Molecular analysis of ras oncogenes in CIN III and in stage I and II invasive squamous cell carcinoma of the uterine cervix

Transcription

1 576 Deprtment of Pthology, Cornell University Medicl College, New York, USA J J O Lery I Silv V Uhlmnn K Luttich Deprtment of Pthology, University of SheYeld, SheYeld, UK R J Lnders Deprtment of Pthology, University College Cork, Irelnd M Crowley I Hely Correspondence to: DrJJO Lery,Deprtment of Pthology, The Coombe Women s Hospitl, Dublin, Republic of Irelnd. Accepted for publiction 5 Februry 1998 Moleculr nlysis of rs oncogenes in CIN III nd in stge I nd II invsive squmous cell crcinom of the uterine cervix J J O Lery, R J Lnders, I Silv, V Uhlmnn, M Crowley, I Hely, K Luttich Abstrct Aim To exmine the prevlence of genitl type humn ppillom virus (HPV) nd muttions t codons 12, 13, nd 61 in H, Ki, nd N-rs in CIN III nd erly invsive squmous cell crcinoms of the cervix. Methods Prevlence of HPV ws exmined in 20 CIN III nd 20 stge I nd II cervicl crcinoms, using non-isotopic in situ hybridistion (NISH) nd solution phse polymerse chin rection (PCR). In ddition, muttions t codons 12, 13, nd 61 were exmined in H, Ki, nd N-rs in these CIN III nd erly invsive squmous cell crcinoms, to ssess the prevlence of rs gene point muttions nd to define where in the pthobiology of squmous cell crcinom such events occur. A non-isotopic PCR/RFLP ssy ws used to define these muttions. Results Of the 20 CIN IIIs exmined, 19 contined HPV 16 DNA sequences by PCR nd NISH. Dul infection ws not uncovered. The 20 erly (stge I nd II) invsive squmous cell crcinoms showed predominnt HPV 16 positivity (17/20), with one cse HPV 18 positive, confirmed on PCR nd NISH. Activting muttions were not identified in ny of the CIN III cses. Only one stge I, HPV 16 positive crcinom showed n ctivting muttion in H-rs codon 12, which ws not present in djcent norml ectocervicl mucos from the sme ptient. Conclusions rs Activtion does not pper to occur in conjunction with HPV infection, prticulrly of HPV 16 infected high grde cervicl intrepithelil neoplsi, or to occur commonly in erly cervicl squmous cell crcinom. The postulted model of HPV linked crcinogenesis suggests mlfunctionl control of virl trnscription s necessry component of neoplstic progression. It is lso cler tht host gene ltertions re eqully necessry for HPV linked crcinogenesis to occur. (J Clin Pthol 1998;51: ) Keywords: rs; humn ppillom virus; cervicl crcinom; CIN III There re three members of the rs oncogene fmily. N-rs is locted on chromosome 1 (1p21p32), H-rs on chromosome 11 (11p15.1-p15.5), nd K-rs on chromosome 12 (12p12.1-pter). 1 Ech of these three genes J Clin Pthol 1998;51: contins four coding exons which specify homologous proteins of 21 kd nd 5' non-coding exon. 2 In ddition, two pseudogenes, H-rs-2 nd K-rs-1, hve been identified nd chrcterised in rts nd humns 3 ; these re mpped to the X chromosome to the 6p12-p23 locus. 3 The protein encoded by the rs genes binds gunosine triphosphte (GTP) nd gunosine diphosphte (GDP) with high Ynity nd re known to possess GTPse ctivity. 2 Such rs proteins shre biochemicl properties with G proteins, which re known to ply role in signl trnsduction pthwys from membrne bound receptors to denylte cyclse. 4 In fct, certin domins of the rs proteins show significnt sequence homology with the α subunit of G proteins such s G 5, which is known to ctivte denylte cyclse directly in response to β drenergic stimuli, mking rs proteins involved in signl trnsduction. rs Proteins probbly exist in equilibrium in the cell between n ctive nd n inctive stge. Inctive forms bind GDP. rs Proteins will remin inctive until they receive stimulus from nother protein/receptor upstrem of puttive pthwy of signl trnsduction. Such stimulus results in the exchnge of GDP for GTP, followed by conformtionl ltertion of inctive rs to ctive rs. Once interction between the ctive rs proteins nd the effector hs tken plce, immedite dectivtion would occur. This is chieved by the intrinsic GTPse ctivity ctlysing