using non-isotopic in situ hybridistion (NISH) nd solution phse polymerse chin rection (PCR). In ddition, muttions t codons 12, 13, nd 61 were exmined in H, Ki, nd N-rs in these CIN III nd erly invsive squmous cell crcinoms, to ssess the prevlence of rs gene point muttions nd to define where in the pthobiology of squmous cell crcinom such events occur. A non-isotopic PCR/RFLP ssy ws used to define these muttions. Results Of the 20 CIN IIIs exmined, 19 contined HPV 16 DNA sequences by PCR nd NISH. Dul infection ws not uncovered. The 20 erly (stge I nd II) invsive squmous cell crcinoms showed predominnt HPV 16 positivity (17/20), with one cse HPV 18 positive, confirmed on PCR nd NISH. Activting muttions were not identified in ny of the CIN III cses. Only one stge I, HPV 16 positive crcinom showed n ctivting muttion in H-rs codon 12, which ws not present in djcent norml ectocervicl mucos from the sme ptient. Conclusions rs Activtion does not pper to occur in conjunction with HPV infection, prticulrly of HPV 16 infected high grde cervicl intrepithelil neoplsi, or to occur commonly in erly cervicl squmous cell crcinom. The postulted model of HPV linked crcinogenesis suggests mlfunctionl control of virl trnscription s necessry component of neoplstic progression. It is lso cler tht host gene ltertions re eqully necessry for HPV linked crcinogenesis to occur. (J Clin Pthol 1998;51: ) Keywords: rs; humn ppillom virus; cervicl crcinom; CIN III There re three members of the rs oncogene fmily. N-rs is locted on chromosome 1 (1p21p32), H-rs on chromosome 11 (11p15.1-p15.5), nd K-rs on chromosome 12 (12p12.1-pter). 1 Ech of these three genes J Clin Pthol 1998;51: contins four coding exons which specify homologous proteins of 21 kd nd 5' non-coding exon. 2 In ddition, two pseudogenes, H-rs-2 nd K-rs-1, hve been identified nd chrcterised in rts nd humns 3 ; these re mpped to the X chromosome to the 6p12-p23 locus. 3 The protein encoded by the rs genes binds gunosine triphosphte (GTP) nd gunosine diphosphte (GDP) with high Ynity nd re known to possess GTPse ctivity. 2 Such rs proteins shre biochemicl properties with G proteins, which re known to ply role in signl trnsduction pthwys from membrne bound receptors to denylte cyclse. 4 In fct, certin domins of the rs proteins show significnt sequence homology with the α subunit of G proteins such s G 5, which is known to ctivte denylte cyclse directly in response to β drenergic stimuli, mking rs proteins involved in signl trnsduction. rs Proteins probbly exist in equilibrium in the cell between n ctive nd n inctive stge. Inctive forms bind GDP. rs Proteins will remin inctive until they receive stimulus from nother protein/receptor upstrem of puttive pthwy of signl trnsduction. Such stimulus results in the exchnge of GDP for GTP, followed by conformtionl ltertion of inctive rs to ctive rs. Once interction between the ctive rs proteins nd the effector hs tken plce, immedite dectivtion would occur. This is chieved by the intrinsic GTPse ctivity ctlysing the hydrolysis of GTP nd thus returning the rs proteins to the inctive GDP bound stte. Muttion occurring in the rs genes shifts the norml equilibrium to the ctive form. Such stbilistion phenomen would result in continuous signl trnsduction nd subsequently mlignnt trnsformtion. Theoreticlly, rs stbilistion cn be chieved by muttions tht inhibit the intrinsic GTPse ctivity of rs proteins, increse the exchnge rte between GDP nd GTP, or induce n ctive conformtionl chnge tht does not require binding of gunine nucleotides. Indeed, norml rs genes if overexpressed lso induce mlignnt trnsformtion by producing mny molecules in the GTP bound ctive stte. Experimentl evidence now indictes tht inhibition of GTPse ctivity is the preferred mechnism of ctivtion of rs oncogenes. 5 6 Activtion of rs genes my occur through (1) muttions in the coding regions nd (2) enhnced expression. Muttions in the three rs oncogenes (H-rs, K-rs, nd N-rs) re
2 Moleculr nlysis of rs oncogenes in crcinom of the cervix 577 Tble 1 Summry of rs gene ssys for H-rs known to occur in the codons for mino cids 12, 13, nd 61. Additionlly, when H-rs is exposed to bisulphite prticulr muttions in codons 12, 13, 59, nd 63 result, which shows tht codons 59 nd 63 re lso potentil trgets for ctivting muttions. 2 Besides these two sites, muttions in codons 116 nd 119 cn lso ctivte the rs gene. 7 Enhnced expression cn be obtined by the insertion of strong promoter or enhncer in the vicinity of the rs gene, 2 8 by mplifiction of the norml proto-oncogene, 9 or by deletion of the first (non-coding) exon. 10 Muttions t codons 12, 13, nd 61 re likely to led to loss of GTPse ctivity which results in constitutively ctivted rs oncogene. Somtic deletions nd muttions of H-rs gene in humn cervicl cncers hve been described by Riou et l, 11 who exmined the c-h-rs-1 locus in cervicl cncers nd described loss of one llele t this locus in 36% of heterozygous tumours nd muttion on codon 12 in 24% of tumours t n dvnced stge. These investigtors lso demonstrted mplifiction of c-myc nd H-rs. 12 In ddition, incresed expression of the rs p21 gene hs been found in cervicl crcinom, using the Y monoclonl ntibody, 13 showing higher stining intensity in mlignnt tumour cells thn in benign or premlignnt lesions. It hs been suggested tht serologicl testing for p21 my hve potentil for monitoring disese ctivity in ptients with cervicl crcinom. 14 H-rs point muttions hve been implicted in the pthogenesis of cervicl neoplsi. In contrst, lrge study of K-rs ctivtion in neoplsms of the humn femle reproductive trct did not show ny point muttionl ctivity in cervicl crcinoms. 15 Interestingly, low incidence of rs oncogene ctivtion in humn squmous cell crcinoms from other sites hs been reported by Rumsby et l. 16 In nogenitl neoplsi, muttions of K-rs t codon 12 hve been shown in nl crcinoms not infected with humn ppillom virus (HPV). Hiorns et l suggest tht rs ctivtion does not pper to be common event Frgment size Gene Enzyme Undigested Mutnt Norml H-rs-12 Msp1 (CCGG) H5': 5'GAGACCCTGTAGGAGGACCC3' H3': 5'GGGTGCTGAGACGAGGGACT3' H-rs-13 HphI (GGTGA) b (10) H12S: 5'GCAGGAGACCCTGTAGGAGGAC3' H13A Hph: 5'GTCAGCGCACTCTTGCCCTCA3' H-rs-61 AlwNI b (17) (CAGNNNCTG) Nested PCR: H-61S: 5'ATGAGAGGTACCAGGGAGAG3' H-61A: 5'TCACGGGGTTCACCTGTACT3' H-61AAlw: 5'CGCATGGCGCTGTACAGCTC3'* *Mismtched nucleotides in the primers re underlined. Khn et l (reference 22). b MspI from Gibco BRL; HpHI from New Englnd Biolbs; AlwNI from Sigm. in the genesis of such tumours nd if it does occur it does not pper to cooperte with HPV. 17 Another common HPV ssocited tumour, oesophgel crcinom, hs lso been exmined for point muttions t codons 12, 13, nd 61 of the rs oncogenes. Victor et l filed to show ny evidence of muttions in these codons in squmous cell crcinoms of the oesophgus in South Afric. 