Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.
|
|
- Posy Summers
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or four nuclei (multinucleated) across 120 HMDP mouse strains. P = 1.1 x See Supplementary Table 1 for a full list of strains and values. (be) Left ventricular anterior wall thickness (mm) (b), stroke volume (μl) (c), left ventricular systolic volume (μl) (d), and left ventricular diastolic volume (μl) (e) at baseline, 3 days and 1 month after injury. Strain A (n = 5), SWR (n = 8), C57Bl/6 (n = 4), and SJL (n = 7). *P < 0.05; #P < 0.01; ##P < Complete statistics for echocardiography parameters can be found in Supplementary Table 3. (f) Example image of trichrome stain at mid-papillary view 1 month after injury. Right panel is a digital cut-out of the left ventricle with the blue scar selected (yellow outline) by the color thresholding in FIJI imaging software. Scale bar represents 1 mm. (g) Orthogonal view of a confocal z-stack showing a cardiac Troponin C (ctnc, green), phospho-histone H3 (phh3, red) cardiomyocyte (white arrowhead). Scale bar represents 20 μm. (h) Quantification of percent of phh3+ CM nuclei in the infarction border zone of the left ventricle for strain A (n = 3) and C57Bl/6 (n = 3) mice. P value is a two-tailed Student t-test. All error bars represent s.e.m.
2 Supplementary Figure 2 Relationships of Tnni3k to mononuclear cardiomyocyte frequency.
3 (a) Dot plot of 120 HMDP strains distributed across three alleles of Tnni3k. Allele 1 is a C at rs resulting in a splice mutation and reduced expression (n = 60 strains). Allele 2 is a T at rs with wild-type expression (n = 56 strains). Allele 3 is T at rs but has a separate polymorphism that results in reduced expression (see main text) (n = 4 strains). (b) Western blot for Tnni3k across 4 strains of the HMDP. C57Bl/6 has allele 2, A has allele 1, and SJL and SWR both have allele 3. (c-f) Ejection fraction (c), stroke volume (d), left ventricular wall thickness (e), and left ventricular volume in diastole and systole (f) measured by echocardiography on Tnni3k knockout (KO, n = 5) and wild-type (WT, n = 5) mice at baseline, 3 days post coronary artery ligation and 28 days post ligation. (g) Confocal image of WGA stain (green) and cardiomyocyte autofluorescence (red). Scale bar represents 50 μm. (h) Quantification of the average cardiomyocyte area at one month post-infarction in WT (n = 6) and KO (n = 7) animals. (i) Quantification of the scar area 1 month after injury represented as a percent of the total left ventricle in WT (n = 6) and KO (n = 7) animals. (j) RT-PCR for mouse Tnni3k, zebrafish tnni3k and zebrafish eef1g in mouse heart and control and Tnni3k transgenic fish. (k) Western blot for Tnni3k in C57Bl/6 mice across developmental ages. Error bars are s.e.m.
4 Supplementary Table Strains of the Hybrid Mouse Diversity Panel. # on Strain N Average Biological Replicates Average SEM Fig1A %Mono %Multi SEM 1 AXB24/PgnJ % 0.74% 0.83% 3.06% 3.06% 11.38% 1.46% 2 BXD24b/TyJ % 0.19% 2.68% 2.29% 7.00% 1.04% 3 BXD31/TyJ % 0.54% 3.67% 2.55% 1.81% 8.76% 2.63% 4 SJL/J % 0.50% 3.66% 1.95% 2.70% 21.48% 2.35% 5 BXD29/TyJ % 1.03% 3.82% 1.77% 10.41% 0.21% 6 BXH6/TyJ % 0.34% 2.86% 2.24% 3.44% 18.01% 1.51% 7 C58/J % 0.60% 3.41% 3.51% 1.66% 9.20% 1.88% 8 BXH8/TyJ % 0.68% 3.33% 3.86% 1.60% 16.53% 1.62% 9 BXA24/PgnJ % 0.38% 3.54% 2.79% 5.34% 1.35% 10 BXD85/RwwJ % 0.04% 3.23% 3.13% 6.10% 1.22% 11 BXA26/PgnJ % 0.85% 2.52% 4.21% 2.97% 0.87% 12 BXD34/TyJ % 0.61% 2.47% 3.26% 