the hydrolysis of GTP nd thus returning the rs proteins to the inctive GDP bound stte. Muttion occurring in the rs genes shifts the norml equilibrium to the ctive form. Such stbilistion phenomen would result in continuous signl trnsduction nd subsequently mlignnt trnsformtion. Theoreticlly, rs stbilistion cn be chieved by muttions tht inhibit the intrinsic GTPse ctivity of rs proteins, increse the exchnge rte between GDP nd GTP, or induce n ctive conformtionl chnge tht does not require binding of gunine nucleotides. Indeed, norml rs genes if overexpressed lso induce mlignnt trnsformtion by producing mny molecules in the GTP bound ctive stte. Experimentl evidence now indictes tht inhibition of GTPse ctivity is the preferred mechnism of ctivtion of rs oncogenes. 5 6 Activtion of rs genes my occur through (1) muttions in the coding regions nd (2) enhnced expression. Muttions in the three rs oncogenes (H-rs, K-rs, nd N-rs) re

2 Moleculr nlysis of rs oncogenes in crcinom of the cervix 577 Tble 1 Summry of rs gene ssys for H-rs known to occur in the codons for mino cids 12, 13, nd 61. Additionlly, when H-rs is exposed to bisulphite prticulr muttions in codons 12, 13, 59, nd 63 result, which shows tht codons 59 nd 63 re lso potentil trgets for ctivting muttions. 2 Besides these two sites, muttions in codons 116 nd 119 cn lso ctivte the rs gene. 7 Enhnced expression cn be obtined by the insertion of strong promoter or enhncer in the vicinity of the rs gene, 2 8 by mplifiction of the norml proto-oncogene, 9 or by deletion of the first (non-coding) exon. 10 Muttions t codons 12, 13, nd 61 re likely to led to loss of GTPse ctivity which results in constitutively ctivted rs oncogene. Somtic deletions nd muttions of H-rs gene in humn cervicl cncers hve been described by Riou et l, 11 who exmined the c-h-rs-1 locus in cervicl cncers nd described loss of one llele t this locus in 36% of heterozygous tumours nd muttion on codon 12 in 24% of tumours t n dvnced stge. These investigtors lso demonstrted mplifiction of c-myc nd H-rs. 12 In ddition, incresed expression of the rs p21 gene hs been found in cervicl crcinom, using the Y monoclonl ntibody, 13 showing higher stining intensity in mlignnt tumour cells thn in benign or premlignnt lesions. It hs been suggested tht serologicl testing for p21 my hve potentil for monitoring disese ctivity in ptients with cervicl crcinom. 14 H-rs point muttions hve been implicted in the pthogenesis of cervicl neoplsi. In contrst, lrge study of K-rs ctivtion in neoplsms of the humn femle reproductive trct did not show ny point muttionl ctivity in cervicl crcinoms. 15 Interestingly, low incidence of rs oncogene ctivtion in humn squmous cell crcinoms from other sites hs been reported by Rumsby et l. 16 In nogenitl neoplsi, muttions of K-rs t codon 12 hve been shown in nl crcinoms not infected with humn ppillom virus (HPV). Hiorns et l suggest tht rs ctivtion does not pper to be common event Frgment size Gene Enzyme Undigested Mutnt Norml H-rs-12 Msp1 (CCGG) H5': 5'GAGACCCTGTAGGAGGACCC3' H3': 5'GGGTGCTGAGACGAGGGACT3' H-rs-13 HphI (GGTGA) b (10) H12S: 5'GCAGGAGACCCTGTAGGAGGAC3' H13A Hph: 5'GTCAGCGCACTCTTGCCCTCA3' H-rs-61 AlwNI b (17) (CAGNNNCTG) Nested PCR: H-61S: 5'ATGAGAGGTACCAGGGAGAG3' H-61A: 5'TCACGGGGTTCACCTGTACT3' H-61AAlw: 5'CGCATGGCGCTGTACAGCTC3'* *Mismtched nucleotides in the primers re underlined. Khn et l (reference 22). b MspI from Gibco BRL; HpHI from New Englnd Biolbs; AlwNI from Sigm. in the genesis of such tumours nd if it does occur it does not pper to cooperte with HPV. 17 Another common HPV ssocited tumour, oesophgel crcinom, hs lso been exmined for point muttions t codons 12, 13, nd 61 of the rs oncogenes. Victor et l filed to show ny evidence of muttions in these codons in squmous cell crcinoms of the oesophgus in South Afric. 