18 In this study, we exmine muttions in these codons in H, Ki, nd N-rs in cervicl intrepithelil neoplsi (CIN) grde III nd erly invsive squmous cell crcinoms of the cervix, to ssess the prevlence of such muttions nd to exmine where in the pthobiology of squmous cell crcinom such events occur. Methods MATERIALS Archivl pryn wx embedded tissues of 20 CIN III nd 20 stge I nd II invsive squmous cell crcinoms were retrieved from the files of the deprtment of pthology, University College Cork, Irelnd. Six of the crcinom group hd coexistent CIN III in the resection specimen. Control histologiclly norml ectocervicl tissue ws exmined in lesions (where possible) in order to ssess the prevlence of genotypic geogrphicl chnge in djcent epithelium. HPV DNA IN SITU HYBRIDISATION Three 5 µm sections (selected from three diverent res of the tumour) were cut onto APES coted glss slides (PH106, C A Hendley, Essex, UK). In ddition, two res from the included cervix were lso exmined. Tissue dewxing ws crried out using xylene nd rehydrtion through grded lcohol series. Proteolytic digestion ws crried out using 0.5 mg/ml proteinse K in proteinse K buver (50 mm Tris HCl, ph mM EDTA) t 37 C for 10 minutes. For lkline phosphtse detection, slides were immersed in 20% (vol/vol) queous cetic cid t 4 C for 15 seconds. For peroxidse detection, slides were immersed in 3% sodium zide/hydrogen peroxide to bolish endogenous peroxidse ctivity. Slides were then wshed in phosphte buvered sline for five minutes. A postfixtion step ws not crried out. Dehydrtion of the sections then took plce through grded lcohols to wter. Cloned HPV probes (6, 11, 16, 18, 31, 33) (genitl types; gifts of Hrld Zur Husen) were lbelled with biotin or digoxigenin using stndrd nick trnsltion protocol. 19 Probes were initilly prepred t concentrtion of 200 ng/ml. The hybridistion buver contined (2 SSC (NCl/sodium citrte), 5% dextrn sulphte, 0.2% dried milk powder contining no vegetble extrcts, nd 50% formmide). Approximtely ng of the pproprite probe in the hybridistion buver ws pplied to the centre of ech well on the PH106 slides. Hybridistion ws crried out s previously described. 12
3 578 O Lery, Lnders, Silv, et l Tble 2 Summry of rs gene ssys for K-rs Frgment size Gene Enzyme Undigested Mutnt Norml K-rs-12 T Bst NI (CC GG) b A K12S1: 5'ACTGAATATAAACTTGTGGTAGTTGGACCT3' K12A1: 5'TCAAAGAATGGTCCTGGAAC3' K13 (sp) Hph I (GGTGA) c K12S1: 5'ACTGAATATAAACTTGTGGTAGTTGGACCT3' K12A1: 5'TCAAAGAATGGTCCTGGAAC3' K-rs 13 He III (GGCC) c (25) K12S2: 5'CATGTTCTAATATAGTCACA3' K13AHe: 5'TATCGTCAAGGCACTCTTGCCTAGG3' K-rs 61 Bcl I (TGATCA) c (19) K61SBcl: 5'GGATATTCTCGACACAGCTGAT3' K61A: 5'AATTACTCCTTAATGTCAGC3' K61SEr: K61A: Er I (GAAGAG) c (25) 5'GGATATTCTCGACACAGCAGGTGA3' 5'AATTACTCCTTAATGTCAGC3' *Mismtched nucleotides in the primers re underlined. See text for detils (not ll mutnts re uncut). b Khn et l (reference 22). c Bst NI, He III, Bcl I from Sigm; Hph I, Er I from New Englnd Biolbs. Tble 3 Summry of rs gene ssys for N-rs Frgment size Gene Enzyme Undigested Mutnt Norml N-rs 12 (method 1) Hph I (GGTGA) (11) N12S1: 5'CTGGTGTGAAATGACTGAG3' N12AHph: 5'TGTCAGTGCGCTTTTCCCAACATC3' N-rs 12 (method 2) BspMI (GCAGGT) b N12S2: 5'ACTGAGTACAAACTGGTGGTGGTTCCAGCA3' N12A2: 5'GGGCTACCTGCGGGCCTCCACTCTATGG3' N-rs 13 HphI (GGTGA) c (23) N12S1: 5'CTGGTGTGAAATGACTGAG3' N13AHph: 5'GATTAGCTGGATTGTCAGTGCGCTTTTCCCATC3' N-rs 61 MscI (TGGCCA) (23) N61SBl: 5'TTGGACATACTGGATACAGCTGGC3' N61A: 5'GTTAATATCCGCAAATGACTTGC3' *Mismtched nucleotides in the primers re underlined. bo Lery et l. c O Lery, nd Mitsudomi et l (reference 22). Hph I, BspMI from New Englnd Biolbs; MscI from Sigm. Following hybridistion, medium stringency wshings were initilly pplied using 2 SSC t 60 C for 20 minutes, followed by 0.2 SSC for 42 C t 20 minutes, then 0.1 SSC t room temperture for five minutes nd 2 SSC t room temperture for five minutes. Higher stringency wshes included 0.2 SSC t 55 C nd 60 C for 10 minutes nd 0.1 SSC t room temperture, 42 C, nd 55 C. The hybridistion signl ws detected using one step, two step, or three step techniques s described previously. 12 Colorimetric detection ws chieved using n NBT/ BCIP substrte for lkline phosphtse or AEC (Zymed kit for peroxidse; Zymed, Cliforni, USA). 12 Sections were counterstined with 2% methyl green for lkline phosphtse detection or hemtoxylin for the peroxidse detection system. Tissue controls for non-isotopic in situ hybridistion (NISH) included HPV positive cervicl wrts nd myocrdium (negtive for HPV). Rection controls included hybridistion buver on its own, biotin/digoxigenin lbelled plsmid sequences (pbr322), nd n irrelevnt probe (Herpes zoster virus, HZV). Lbelled humn plcentl DNA ws used to check hybridistion eyciency. Detection controls included omitting primry or secondry ntibody steps nd ddition of the colorimetric substrte only. SOLUTION PHASE POLYMERASE CHAIN REACTION HPV DNA sequences were derived from the EMBL genetic sequence dtbse. HPV E6 sequences which remin intct following virl DNA integrtion were chosen. During oligo synthesis, biotin reporter molecule with 15 crbon tom linker rm ws dded to the 5' end of the oligonucleotide probe nd subsequently used s n internl probe to confirm product specificity. The nucleotide sequence of the primers re s previously described. 20 Generl HPV primers (which identify sequenced nd unsequenced HPV) were lso used for pn HPV screen, unrestricted by the type specific HPV chosen bove, nd re s previously described. 