18 In this study, we exmine muttions in these codons in H, Ki, nd N-rs in cervicl intrepithelil neoplsi (CIN) grde III nd erly invsive squmous cell crcinoms of the cervix, to ssess the prevlence of such muttions nd to exmine where in the pthobiology of squmous cell crcinom such events occur. Methods MATERIALS Archivl pryn wx embedded tissues of 20 CIN III nd 20 stge I nd II invsive squmous cell crcinoms were retrieved from the files of the deprtment of pthology, University College Cork, Irelnd. Six of the crcinom group hd coexistent CIN III in the resection specimen. Control histologiclly norml ectocervicl tissue ws exmined in lesions (where possible) in order to ssess the prevlence of genotypic geogrphicl chnge in djcent epithelium. HPV DNA IN SITU HYBRIDISATION Three 5 µm sections (selected from three diverent res of the tumour) were cut onto APES coted glss slides (PH106, C A Hendley, Essex, UK). In ddition, two res from the included cervix were lso exmined. Tissue dewxing ws crried out using xylene nd rehydrtion through grded lcohol series. Proteolytic digestion ws crried out using 0.5 mg/ml proteinse K in proteinse K buver (50 mm Tris HCl, ph mM EDTA) t 37 C for 10 minutes. For lkline phosphtse detection, slides were immersed in 20% (vol/vol) queous cetic cid t 4 C for 15 seconds. For peroxidse detection, slides were immersed in 3% sodium zide/hydrogen peroxide to bolish endogenous peroxidse ctivity. Slides were then wshed in phosphte buvered sline for five minutes. A postfixtion step ws not crried out. Dehydrtion of the sections then took plce through grded lcohols to wter. Cloned HPV probes (6, 11, 16, 18, 31, 33) (genitl types; gifts of Hrld Zur Husen) were lbelled with biotin or digoxigenin using stndrd nick trnsltion protocol. 19 Probes were initilly prepred t concentrtion of 200 ng/ml. The hybridistion buver contined (2 SSC (NCl/sodium citrte), 5% dextrn sulphte, 0.2% dried milk powder contining no vegetble extrcts, nd 50% formmide). Approximtely ng of the pproprite probe in the hybridistion buver ws pplied to the centre of ech well on the PH106 slides. Hybridistion ws crried out s previously described. 12

3 578 O Lery, Lnders, Silv, et l Tble 2 Summry of rs gene ssys for K-rs Frgment size Gene Enzyme Undigested Mutnt Norml K-rs-12 T Bst NI (CC GG) b A K12S1: 5'ACTGAATATAAACTTGTGGTAGTTGGACCT3' K12A1: 5'TCAAAGAATGGTCCTGGAAC3' K13 (sp) Hph I (GGTGA) c K12S1: 5'ACTGAATATAAACTTGTGGTAGTTGGACCT3' K12A1: 5'TCAAAGAATGGTCCTGGAAC3' K-rs 13 He III (GGCC) c (25) K12S2: 5'CATGTTCTAATATAGTCACA3' K13AHe: 5'TATCGTCAAGGCACTCTTGCCTAGG3' K-rs 61 Bcl I (TGATCA) c (19) K61SBcl: 5'GGATATTCTCGACACAGCTGAT3' K61A: 5'AATTACTCCTTAATGTCAGC3' K61SEr: K61A: Er I (GAAGAG) c (25) 5'GGATATTCTCGACACAGCAGGTGA3' 5'AATTACTCCTTAATGTCAGC3' *Mismtched nucleotides in the primers re underlined. See text for detils (not ll mutnts re uncut). b Khn et l (reference 22). c Bst NI, He III, Bcl I from Sigm; Hph I, Er I from New Englnd Biolbs. Tble 3 Summry of rs gene ssys for N-rs Frgment size Gene Enzyme Undigested Mutnt Norml N-rs 12 (method 1) Hph I (GGTGA) (11) N12S1: 5'CTGGTGTGAAATGACTGAG3' N12AHph: 5'TGTCAGTGCGCTTTTCCCAACATC3' N-rs 12 (method 2) BspMI (GCAGGT) b N12S2: 5'ACTGAGTACAAACTGGTGGTGGTTCCAGCA3' N12A2: 5'GGGCTACCTGCGGGCCTCCACTCTATGG3' N-rs 13 HphI (GGTGA) c (23) N12S1: 5'CTGGTGTGAAATGACTGAG3' N13AHph: 5'GATTAGCTGGATTGTCAGTGCGCTTTTCCCATC3' N-rs 61 MscI (TGGCCA) (23) N61SBl: 5'TTGGACATACTGGATACAGCTGGC3' N61A: 5'GTTAATATCCGCAAATGACTTGC3' *Mismtched nucleotides in the primers re underlined. bo Lery et l. c O Lery, nd Mitsudomi et l (reference 22). Hph I, BspMI from New Englnd Biolbs; MscI from Sigm. Following hybridistion, medium stringency wshings were initilly pplied using 2 SSC t 60 C for 20 minutes, followed by 0.2 SSC for 42 C t 20 minutes, then 0.1 SSC t room temperture for five minutes nd 2 SSC t room temperture for five minutes. Higher stringency wshes included 0.2 SSC t 55 C nd 60 C for 10 minutes nd 0.1 SSC t room temperture, 42 C, nd 55 C. The hybridistion signl ws detected using one step, two step, or three step techniques s described previously. 12 Colorimetric detection ws chieved using n NBT/ BCIP substrte for lkline phosphtse or AEC (Zymed kit for peroxidse; Zymed, Cliforni, USA). 12 Sections were counterstined with 2% methyl green for lkline phosphtse detection or hemtoxylin for the peroxidse detection system. Tissue controls for non-isotopic in situ hybridistion (NISH) included HPV positive cervicl wrts nd myocrdium (negtive for HPV). Rection controls included hybridistion buver on its own, biotin/digoxigenin lbelled plsmid sequences (pbr322), nd n irrelevnt probe (Herpes zoster virus, HZV). Lbelled humn plcentl DNA ws used to check hybridistion eyciency. Detection controls included omitting primry or secondry ntibody steps nd ddition of the colorimetric substrte only. SOLUTION PHASE POLYMERASE CHAIN REACTION HPV DNA sequences were derived from the EMBL genetic sequence dtbse. HPV E6 sequences which remin intct following virl DNA integrtion were chosen. During oligo synthesis, biotin reporter molecule with 15 crbon tom linker rm ws dded to the 5' end of the oligonucleotide probe nd subsequently used s n internl probe to confirm product specificity. The nucleotide sequence of the primers re s previously described. 20 Generl HPV primers (which identify sequenced nd unsequenced HPV) were lso used for pn HPV screen, unrestricted by the type specific HPV chosen bove, nd re s previously described. 21 Sections 10 µm thick were cut from the tissue blocks nd plced in sterile Eppendorf tubes. Strict nticontmintion protocols were dopted throughout. Nucleic cid extrction ws performed using proteinse K ( mg/ml) in proteinse K buver (100 mm NCl, 10 mm Tris HCl, 25 mm EDTA, 0.5% SDS, ph 8.4). Proteinse K incubtion ws crried out for three to five dys t 37 C with dequte mixing of smples. Proteinse K inctivtion ws then crried out t 94 C for 10 minutes. DNA ws purified using stndrd phenol chloroform isomyl lcohol technique. Nucleic cid ws precipitted using 3 M sodium cette nd ice cold ethnol. For type specific HPV polymerse chin rection (PCR), the PCR solution consisted of PCR buver (50 mm KCl, 10 mm Tris HCl ph 8.3, 1.5 mm MgCl 2, 0.01% geltine, 200 µm of ech deoxynucleotide triphosphte (dntp), 1.0 µm of ech primer, 2.5 units of AmpliTq DNA polymerse, nd 100 ng of DNA templte). Smples were then subjected to 40 cycles of PCR in Perkin Elmer 480 DNA thermocycler. Cycling prmeters were s follows: 94 C for one minute, followed by 94 C for one minute, 55 C for two minutes, 72 C for three minutes, by 40 cycles with finl extension set for 72 C for five minutes. For generl primer PCR, mplifiction conditions were similr except 3.5 mm MgCl 2 ws used nd n nneling temperture of 40 C ws pplied. Type specific HPV PCR products were confirmed by dot blot hybridistion, s previously described. 20 ANALYSIS OF rs ONCOGENE POINT MUTATIONS Nucleic cid ws extrcted s bove. The prevlence of rs point muttions ws ssessed by PCR/RFLP nlysis. Primers used for mplifiction of rs genes re shown in tbles 1 6. Cell lines shown to hve ll six possible muttions t codon 12 of Ki-rs nd t H-rs or N-rs codons 12 nd 61 were used s positive

4 Moleculr nlysis of rs oncogenes in crcinom of the cervix 579 Tble 4 Designed restriction frgment length polymorphisms for the detection of point muttions t codon 12 of the rs genes Sequence (codon) Gene Mismtch Enzyme Restriction site H-rs GCC GGC GGT MspI CCGC T K-rs GGA GCT GGT GGC CCT (11) Bst NI CC GG A Nrs GGA GCA GGT GGT GAT (13) Hph I b GGTGA CCA (10) Bsp MI GCAGGT Sequence round codon 12 is shown; muttions re underlined. Mismtched nucleotide nd its position in the primer is shown. Khn et l (reference 22). b MspI from Gibco BRL; Bst NI from Sigm; Hph I nd BspMI from New Englnd Biolbs. Tble 5 Designed restriction frgment length polymorphisms (RFLP) for the detection of point muttions t codon 13 of rs genes Sequence (codon) Gene Mismtch Enzyme Restriction site H-rs GGC GGT GTG GAG (14) Hph I GGTGA K-rs GGT GGC GTA CTA (14) He III GGCC N-rs GGT GGT GTT GAT (14) Hph I GGTGA Sequence round codon 12 is shown; muttions re underlined. Mismtched nucleotide nd its position in the primer is shown. Origin of RFLP, He III from Sigm; Hph I from New Englnd Biolbs. Tble 