21 Sections 10 µm thick were cut from the tissue blocks nd plced in sterile Eppendorf tubes. Strict nticontmintion protocols were dopted throughout. Nucleic cid extrction ws performed using proteinse K ( mg/ml) in proteinse K buver (100 mm NCl, 10 mm Tris HCl, 25 mm EDTA, 0.5% SDS, ph 8.4). Proteinse K incubtion ws crried out for three to five dys t 37 C with dequte mixing of smples. Proteinse K inctivtion ws then crried out t 94 C for 10 minutes. DNA ws purified using stndrd phenol chloroform isomyl lcohol technique. Nucleic cid ws precipitted using 3 M sodium cette nd ice cold ethnol. For type specific HPV polymerse chin rection (PCR), the PCR solution consisted of PCR buver (50 mm KCl, 10 mm Tris HCl ph 8.3, 1.5 mm MgCl 2, 0.01% geltine, 200 µm of ech deoxynucleotide triphosphte (dntp), 1.0 µm of ech primer, 2.5 units of AmpliTq DNA polymerse, nd 100 ng of DNA templte). Smples were then subjected to 40 cycles of PCR in Perkin Elmer 480 DNA thermocycler. Cycling prmeters were s follows: 94 C for one minute, followed by 94 C for one minute, 55 C for two minutes, 72 C for three minutes, by 40 cycles with finl extension set for 72 C for five minutes. For generl primer PCR, mplifiction conditions were similr except 3.5 mm MgCl 2 ws used nd n nneling temperture of 40 C ws pplied. Type specific HPV PCR products were confirmed by dot blot hybridistion, s previously described. 20 ANALYSIS OF rs ONCOGENE POINT MUTATIONS Nucleic cid ws extrcted s bove. The prevlence of rs point muttions ws ssessed by PCR/RFLP nlysis. Primers used for mplifiction of rs genes re shown in tbles 1 6. Cell lines shown to hve ll six possible muttions t codon 12 of Ki-rs nd t H-rs or N-rs codons 12 nd 61 were used s positive
4 Moleculr nlysis of rs oncogenes in crcinom of the cervix 579 Tble 4 Designed restriction frgment length polymorphisms for the detection of point muttions t codon 12 of the rs genes Sequence (codon) Gene Mismtch Enzyme Restriction site H-rs GCC GGC GGT MspI CCGC T K-rs GGA GCT GGT GGC CCT (11) Bst NI CC GG A Nrs GGA GCA GGT GGT GAT (13) Hph I b GGTGA CCA (10) Bsp MI GCAGGT Sequence round codon 12 is shown; muttions re underlined. Mismtched nucleotide nd its position in the primer is shown. Khn et l (reference 22). b MspI from Gibco BRL; Bst NI from Sigm; Hph I nd BspMI from New Englnd Biolbs. Tble 5 Designed restriction frgment length polymorphisms (RFLP) for the detection of point muttions t codon 13 of rs genes Sequence (codon) Gene Mismtch Enzyme Restriction site H-rs GGC GGT GTG GAG (14) Hph I GGTGA K-rs GGT GGC GTA CTA (14) He III GGCC N-rs GGT GGT GTT GAT (14) Hph I GGTGA Sequence round codon 12 is shown; muttions re underlined. Mismtched nucleotide nd its position in the primer is shown. Origin of RFLP, He III from Sigm; Hph I from New Englnd Biolbs. Tble 6 Designed restriction frgment length polymorphisms (RFLP) for the detection of point muttions t codon 61 of the rs genes Sequence (codon) Gene Mismtch Enzyme Restriction site H-rs GCC GGC CAG GAG GAG CTG (63) Alw N1 CAGN 3 CTG K-rs GCA GGT CAA GAG GCT GAT Bcl I TGATCA (59, 60) GAA (61) Er I GAAGAG CGA Tq I TCGA CTA Xb I TCTAGA CAC Me III GTCAC CAT Nl III CATG N-rs GCT GGA CAA GAA GAG GGC (60) Bl I TGGCCA Sequence round codon 12 is shown; muttions re underlined. Mismtched nucleotide nd its position in the primer is shown. Origin of RFLP: Bcl I, Er I, AlwNI, Bl I, Mitsudomi et l (reference 23); Nl III, Kumr et l (reference 24); Tq I, Xb I, Me III, Milici et l (reference 25). AlwNI, Bcl I, Nl III, Tq I, nd Xb I from Sigm; Er I from New Englnd Biolbs. Tble 7 Cell lines used in the study Cell line Activting muttion nd codon Clu I TGT; K-rs codon 12 A549 AGT; K-rs codon 12 SW480 GTT; K-rs codon 12 SW1116 GCT; K-rs codon 12 A427 GAT; K-rs codon 12 T24 Homozygous for vline t H-rs codon 12 HT1080 Homozygous for lysine t N-rs codon 61 NCI-H1915 CTG; H-rs codon 61 NCI-H647 GAC; K-rs codon 13 Activting muttion underlined. controls (Clu-1, SW 480, A427, SW1116, nd T24 were purchsed from ATCC, PHLS Centre for Applied Microbiology, Porton Down, Slisbury, UK) (tble 7). Codon 12 rs oncogenes H-rs 12 Primers were used to mplify H-rs codon 12 sequences spnning two endogenous MspI (CCGG) sites, one of which included the two trget G residues t position 12 nd the other of which is n Msp1 control site. Positive control cell line mteril used in this ssy ws the T24 cell line (homozygous for the vline codon 12 muttion). The sizes of the undigested, norml, nd mutnt frgments re given in tble 1. K-rs 12 This codon ws mplified using 5' end primer tht contined C substitution t the first position of codon 11. This creted Bst N1 (CCTGG) site which overlps the first two nucleotides of codon 12. The 3' primer lso contined substitution, creting control Bst N1 site. The cell line SW 480 ws used s positive control mteril. The sizes of the undigested, norml, nd mutnt frgments re given in tble 2. N-rs 12 In this cse, by introducing n A residue t codon 13 through the mismtched ntisense primer N12AHph, novel Hph site ws creted. Any muttion bolished the restriction site. The sizes of the undigested, norml, nd mutnt frgment re given in tble 3. Detils of the RFLPs t codon 12 re given in tble 4. Codon 13 rs oncogenes By introducing n A residue t codon 14 for (H nd N rs) nd Ctcodon 13 for K rs, screening for point muttions t codon 13 for ech of the three rs oncogenes could be performed using the mismtched primers H13AHph, K13AHe, nd N13AHph, which respectively creted n Hph1 site for H-rs, n He III site for K-rs, nd n Hph1 site for N-rs. Using the primers for K-rs codon 12 ssy, the sme mplified frgment cn be digested with Hph 1 to dignose sprtic cid muttions t the second position of codon 13. The prticulrs of the RFLPs re given in tble 5. Codon 61 rs oncogenes H-rs 61 For this codon, AlwN1 cut the frgment generted with primers H61AAlw nd H61S (tble 1) when no muttion ws present. To mximise the eyciency of this ssy, the entire codon ws first mplified using H61S nd H61A nd nested PCR for H61AAlw nd H61S. The digestions re illustrted in tbles 1 nd 6. K-rs 61 The enzyme Bcl I cut the PCR product mplified with K61SBcl (which hs two mismtches t codon 59 nd 60) nd K61A when the first two nucleotides of codon 61 re CA. The third nucleotide of codon 61 Vects the genetic code, nd Er I digestion ws therefore necessry. ErI would only cut the frgment generted by primers K61SEr nd K61A when the third nucleotide of codon 61 ws A. By combining the digestions of Bcl I nd Er I, ny muttion could be detected. These digestions re illustrted in tbles 2 nd 6. N-rs 61 Bl I cut the frgment generted by N61SBl nd N61A when the first two nucleotides were CA (tble 6). Afl III will cut when codon 61 is CAT or CAC. Therefore when Bl I cuts nd AflIII does not, then no ctivting muttion ws present. The digestions re illustrted in tbles 2 nd 6.