6 Designed restriction frgment length polymorphisms (RFLP) for the detection of point muttions t codon 61 of the rs genes Sequence (codon) Gene Mismtch Enzyme Restriction site H-rs GCC GGC CAG GAG GAG CTG (63) Alw N1 CAGN 3 CTG K-rs GCA GGT CAA GAG GCT GAT Bcl I TGATCA (59, 60) GAA (61) Er I GAAGAG CGA Tq I TCGA CTA Xb I TCTAGA CAC Me III GTCAC CAT Nl III CATG N-rs GCT GGA CAA GAA GAG GGC (60) Bl I TGGCCA Sequence round codon 12 is shown; muttions re underlined. Mismtched nucleotide nd its position in the primer is shown. Origin of RFLP: Bcl I, Er I, AlwNI, Bl I, Mitsudomi et l (reference 23); Nl III, Kumr et l (reference 24); Tq I, Xb I, Me III, Milici et l (reference 25). AlwNI, Bcl I, Nl III, Tq I, nd Xb I from Sigm; Er I from New Englnd Biolbs. Tble 7 Cell lines used in the study Cell line Activting muttion nd codon Clu I TGT; K-rs codon 12 A549 AGT; K-rs codon 12 SW480 GTT; K-rs codon 12 SW1116 GCT; K-rs codon 12 A427 GAT; K-rs codon 12 T24 Homozygous for vline t H-rs codon 12 HT1080 Homozygous for lysine t N-rs codon 61 NCI-H1915 CTG; H-rs codon 61 NCI-H647 GAC; K-rs codon 13 Activting muttion underlined. controls (Clu-1, SW 480, A427, SW1116, nd T24 were purchsed from ATCC, PHLS Centre for Applied Microbiology, Porton Down, Slisbury, UK) (tble 7). Codon 12 rs oncogenes H-rs 12 Primers were used to mplify H-rs codon 12 sequences spnning two endogenous MspI (CCGG) sites, one of which included the two trget G residues t position 12 nd the other of which is n Msp1 control site. Positive control cell line mteril used in this ssy ws the T24 cell line (homozygous for the vline codon 12 muttion). The sizes of the undigested, norml, nd mutnt frgments re given in tble 1. K-rs 12 This codon ws mplified using 5' end primer tht contined C substitution t the first position of codon 11. This creted Bst N1 (CCTGG) site which overlps the first two nucleotides of codon 12. The 3' primer lso contined substitution, creting control Bst N1 site. The cell line SW 480 ws used s positive control mteril. The sizes of the undigested, norml, nd mutnt frgments re given in tble 2. N-rs 12 In this cse, by introducing n A residue t codon 13 through the mismtched ntisense primer N12AHph, novel Hph site ws creted. Any muttion bolished the restriction site. The sizes of the undigested, norml, nd mutnt frgment re given in tble 3. Detils of the RFLPs t codon 12 re given in tble 4. Codon 13 rs oncogenes By introducing n A residue t codon 14 for (H nd N rs) nd Ctcodon 13 for K rs, screening for point muttions t codon 13 for ech of the three rs oncogenes could be performed using the mismtched primers H13AHph, K13AHe, nd N13AHph, which respectively creted n Hph1 site for H-rs, n He III site for K-rs, nd n Hph1 site for N-rs. Using the primers for K-rs codon 12 ssy, the sme mplified frgment cn be digested with Hph 1 to dignose sprtic cid muttions t the second position of codon 13. The prticulrs of the RFLPs re given in tble 5. Codon 61 rs oncogenes H-rs 61 For this codon, AlwN1 cut the frgment generted with primers H61AAlw nd H61S (tble 1) when no muttion ws present. To mximise the eyciency of this ssy, the entire codon ws first mplified using H61S nd H61A nd nested PCR for H61AAlw nd H61S. The digestions re illustrted in tbles 1 nd 6. K-rs 61 The enzyme Bcl I cut the PCR product mplified with K61SBcl (which hs two mismtches t codon 59 nd 60) nd K61A when the first two nucleotides of codon 61 re CA. The third nucleotide of codon 61 Vects the genetic code, nd Er I digestion ws therefore necessry. ErI would only cut the frgment generted by primers K61SEr nd K61A when the third nucleotide of codon 61 ws A. By combining the digestions of Bcl I nd Er I, ny muttion could be detected. These digestions re illustrted in tbles 2 nd 6. N-rs 61 Bl I cut the frgment generted by N61SBl nd N61A when the first two nucleotides were CA (tble 6). Afl III will cut when codon 61 is CAT or CAC. Therefore when Bl I cuts nd AflIII does not, then no ctivting muttion ws present. The digestions re illustrted in tbles 2 nd 6.