5 580 O Lery, Lnders, Silv, et l Figure 1 HPV 16 non-isotopic in situ hybridistion (NISH) ssy in cervicl squmous cell crcinom, showing punctte signls in the nuclei of mny cells. POLYMERASE CHAIN REACTION Genomic DNA ( ng) ws mplified in rection volume of 50 or 100 µl contining 50 mm KCl, 10 mm Tris-HCl (ph 8.3), 1.5 mm MgCl 2, 0.01% (wt/vol) geltin, 1.25 mm of ech of four dntp, 50 pmol of primers, nd 2.5 units of Tq DNA polymerse (Ampli Tq, Perkin-Elmer, Wrrington, Cheshire, UK). The conditions for the PCR using 480 therml cycler (Perkin-Elmer) were s follows: 94 C for five minutes for initil denturtion, 40 cycles of 94 C for one minute, nneling for two minutes, nd extension t 68 C for two minutes. Anneling tempertures were s follows: K-rs codon 12, 45 C; H-rs codon 12, 62 C; N-rs codon 12, 55 C; K- nd N-rs codons 13 nd 61, 50 C; H-rs codon 13 nd 61, 60 C. Oligonucleotide primers were synthesised using DNA synthesiser ccording to the published sequences dt of the K-, H-, nd N-rs genes. Primer sequences re shown in tbles 1, 2, nd 3. In cse of the H-rs codon 61 screening, the eyciency of PCR ws very low becuse of two mismtches in the primer H61AAlw. To overcome this, we employed heminested PCR using entire exon II PCR product s templte for second stge PCR. RESTRICTION ENZYME DIGESTION AND GEL ELECTROPHORESIS PCR product (16 20 µl) ws digested with the restriction enzymes shown in tbles 1 3. The rection conditions followed suppliers recommendtions. DNA ws electrophoresed through 4 6% grose gels, followed by ethidium bromide stining. Gels were photogrphed using n ultrviolet light trnsillumintor. Figure 2 H-rs 12 muttion PCR/RFLP ssy, using 4% grose gel. Mrker ldder used is phi X174. U, uncut mplified product; Mt, mutnt frgment (lne 6). Lne 5 shows mutted H-rs codon 12 in tumour smple. Figure 3 N-rs codon 61 ssy to estblish PCR/RFLP ssy sensitivity: 25 ng of strting DNA templte ws used; genomic DNA ws prepred from HT 1080 cells (homozygous for the mutnt 61 lysine llele). This mutnt DNA ws mixed with norml genomic DNA obtined from humn plcent nd mixed in defined rtios. The mplified product ws then digested with Bl I. Results Of the 20 CIN IIIs exmined, 19 contined HPV 16 DNA sequences by PCR nd NISH. Dul infection ws not uncovered. The 20 erly (stge I nd II) invsive squmous cell crcinoms showed predominnt HPV 16 positivity (17/20) with one cse (1/20) being HPV 18 positive, gin confirmed on PCR nd NISH (fig 1). Activting muttions were not identified in ny of the CIN smples. Only one stge I HPV
6 Moleculr nlysis of rs oncogenes in crcinom of the cervix positive crcinom showed n ctivting muttion t codon 12 of H-rs. The djcent norml ectocervicl mucos from the sme ptient ws norml. All control cell lines yielded restriction ptterns s predicted (fig 2). The sensitivity of the ssy with loding contminting non-mutted DNA ws lso estblished (fig 3) t sensitivity of 1:3 (tumour to contminting DNA sequences) using 25 ng of strting DNA templte (fig 3), nd 1:4 nd 1:5 using higher DNA concentrtions ( ng). Control DNA from norml cervicl mrgins did not revel ny ctivting muttions. Discussion We exmined 20 CIN III smples (19 HPV positive, one HPV negtive) nd 20 stge I nd II cervicl crcinoms (18 HPV positive, two HPV negtive) to ssess the prevlence of point muttions in H, K, nd N-rs oncogenes, using PCR/RFLP nlysis. This ssy overs rpid, non-rdioctive method of screening rs muttions in lrge study popultions. The optiml digestion conditions for RFLP nlysis were first estblished using positive control cell lines contining defined ctivting muttions. We were confidently ble to demonstrte mutnt DNA in 1:3 rtio in contminting norml DNA, even using 25 ng of strting DNA templte (fig 3). At higher strting DNA concentrtions, rtios of 1:4 were esily chieved. We identified n ctivting muttion t codon 12 H-rs in one HPV 16 positive stge I cervicl squmous cell crcinom. The surrounding norml ectocervicl mucos in this ptient did not contin ny ctivting muttion. No djcent CIN III ws identified in this cse. The findings re in keeping with those of Bos, 2 but re contrry to the findings of Riou et l, 12 in which muttions t codon 12 of H-rs were found in 24% of tumours t n dvnced stge. Additionlly 40% of tumours with muttions (in the Riou series), lso contined n llelic deletion t tht locus. Riou s dt suggest tht deletions nd muttions of H-rs gene occur in dvnced stges of cervicl crcinom. The tumours exmined in our study were predominntly stge I nd II diverent study group where diverent genetic events my be opertionl. Previously, Rumsby et l found low incidence of rs oncogene ctivtion in rnge of humn squmous cell crcinoms. 