5 580 O Lery, Lnders, Silv, et l Figure 1 HPV 16 non-isotopic in situ hybridistion (NISH) ssy in cervicl squmous cell crcinom, showing punctte signls in the nuclei of mny cells. POLYMERASE CHAIN REACTION Genomic DNA ( ng) ws mplified in rection volume of 50 or 100 µl contining 50 mm KCl, 10 mm Tris-HCl (ph 8.3), 1.5 mm MgCl 2, 0.01% (wt/vol) geltin, 1.25 mm of ech of four dntp, 50 pmol of primers, nd 2.5 units of Tq DNA polymerse (Ampli Tq, Perkin-Elmer, Wrrington, Cheshire, UK). The conditions for the PCR using 480 therml cycler (Perkin-Elmer) were s follows: 94 C for five minutes for initil denturtion, 40 cycles of 94 C for one minute, nneling for two minutes, nd extension t 68 C for two minutes. Anneling tempertures were s follows: K-rs codon 12, 45 C; H-rs codon 12, 62 C; N-rs codon 12, 55 C; K- nd N-rs codons 13 nd 61, 50 C; H-rs codon 13 nd 61, 60 C. Oligonucleotide primers were synthesised using DNA synthesiser ccording to the published sequences dt of the K-, H-, nd N-rs genes. Primer sequences re shown in tbles 1, 2, nd 3. In cse of the H-rs codon 61 screening, the eyciency of PCR ws very low becuse of two mismtches in the primer H61AAlw. To overcome this, we employed heminested PCR using entire exon II PCR product s templte for second stge PCR. RESTRICTION ENZYME DIGESTION AND GEL ELECTROPHORESIS PCR product (16 20 µl) ws digested with the restriction enzymes shown in tbles 1 3. The rection conditions followed suppliers recommendtions. DNA ws electrophoresed through 4 6% grose gels, followed by ethidium bromide stining. Gels were photogrphed using n ultrviolet light trnsillumintor. Figure 2 H-rs 12 muttion PCR/RFLP ssy, using 4% grose gel. Mrker ldder used is phi X174. U, uncut mplified product; Mt, mutnt frgment (lne 6). Lne 5 shows mutted H-rs codon 12 in tumour smple. Figure 3 N-rs codon 61 ssy to estblish PCR/RFLP ssy sensitivity: 25 ng of strting DNA templte ws used; genomic DNA ws prepred from HT 1080 cells (homozygous for the mutnt 61 lysine llele). This mutnt DNA ws mixed with norml genomic DNA obtined from humn plcent nd mixed in defined rtios. The mplified product ws then digested with Bl I. Results Of the 20 CIN IIIs exmined, 19 contined HPV 16 DNA sequences by PCR nd NISH. Dul infection ws not uncovered. The 20 erly (stge I nd II) invsive squmous cell crcinoms showed predominnt HPV 16 positivity (17/20) with one cse (1/20) being HPV 18 positive, gin confirmed on PCR nd NISH (fig 1). Activting muttions were not identified in ny of the CIN smples. Only one stge I HPV

6 Moleculr nlysis of rs oncogenes in crcinom of the cervix positive crcinom showed n ctivting muttion t codon 12 of H-rs. The djcent norml ectocervicl mucos from the sme ptient ws norml. All control cell lines yielded restriction ptterns s predicted (fig 2). The sensitivity of the ssy with loding contminting non-mutted DNA ws lso estblished (fig 3) t sensitivity of 1:3 (tumour to contminting DNA sequences) using 25 ng of strting DNA templte (fig 3), nd 1:4 nd 1:5 using higher DNA concentrtions ( ng). Control DNA from norml cervicl mrgins did not revel ny ctivting muttions. Discussion We exmined 20 CIN III smples (19 HPV positive, one HPV negtive) nd 20 stge I nd II cervicl crcinoms (18 HPV positive, two HPV negtive) to ssess the prevlence of point muttions in H, K, nd N-rs oncogenes, using PCR/RFLP nlysis. This ssy overs rpid, non-rdioctive method of screening rs muttions in lrge study popultions. The optiml digestion conditions for RFLP nlysis were first