16 Hiorns et l screened series of nogenitl tumours for ctivting muttions of the rs oncogene fmily using the polymerse chin rection nd series of synthetic oligonucleotide probes 17 (n lterntive method to the ssy dopted in our study). Muttions were seen in only two cses (both K-rs codon 12), neither of which ws HPV ssocited. Their findings redily suggest tht rs ctivtion does not pper to be common event in the genesis of these tumours nd when it did occur it did not pper to coexist with HPV infection. This supports the findings of our study, in which the mjority of cses were HPV positive nd ctivting rs muttion negtive. It seems likely, therefore, tht in erly nogenitl neoplsi muttions t either codon 12 of H-rs nd K-rs in prticulr re uncommon events. Our dt in reltion to CIN III re in ccordnce with those of Le Vn et l, 26 who were unble to identify H-rs 12 muttions in cses of CIN I, II, nd III. However, Grendys et l hve recently demonstrted muttions in H, Ki, nd N-rs codon 61 in 24.2% of stge IB cervicl crcinoms, 27 contrsting with 5% (1/20) in our study. In conclusion, rs ctivtion does not pper to occur in conjunction with HPV infection, prticulrly of HPV 16 infected high grde cervicl intrepithelil neoplsi. In ddition, rs ctivtion is n infrequent event in erly squmous cell crcinom, lthough the interction of HPV 16 nd rs oncogenes in cellulr trnsformtion in vitro hs been shown. 28 This leds us to believe tht mny diverent cell types diver in their susceptibility to trnsformtion by such gents. On current dt, the postulted model of HPV linked crcinogenesis suggests mlfunctionl control of HPV trnscription s necessry component for neoplstic progression. It is lso cler, however, tht host gene ltertions re eqully necessry for HPV linked crcinogenesis to occur. 1 Mrshll CJ. Humn oncogenes. In: Weiss R, Teich N, Vrmus H, CoYn J,eds.RNA tumour viruses. Cold Spring Hrbor: Cold Spring Hrbor Press, 1985: Bos JL. The rs gene fmily nd humn crcinogenesis. Mutt Res 1988;195: Brbcid M. rs Genes. Annu Rev Biochem 1987;56: Gilmn AG. G proteins nd dul control of denylte cyclse. Cell 1984;36: Gibbs JB, Sigl IS, Poe M, et l. Intrinsic GTPse ctivity distinguishes norml nd oncogenic rs p 21 molecules. Proc Ntl Acd Sci USA 1984;81: Mnne V, Bekesi E, Kung HF. H-rs proteins exhibit GTPse ctivity: point muttions tht ctivte H-rs gene product result in decresed GTPse ctivity. Proc Ntl Acd Sci USA 1985;82: Wlter M, Clrk SG, Levinson AD. The oncogenic ctivtion of humn p21 rs by novel mechnism. Science 1986;233: Westwy D, PpkoV J, Moscovici C, et l. Identifiction of pro-virlly ctivted c-h-rs oncogene in n vin nephroblstom vi novel procedure: cdna cloning of chimeric virl host trnscript. EMBO J 1986;5: Pulciri S, Sntos E, Long LK, et l. rs Gene mplifiction nd mlignnt trnsformtion. Mol Cell Biol 1985;5: Cichutek K, Duesberg PH. Hrvey rs genes trnsform without mutnt codons pprently ctivted by trunction of 5' exon (exon-1). Proc Ntl Acd Sci USA 1986;83: Riou G, Brrois M, Sheng ZM, et l. Somtic deletions nd muttions of c-h-rs gene in humn cervicl cncers. Oncogene 1988;3: Riou G, Brrois M, Dutronquy V, et l. Presence of ppillomvirus DNA sequences, mplifiction of c-myc nd c-h-rs oncogenes nd enhnced expression of c-myc in crcinoms of the uterine cervix. Ppillomvirus: Moleculr nd Clinicl Aspects 1985; Agnntis NJ, Spndidos DA, Mher H, et l. Immunohistochemicl study of rs oncogene expression in endometril nd cervicl humn lesions. Eur J Gynecol Oncol 1988;9: Kitchener HC. Recent developments in viruses nd genetics in gynecologic cncer. Curr Opin Oncol 1990;2: Enomoto T, Inoue M, Perntoni AO, et l. K-rs ctivtion in neoplsms of the humn femle reproductive trct. Cncer Res 1990;50: Rumsby G, Crter RL, Gusterson BA. Low incidence of rs oncogene ctivtion in humn squmous cell crcinoms. Br J Cncer 1990;61: Hiorns LR, Scholefield JH, Plmer JG, et l. Ki-rs oncogene muttions in non-hpv ssocited nl crcinom. J Pthol 1990;161: Victor T, Du Toit R, Jordn AM, et l. No evidence for point muttions in codons 12, 13, 61 of the rs gene in high incidence re for esophgel nd gstric cncers. Cncer Res 1990;50:
7 582 O Lery, Lnders, Silv, et l 19 O Lery JJ, Browne G, Crowley M, et l. Non-isotopic detection of DNA in tissues. In: Herrington CS, Levy BR, eds. In-situ hybridistion. A prcticl pproch. Oxford: Oxford University Press, 1994: Arends MJ, Donldson YK, Duvll E, et l. HPV in full thickness cervicl biopsies: high prevlence in CIN2 nd CIN3 detected by sensitive PCR method. J Pthol 1991; 165: Vn den Brule AFC, Snijders PJF, Gordijn RLJ, et l. Generl primer-medited polymerse chin rection permits the detection of sequenced nd still unsequenced humn ppillomvirus genotypes in cervicl scrpes nd crcinoms. Int J Cncer 1990;45: Khn SM, Jing W, Weinstein IB. Rpid non-rdioctive detection of rs oncogenes in humn tumours. Amplifictions: A Forum for PCR Users 1990;4: Mitsudomi T, Villet J, Mulshine JL, et l. Muttion of rs genes distinguish subset of non- smll-cell lung cncer cell lines from smll-cell lung cncer cell lines. Oncogene 1991;6: Kumr K, Dunn LL. Designed dignostic restriction frgment length polymorphisms for the detection of point muttions in rs oncogenes. Oncogene Res 1989;4: Milici A, Blich M, Murphy E, et l. c-k-rs codon 12 GGT- CGT point muttion. An infrequent event in humn lung cncer. Biochem Biophys Res Commun 1986;140: Le Vn L, Stoerker J, Rinehrt CA, et l. H-rs codon 12 muttion in cervicl dysplsi. Gynecol Oncol 1993;49: Grendys EC, Brnes WA, Weitzel J, et l. Identifiction of H, K nd N-rs point muttions in stge IB cervicl crcinom. Gynecol Oncol 1997;65: Mtlshewski G, Schneider J, Bnks L, et l. Humn ppillomvirus type 16 DNA co-opertes with ctivted rs in trnsforming primry cells. EMBO J 1987;6: J Clin Pthol: first published s /jcp on 1 August Downloded from on 5 September 2018 by guest. Protected by copyright.
Comparison of three simple methods for the
J. clin. Pth. (1967), 2, 5 Comprison of three simple methods for the ssessment of 'free' thyroid hormone T. M. D. GIMLETTE1 From the Rdio-Isotope Lbortory, St. Thoms's Hospitl, London SYNOPSIS A dilysis
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationNucleolar organiser regions (AgNORS) in anal intraepithelial neoplasia and invasive anal
J Clin Pthol 1992;5:889893 Deprtment of Surgery, Clinicl Sciences Centre, Northern Generl Hospitl, Sheffield S5 7AU O A Ogunbiyi J H Scholefield K Rogers Deprtment of Obstetrics nd Gynecology F Shrp R
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationBENIGN ulceration along the greater curvature of the pars media of the
BENIGN ULCERS OF THE GREATER CURVATURE OF THE STOMACH Report of Two Cses CHARLES H. BROWN, M.D. Deprtment of Gstroenterology nd ANTHONY D. INTRIERE, M.D.* BENIGN ulcertion long the greter curvture of the
More informationphosphatase isoenzyme activity: estimation of
J Clin Pthol 1988;41:202-206 Quntittive method for determining serum lkline phosphtse isoenzyme ctivity: estimtion of intestinl component M J PEAKE, M PEJAKOVIC, G H WHITE From the Deprtment ofbiochemistry
More informationEvaluation of the detection of 14 high-risk human papillomaviruses with HPV 16 and HPV 18 genotyping for cervical cancer screening
1332 Evlution of the detection of 14 high-risk humn ppillomviruses with HPV 16 nd HPV 18 genotyping for cervicl cncer screening MEI-LU BIAN, JIAO-YING CHENG, LI MA, XIAO CONG, JUN LIU, YING CHEN nd XI
More informationComparative effectiveness of the tumour diagnostics,
Gut, 1987, 28, 323-329 Comprtive effectiveness of the tumour dignostics, C 19-9, C 125 nd crcinoembryonic ntigen in ptients with diseses of the digestive system K SKMOTO, Y HG, R YOSHIMR, H GMI, Y YOKOYM,
More informationThe expression of p73 is increased in lung cancer, independent of p53 gene alteration
Article no. bjoc.1999.0572 The expression of p73 is incresed in lung cncer, independent of p53 gene ltertion Y Tokuchi 1, T Hshimoto 1, Y Kobyshi 2, M Hyshi 1, K Nishid 2, S Hyshi 1, K Imi 1, K Nkchi 1,
More information27 June Bmnly L. WALTER ET AL.: RESPONSE OF CERVICAL CANCERS TO IRRADIATION
27 June 1964 Bmnly MEDICAL JOURNAL L. WALTER ET AL.: RESPONSE OF CERVICAL CANCERS TO IRRADIATION x 1,638.) FIG. 2.-Foci of sme tumour s in Fig. 1 contining vible tumour cells with scnty cytoplsm, reltively
More informationOverview: The Cellular Internet. General Biology. 7. Cell Communication & Signalling
Course o: BG00 Credits:.00 Generl Biology Overview: The Cellulr Internet Cell-to-cell communiction is bsolutely essentil for multicellulr orgnisms Biologists hve discovered some universl mechnisms of cellulr
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationSUPPLEMENTARY INFORMATION
TM TM tip link horizontl top connectors 1 leucine-rich (21 %) otoncorin-like 1809 ntigenic peptides B D signl peptide hydrophoic segment proline/threonine-rich (79 %) Supplementry Figure 1. () The outer
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationUnique roles of the unfolded protein response pathway in fungal. development and differentiation. Kwang Woo Jung, Yee Seul So, & Yong Sun Bahn *
Supplementry Informtion Unique roles of the unfolded protein response pthwy in fungl development nd differentition Kwng Woo Jung, Yee Seul So, & Yong Sun Bhn * Contents Supplementry Figure S1 Supplementry
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationAnalysis of Regulatory of Interrelated Activity of Hepatocyte and Hepatitis B Viruses
Interntionl Journl of Biomedicl Mterils Reserch 8 6(): -7 http://www.sciencepublishinggroup.com/j/ijbmr doi:.648/j.ijbmr.86. ISSN: 33-756 (Print) ISSN: 33-7579 (Online) Anlysis of Regultory of Interrelted
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationJournal of Hainan Medical University.
132 Journl of Hinn Medicl University 2017; 23(11): 132-136 Journl of Hinn Medicl University http://www.hnykdxxb.com Assessment of the efficcy nd sfety of bronchil rtery perfusion chemotherpy combined with
More informationEfficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis
Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell
More informationCHEST. Thyroid transcription factor 1 (TTF-1) is an important. Original Research
CHEST Originl Reserch Clinicl Significnce of Thyroid Trnscription Fctor-1 in Advnced Lung Adenocrcinom Under Epiderml Growth Fctor Receptor Tyrosine Kinse Inhibitor Tretment Kuei-Pin Chung, MD; Yen-Tsung
More informationC reactive protein: an aid to assessment and
C rective protein: n id to ssessment nd monitoring of cute pncretitis J Clin Pthol 1984;37:27-211 AD MAYR,* MJ McMAHON,* MARGART BOWN,t H COOPRt From the *University Deprtment ofsurgery, Generl Infrmry,
More informationA comparative study on the extraction of membranebound bilirubin from erythrocyte membranes using various methods
J. Biochem. Biophys. Methods 39 (1999) 39 45 A comprtive study on the extrction of membrnebound bilirubin from erythrocyte membrnes using vrious methods * Sd Tyyb, Mohmmd Kutub Ali Interdisciplinry Biotechnology
More informationLung cancer is the leading cause of cancer death worldwide, EGFR Mutation and Brain Metastasis in Pulmonary Adenocarcinomas
Originl Article EGFR Muttion nd Brin Metstsis in Pulmonry Adenocrcinoms Dong-Yeop Shin, MD,* Im Il N, MD,* Cheol Hyeon Kim, MD, PhD, Sunhoo Prk, MD, PhD, HeeJong Bek, MD, PhD, nd Sung Hyun Yng, MD, PhD*
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationSupplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationS Majumdar and EP Diamandis
1999 Cncer Reserch Cmpign Article no. bjoc.1998.0254 The promoter nd the enhncer region of the KLK 3 (prostte specific ntigen) gene is frequently mutted in brest tumours nd in brest crcinom cell lines
More informationSupplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
More informationReview TEACHING FOR GENERALIZATION & MAINTENANCE
Gols By the end of clss, you should be ble to: Explin wht generliztion is, why it is criticl for techers to know how to tech so tht it occurs, nd give n exmple of it from your own experience in the clssroom
More informationPaper-based skin patch for the diagnostic screening of cystic fibrosis
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 2015 Supplementry informtion Pper-bsed skin ptch for the dignostic screening of cystic fibrosis Xun Mu,*
More informationMeasurement of Enzymatic Activity and by Radioimmunoassay
CLIN. CHEM. 23/1, 95-99 (1977) Comprison of Humn Prosttic Acid Phosphtse by Mesurement of Enzymtic Activity nd by Rdioimmunossy Andrs G. Foti,1 Hrvey Herschmn,2 nd J. Fenimore Cooper3 We compred results
More informationSUPPLEMENTARY INFORMATION
Supplementry Tble 1. Sttistics of dt sets nd structure refinement PYL1 po PYL2/ABA PYL2 po PYL2/ABA/HAB1 PDB code 3KAY 3KAZ 3KB0 3KB3 Dt collection APS bem line 21-ID 21-ID 21-ID 21-ID Spce group P6 5
More informationEsophageal carcinoma is the eighth most common cancer
ORIGINAL ARTICLE Tumor-Strom Rtio Is n Independent Predictor for Survivl in Esophgel Squmous Cell Crcinom Ki Wng, MD,* Wei M, MD,* Jinbo Wng, MD,* Ling Yu, MD, Xiomei Zhng, MD, Zhenbo Wng, MD, Bingxu Tn,
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationDifferentiation of malignant from normal and reactive mesothelial cells by the argyrophil technique for
Thorx 1988;43:366-370 Differentition of mlignnt from norml nd rective mesothelil cells by the rgyrophil technique for nucleolr orgniser region ssocited proteins JON G AYRES, JOHN G CROCKER, NCHOLAS Q SKLBECK
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationPreferential loss of a polymorphic RIZ allele in human hepatocellular carcinoma
doi: 10.1054/ bjoc.2000.1667, vilble online t http://www.idelibrry.com on http://www.bjcncer.com Preferentil loss of polymorphic RIZ llele in humn heptocellulr crcinom W Fng 1, Z Pio 1, IM Buyse 1#, D
More informationrticle Fig. 1. Lung tumor iossys using heterozygous -deficient mice., Experimentl design.,d, Lung tumor multiplicity in urethne- nd MNU-treted mice, r
Wildtype cn inhiit lung crcinogenesis in mice rticle Zhongqiu Zhng 1, Yin Wng 2, Hris G. Vikis 3, Leis Johnson 4, Gongjie Liu 1, Jie Li 1, Mrshll W. Anderson 5, Roert C. Sills 6, H.L. Hong 6, Theodor R.