estblished using positive control cell lines contining defined ctivting muttions. We were confidently ble to demonstrte mutnt DNA in 1:3 rtio in contminting norml DNA, even using 25 ng of strting DNA templte (fig 3). At higher strting DNA concentrtions, rtios of 1:4 were esily chieved. We identified n ctivting muttion t codon 12 H-rs in one HPV 16 positive stge I cervicl squmous cell crcinom. The surrounding norml ectocervicl mucos in this ptient did not contin ny ctivting muttion. No djcent CIN III ws identified in this cse. The findings re in keeping with those of Bos, 2 but re contrry to the findings of Riou et l, 12 in which muttions t codon 12 of H-rs were found in 24% of tumours t n dvnced stge. Additionlly 40% of tumours with muttions (in the Riou series), lso contined n llelic deletion t tht locus. Riou s dt suggest tht deletions nd muttions of H-rs gene occur in dvnced stges of cervicl crcinom. The tumours exmined in our study were predominntly stge I nd II diverent study group where diverent genetic events my be opertionl. Previously, Rumsby et l found low incidence of rs oncogene ctivtion in rnge of humn squmous cell crcinoms. 16 Hiorns et l screened series of nogenitl tumours for ctivting muttions of the rs oncogene fmily using the polymerse chin rection nd series of synthetic oligonucleotide probes 17 (n lterntive method to the ssy dopted in our study). Muttions were seen in only two cses (both K-rs codon 12), neither of which ws HPV ssocited. Their findings redily suggest tht rs ctivtion does not pper to be common event in the genesis of these tumours nd when it did occur it did not pper to coexist with HPV infection. This supports the findings of our study, in which the mjority of cses were HPV positive nd ctivting rs muttion negtive. It seems likely, therefore, tht in erly nogenitl neoplsi muttions t either codon 12 of H-rs nd K-rs in prticulr re uncommon events. Our dt in reltion to CIN III re in ccordnce with those of Le Vn et l, 26 who were unble to identify H-rs 12 muttions in cses of CIN I, II, nd III. However, Grendys et l hve recently demonstrted muttions in H, Ki, nd N-rs codon 61 in 24.2% of stge IB cervicl crcinoms, 27 contrsting with 5% (1/20) in our study. In conclusion, rs ctivtion does not pper to occur in conjunction with HPV infection, prticulrly of HPV 16 infected high grde cervicl intrepithelil neoplsi. In ddition, rs ctivtion is n infrequent event in erly squmous cell crcinom, lthough the interction of HPV 16 nd rs oncogenes in cellulr trnsformtion in vitro hs been shown. 28 This leds us to believe tht mny diverent cell types diver in their susceptibility to trnsformtion by such gents. On current dt, the postulted model of HPV linked crcinogenesis suggests mlfunctionl control of HPV trnscription s necessry component for neoplstic progression. It is lso cler, however, tht host gene ltertions re eqully necessry for HPV linked crcinogenesis to occur. 1 Mrshll CJ. Humn oncogenes. In: Weiss R, Teich N, Vrmus H, CoYn J,eds.RNA tumour viruses. Cold Spring Hrbor: Cold Spring Hrbor Press, 1985: Bos JL. The rs gene fmily nd humn crcinogenesis. Mutt Res 1988;195: Brbcid M. rs Genes. Annu Rev Biochem 1987;56: Gilmn AG. G proteins nd dul control of denylte cyclse. Cell 1984;36: Gibbs JB, Sigl IS, Poe M, et l. Intrinsic GTPse ctivity distinguishes norml nd oncogenic rs p 21 molecules. Proc Ntl Acd Sci USA 1984;81: Mnne V, Bekesi E, Kung HF. H-rs proteins exhibit GTPse ctivity: point muttions tht ctivte H-rs gene product