More informationPlaque Assay of Avian Sarcoma Viruses Using Casein
JOURNAL OF VIROLOGY, Sept. 1975, p. 707-711 Copyright 0 1975 Americn Society for Microbiology Vol. 16, No. 3 Printed in U.S.A. Plque Assy of Avin Srcom Viruses Using Csein PIERO C. BALDUZZI*l AND HELEN
More informationORIGINAL ARTICLE ABSTRACT INTRODUCTION
ORIGINAL ARTICLE LOSS OF EPCAM STAINING CORRELATES WITH POOR OUTCOME IN CRC, Wng et l. Reduction in membrnous immunohistochemicl stining for the intrcellulr domin of epithelil cell dhesion molecule correltes
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationRapid communications Increased detection of Mycoplasma pneumoniae infection in children in England and Wales, October 2011 to January 2012
Rpid communictions Incresed detection of Mycoplsm pneumonie infection in children in Englnd nd Wles, October 2011 to Jnury 2012 V J Chlker (vicki.chlker@hp.org.uk) 1, T Stocki 1, D Litt 1, A Berminghm
More informationGeneral Microscopic Changes
Generl Microscopic Chnges 2 This chpter covers collection of microscopic chnges tht lck dignostic specificity ut occur in different specific diseses, s will ecome pprent in susequent chpters. Almost ll
More informationInduction of Lactose Transport in Escherichia coli During the Absence of Phospholipid Synthesis
JOURNAL OF BACTERIOLOGY, Aug. 1975, p. 492-496 Copyright 1975 Americn Society for Microbiology Vol. 123, No. 2 Printed in U.S.A. Induction of Lctose Trnsport in Escherichi coli During the Absence of Phospholipid
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationInfluence of the vagus nerve upon the reflex control of the lower oesophageal sphincter
Gut, 1984, 2, 23-28 Influence of the vgus nerve upon the reflex control of the lower oesophgel sphincter L OGILVIE* ND M TKINSON From University Hospitl, Queen's Medicl Centre, Nottinghm SUMMRY In 24 control
More informationCLPNA Pressure Ulcers ecourse: Module 5.3 Quiz I page 1
CLPNA Pressure Ulcers ecourse: Module 5.3 Quiz I 1. Clensing is the process of clening nd sterilizing pressure ulcer wound. 2. How often should pressure ulcer wound nd surrounding skin be clensed?. Every
More informationAssociation between LAPTM4B gene polymorphism and susceptibility to and prognosis of diffuse large B cell lymphoma
264 Assocition between LAPTM4B gene polymorphism nd susceptibility to nd prognosis of diffuse lrge B cell lymphom HUIRONG DING 1*, XIAOJING CHENG 2*, NING DING 3*, ZHIHUA TIAN 1, JUN ZHU 3, CHUNLIAN ZHOU
More informationSignificance of Silver Binding Nucleolar Organizer Regions in Oral Squamous Cell Carcinomas
Originl Article DOI: 10.17354/ijss/2016/147 Significnce of Silver Binding Nucleolr Orgnizer Regions in Orl Squmous Cell Crcinoms Ritu Shrm 1, Gurv Kumr 2 1 Assistnt Professor, Deprtment of Pthology, Hind
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationHEMOGLOBIN STANDARDS*
HEMOGLOBIN STANDARDS* RUSSELL L. HADEN Clevelnd Clinic, Clevelnd, Ohio Estimtions of hemoglobin often re unstisfctory to the lbortory worker nd the reports my be confusing to the clinicin. Unfortuntely,
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More informationRESEARCH ARTICLE. Wen Li 1, Jing Deng 2 *, Shuang-Shuang Wang 1, Liang Ma 1, Jiang Pei 1, Xiao-Xi Zeng 1, Jian-Xin Tang 1. Abstract.