result in decresed GTPse ctivity. Proc Ntl Acd Sci USA 1985;82: Wlter M, Clrk SG, Levinson AD. The oncogenic ctivtion of humn p21 rs by novel mechnism. Science 1986;233: Westwy D, PpkoV J, Moscovici C, et l. Identifiction of pro-virlly ctivted c-h-rs oncogene in n vin nephroblstom vi novel procedure: cdna cloning of chimeric virl host trnscript. EMBO J 1986;5: Pulciri S, Sntos E, Long LK, et l. rs Gene mplifiction nd mlignnt trnsformtion. Mol Cell Biol 1985;5: Cichutek K, Duesberg PH. Hrvey rs genes trnsform without mutnt codons pprently ctivted by trunction of 5' exon (exon-1). Proc Ntl Acd Sci USA 1986;83: Riou G, Brrois M, Sheng ZM, et l. Somtic deletions nd muttions of c-h-rs gene in humn cervicl cncers. Oncogene 1988;3: Riou G, Brrois M, Dutronquy V, et l. Presence of ppillomvirus DNA sequences, mplifiction of c-myc nd c-h-rs oncogenes nd enhnced expression of c-myc in crcinoms of the uterine cervix. Ppillomvirus: Moleculr nd Clinicl Aspects 1985; Agnntis NJ, Spndidos DA, Mher H, et l. Immunohistochemicl study of rs oncogene expression in endometril nd cervicl humn lesions. Eur J Gynecol Oncol 1988;9: Kitchener HC. Recent developments in viruses nd genetics in gynecologic cncer. Curr Opin Oncol 1990;2: Enomoto T, Inoue M, Perntoni AO, et l. K-rs ctivtion in neoplsms of the humn femle reproductive trct. Cncer Res 1990;50: Rumsby G, Crter RL, Gusterson BA. Low incidence of rs oncogene ctivtion in humn squmous cell crcinoms. Br J Cncer 1990;61: Hiorns LR, Scholefield JH, Plmer JG, et l. Ki-rs oncogene muttions in non-hpv ssocited nl crcinom. J Pthol 1990;161: Victor T, Du Toit R, Jordn AM, et l. No evidence for point muttions in codons 12, 13, 61 of the rs gene in high incidence re for esophgel nd gstric cncers. Cncer Res 1990;50:

7 582 O Lery, Lnders, Silv, et l 19 O Lery JJ, Browne G, Crowley M, et l. Non-isotopic detection of DNA in tissues. In: Herrington CS, Levy BR, eds. In-situ hybridistion. A prcticl pproch. Oxford: Oxford University Press, 1994: Arends MJ, Donldson YK, Duvll E, et l. HPV in full thickness cervicl biopsies: high prevlence in CIN2 nd CIN3 detected by sensitive PCR method. J Pthol 1991; 165: Vn den Brule AFC, Snijders PJF, Gordijn RLJ, et l. Generl primer-medited polymerse chin rection permits the detection of sequenced nd still unsequenced humn ppillomvirus genotypes in cervicl scrpes nd crcinoms. Int J Cncer 1990;45: Khn SM, Jing W, Weinstein IB. Rpid non-rdioctive detection of rs oncogenes in humn tumours. Amplifictions: A Forum for PCR Users 1990;4: Mitsudomi T, Villet J, Mulshine JL, et l. Muttion of rs genes distinguish subset of non- smll-cell lung cncer cell lines from smll-cell lung cncer cell lines. Oncogene 1991;6: Kumr K, Dunn LL. Designed dignostic restriction frgment length polymorphisms for the detection of point muttions in rs oncogenes. Oncogene Res 1989;4: Milici A, Blich M, Murphy E, et l. c-k-rs codon 12 GGT- CGT point muttion. An infrequent event in humn lung cncer. Biochem Biophys Res Commun 1986;140: Le Vn L, Stoerker J, Rinehrt CA, et l. H-rs codon 12 muttion in cervicl dysplsi. Gynecol Oncol 1993;49: Grendys EC, Brnes WA, Weitzel J, et l. Identifiction of H, K nd N-rs point muttions in stge IB cervicl crcinom. Gynecol Oncol 1997;65: Mtlshewski G, Schneider J, Bnks L, et l. Humn ppillomvirus type 16 DNA co-opertes with ctivted rs in trnsforming primry cells. EMBO J 1987;6: J Clin Pthol: first published s /jcp on 1 August Downloded from on 5 September 2018 by guest. Protected by copyright.