DOI:http://dx.doi.org/10.7314/APJCP.2014.15.24.10937 Methyltion of the RAR-β Gene nd Cigrette Smoking in NSCLC in Southern-Centrl Chinese RESEARCH ARTICLE Assocition of Methyltion of the RAR-β Gene with
More informationLipase and Pancreatic Amylase Activities in Tissues and in Patients with Hyperamylasemia
CLINICAL CHEMISTRY Originl Article Lipse nd Pncretic Amylse Activities in Tissues nd in Ptients with Hypermylsemi FRED APPLE, PH.D, PETER BENSON, M.D., LYNNE PREESE, MT, M.B.A., STEVEN EASTEP, M.D., LAURA
More informationReduced expression of cytokeratin 4 and 13 is a valuable marker for histologic grading of esophageal squamous intraepithelial neoplasia
J Med Dent Sci 2012; 59: 17-28 Originl Article Reduced expression of cytokertin 4 nd 13 is vlule mrker for histologic grding of esophgel squmous intrepithelil neoplsi Mski Tkshim 1), Hiroshi Kwchi 1),
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationPotential of In Situ Hybridization for Early Diagnosis of Productive Cytomegalovirus Infection
JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 1988, p. 2536-2540 0095-1137/88/122536-05$02.00/0 Copyright 1988, Americn Society for Microbiology Vol. 26, No. 12 Potentil of In Situ Hybridiztion for Erly Dignosis
More informationGenetic polymorphisms in the TERT-CLPTM1L region and lung cancer susceptibility in Chinese males
1588 Genetic polymorphisms in the TERT-CLPTM1L region nd lung cncer susceptibility in Chinese mles XUYANG XIAO 1 nd WUBIN HE 2 1 Deprtment of Thorcic Surgery nd 2 Biologicl Therpy Center Lbortory, The
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationOriginal Article Prognostic and clinicopathologic significance of AEG-1/MTDH and E-cadherin expression in human gallbladder carcinoma
Int J Clin Exp Pthol 2018;11(12):6025-6031 www.ijcep.com /ISSN:1936-2625/IJCEP0086349 Originl Article Prognostic nd clinicopthologic significnce of AEG-1/MTDH nd E-cdherin expression in humn gllbldder
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationchapter 3. Squamous intraepithelial lesions: cytology histology correlation
chpter 3. Squmous intrepithelil lesions: cytology histology correltion CHAPTER 1 This chpter discusses the nturl history of cervicl precncer, HPV nd oncogenesis, cytology nomenclture, nd the cytologicl
More informationEstimating the impact of the 2009 influenza A(H1N1) pandemic on mortality in the elderly in Navarre, Spain
Rpid communictions Estimting the impct of the influenz pndemic on mortlity in the elderly in Nvrre, Spin J Cstill (jcstilc@nvrr.es) 1, J Etxeberri 1, E Ardnz 1, Y Floristán 1, R López Escudero 1, M Guevr
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationRheumatoid-susceptible alleles of HLA-DRB 1 are genetically recessive to non-susceptible alleles in the progression of bone destruction in the wrists
Annls of the Rheumtic Diseses 1994; 53: 587-592 587 Deprtment of Orthopedic Surgery, Knsi Medicl University, Otokoym Hospitl, Kyoto, Jpn Y Tod Y Mori Deprtment of Orthopedic Surgery, Knsi Medicl University,
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationSignificance of Expression of TGF- in Pulmonary Metastasis in Non-small Cell Lung Cancer Tissues
Originl Article Significnce of Expression of in Pulmonry Metstsis in Non-smll Cell Lung Cncer Tissues Hisshi Sji, Hruhiko Nkmur, Idiris Awut, Norihito Kwski, Msru Hgiwr, Akihiko Ogt, Mkoto Hosk, Tkmoto
More informationDendritic cells engineered to secrete anti-dcr3 antibody augment cytotoxic T lymphocyte response against pancreatic cancer in vitro
Submit Mnuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.spx DOI: 10.3748/wjg.v23.i5.817 World J Gstroenterol 2017 Februry 7; 23(5): 817-829 ISSN 1007-9327 (print) ISSN
More informationSalmonella typhi from Blood
JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 1978, p. 122-126 0095-1137/78/0007-0122$02.00/0 Copyright 1978 Americn Society for Microbiology Lbortory nd Clinicl Investigtion of Recovery of Slmonell typhi from
More informationUlinastatin reduces urinary sepsis related inflammation by upregulating IL 10 and downregulating TNF α levels
MOLECULAR MEDICINE REPORTS 8: 29-34, 2013 Ulinsttin reduces urinry sepsis relted inflmmtion by upregulting IL 10 nd downregulting TNF α levels XIAN CHEN 1*, YI WANG 1*, HONGMEI LUO 2, ZHIGANG LUO 1, LISHA
More informationScientific research on the biological value of olive oil
Scientific reserch on the biologicl vlue olive oil Cov F.G. Ally M. (ed.). L' économie de l' olivier Pr : CIHEAM Options Méditerrnéennes : Série Etudes; n. 1988-V 1988 pges 149-152 Article vilble on le
More informationPreliminary and Short Report
TEE JOURNAL OF INVESTIGATIVE DREMATOLOOT Copyright 1967 by The Willims & Wilkins Co. Vol. 48 No. 3 Printed in U.S.A. Preliminry nd Short Report PARTICLES IN THE CISTERNAE OF THE ENDOPLASMIC RETICULUM OF
More informationa) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationthalassaemia major, treated with long term subcutaneous desferrioxamine
Iron stte nd heptic disese in ptients with thlssemi mjor, treted with long term subcutneous desferrioxmine J Clin Pthol 1987;4:1353-1359 BEATRIX WONKE,t A V HOFFBRAND,* D M FLYNN,$ M A ALDOURI,* MARTINE
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationin the above manner contained 105 to 106 plaqueforming virus preparation was used without further manipulation
INFECTION AND IMMUNITY, June 1978, p. 660-664 0019-9567/78/0020-tE60$02.00/0 Copyright 1978 Americn Society for Microbiology Vol. 20, No. 3 Printed in U.S.A. Enzyme-Linked Immunosorbent Assy for Mesurement
More informationSPHINGOLIPIDS. of synthetic ceramides. Gas-liquid chromatography-mass spectrometry. GL C-Mass Spectrometry
Gs-liquid chromtogrphy-mss spectrometry of synthetic cermides BENGT SAMUELSSON nd KARN SAMUELSSON Deprtment of Medicl Chemistry, Royl Veterinry College; Deprtment of Neurology, Krolinsk Sjukhuset; nd Lbortory
More informationB. Koven 1*, E. Gisbert 2, O. Nixon 1, I. Meiri-Ashkenazi 1, A. Gaon 1, M.M. Solovyev 3,4, A. Tandler 1, H. Rosenfeld 1
DESIGNING WEANING DIETS BASED ON THE ONTOGENY OF DIGESTIVE TRACT ENZYME ACTIVITY DURING THE CARNIVOROUS-OMNIVOROUS TRANSITION IN GREY MULLET (MUGIL CEPHALUS) JUVENILES B. Koven 1*, E. Gisert 2, O. Nixon
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationELDAWY ET AL.: JOURNAL OF AOAC INTERNATIONAL VOL. 86, NO. 4,
ELDAWY ET AL.: JOURNAL OF AOAC INTERNATIONAL VOL. 86, NO. 4, 2003 675 DRUGS, COSMETICS, FORENSIC SCIENCES Determintion of Chlorphenirmine Mlete nd Tincture Ipecc in Dosge Form by Liquid Chromtogrphy with
More informationEfficacy of Sonidegib in Patients With Metastatic BCC (mbcc)
AAD 216 eposter 3368 Efficcy of Sonidegib in Ptients With Metsttic BCC (mbcc) Colin Morton, 1 Michel Migden, 2 Tingting Yi, 3 Mnish Mone, 3 Dlil Sellmi, 3 Reinhrd Dummer 4 1 Stirling Community Hospitl,
More informationEffects of blueberries on migration, invasion, proliferation, the cell cycle and apoptosis in hepatocellular carcinoma cells
BIOMEDICAL REPORTS 5: 579-584, 2016 Effects of blueberries on migrtion, invsion, prolifertion, the cell cycle nd poptosis in heptocellulr crcinom cells WEI ZHAN 1*, XIN LIAO 2*, LEI YU 3, TIAN TIAN 3,
More informationA LAYOUT-AWARE APPROACH FOR IMPROVING LOCALIZED SWITCHING TO DETECT HARDWARE TROJANS IN INTEGRATED CIRCUITS
A LAYOUT-AWARE APPROACH FOR IMPROVING LOCALIZED SWITCHING TO DETECT HARDWARE TROJANS IN INTEGRATED CIRCUITS Hssn Slmni, Mohmmd Tehrnipoor ECE Deprtment University of Connecticut {slmni h,tehrni}@engr.uconn.edu
More information