4.55% 4.40% 0.36% 13 C57BLKS/J % 0.89% 3.72% 1.76% 4.79% 8.15% 0.96% 14 BTBR T+ tf/j % 0.62% 3.13% 2.55% 4.62% 9.29% 1.76% 15 BXD5/TyJ % 1.01% 2.08% 3.13% 5.49% 9.09% 2.61% 16 MRL/MpJ % 1.30% 2.43% 6.21% 2.17% 5.08% 0.15% 17 BXD75/RwwJ % 0.75% 4.71% 1.49% 4.12% 4.56% 8.46% 1.37% 18 BXD16/TyJ % 0.25% 3.33% 4.21% 3.72% 3.45% 0.71% 19 BXD67/RwwJ % 1.03% 5.19% 2.67% 8.33% 0.09% 20 AXB10/PgnJ % 0.21% 4.19% 3.77% 11.20% 0.50% 21 AXB19/PgnJ % 0.85% 3.39% 4.71% 2.25% 6.18% 9.08% 0.42% 22 BXD96/RwwJ % 0.84% 5.70% 2.67% 2.75% 5.51% 7.57% 0.95% 23 BXH10/TyJ % 0.79% 4.92% 2.70% 5.21% 16.75% 0.33% 24 AXB15/PgnJ % 0.23% 4.66% 3.87% 4.39% 4.01% 0.08% 25 BXA7/PgnJ % 1.44% 2.05% 6.08% 2.56% 10.04% 1.57% 26 BXD18/TyJ % 0.31% 5.04% 4.05% 4.15% 8.72% 2.56% 27 BXH22/KccJ % 0.85% 2.87% 5.76% 4.72% 6.37% 0.32% 28 AXB12/PgnJ % 1.12% 3.33% 5.58% 3.23% 0.64% 29 BXD87/RwwJ % 0.43% 4.39% 5.24% 3.76% 16.02% 3.15% 30 BXD65/RwwJ % 0.27% 4.80% 3.95% 4.72% 8.55% 0.47% 31 BXA14/PgnJ % 0.90% 3.61% 5.41% 9.72% 0.59% 32 SM/J % 0.76% 5.51% 3.65% 6.47% 2.67% 33 BXH9/TyJ % 1.04% 5.47% 2.54% 5.81% 8.10% 2.59% 34 BXD55/RwwJ % 0.78% 5.17% 4.12% 6.45% 2.80% 20.57% 3.49% 35 BUB/BnJ % 0.77% 3.57% 4.41% 6.18% 5.91% 0.84% 36 CXB6/ByJ % 1.42% 3.33% 6.17% 19.98% 4.71% 37 BXD51/RwwJ % 0.23% 4.52% 5.31% 4.76% 6.31% 1.32% 38 AXB19a/PgnJ % 0.33% 5.43% 4.29% 5.00% 10.16% 1.35% 39 FVB/NJ % 0.39% 4.64% 6.08% 4.44% 4.52% 9.52% 1.67% 40 BXD32/TyJ % 0.62% 6.28% 4.48% 4.37% 8.06% 1.22% 41 BXD73/RwwJ % 0.64% 4.70% 6.94% 4.81% 3.95% 22.79% 1.85% 42 BXD2/TyJ % 0.73% 4.38% 5.84% 3.45% 1.41% 43 C57Bl/6J % 0.50% 4.65% 4.49% 6.67% 5.03% 20.28% 5.66% 44 AXB23/PgnJ % 0.29% 5.06% 5.65% 12.13% 1.58% 45 C57L/J % 0.77% 4.15% 5.16% 6.78% 7.73% 1.10% 46 BXD60/RwwJ % 2.51% 2.33% 8.47% 6.90% 13.31% 5.33% 47 SEA/GnJ % 0.61% 4.55% 5.26% 6.61% 5.93% 1.63% 48 BXH4/TyJ % 0.52% 5.58% 6.10% 4.00% 6.28% 15.49% 1.27% 49 BXD14/TyJ % 0.41% 5.62% 6.16% 4.76% 8.24% 1.36% 50 BXD40/TyJ % 0.28% 5.91% 5.78% 5.00% 6.38% 1.70% X1/SvJ % 1.12% 6.42% 6.98% 3.37% 6.04% 0.58% 52 CXB8/HiAJ % 1.20% 6.43% 2.83% 5.05% 9.76% 3.88% 14.47% 2.29% 53 BXH19/TyJ % 1.51% 5.05% 8.53% 3.40% 9.98% 0.57% 54 CXB9/HiAJ % 0.08% 5.74% 5.59% 10.36% 0.52% 55 BXD13/TyJ % 0.44% 6.49% 5.56% 5.00% 0.77% 0.49% 56 BXD6/TyJ % 1.87% 2.08% 3.13% 5.49% 11.19% 1.55% 57 CXB12/HiAJ % 0.23% 5.45% 6.23% 5.63% 6.08% 1.92% 58 Balb/cJ % 0.67% 4.80% 5.68% 7.11% 4.89% 0.58% 59 BXD28/TyJ % 0.55% 6.46% 4.89% 6.61% 4.69% 1.04% 60 KK/HlJ % 0.35% 6.78% 6.02% 5.59% 10.08% 2.67%
5 Supplementary Table 1. Continued # on Strain N Average Biological Replicates Average SEM Fig1A %Mono %Multi SEM 61 BXH7/TyJ % 1.36% 7.00% 7.96% 3.48% 4.91% 0.44% 62 CXB13/HiAJ % 0.30% 5.86% 6.46% 20.42% 0.75% 63 LG/J % 0.47% 6.64% 5.70% 10.26% 0.50% 64 AKR/J % 1.25% 4.88% 4.96% 8.68% 17.72% 1.24% 65 BXD61/RwwJ % 0.89% 4.50% 6.64% 7.49% 4.89% 0.29% 66 BXD68/RwwJ % 1.20% 5.09% 7.49% 3.36% 1.05% 67 LP/J % 0.65% 7.06% 5.75% 3.12% 1.30% 68 BXH20/KccJ % 0.81% 7.26% 5.65% 12.90% 1.61% 69 BXD50/RwwJ % 0.67% 7.59% 6.58% 5.26% 5.22% 1.20% 70 BXD20/TyJ % 0.75% 7.92% 7.42% 6.33% 7.45% 3.77% 13.51% 2.59% 71 BXD48/RwwJ % 0.56% 5.78% 8.00% 7.11% 5.65% 17.52% 3.06% 72 BXA2/PgnJ % 0.65% 6.00% 7.29% 18.38% 0.38% 73 BXA13/PgnJ % 0.34% 7.04% 7.20% 6.10% 9.76% 1.30% 74 BXD42/TyJ % 0.87% 5.49% 6.59% 8.47% 8.33% 1.54% 75 DBA/2J % 0.30% 7.54% 7.20% 6.51% 9.31% 1.16% 76 BXD9/TyJ % 0.90% 8.23% 6.43% 5.74% 1.88% 77 BXD100/RwwJ % 0.78% 6.64% 7.00% 9.13% 9.65% 0.89% 78 AXB1/PgnJ % 0.82% 8.81% 8.17% 6.08% 12.79% 2.22% 79 BXD27/TyJ % 0.26% 7.91% 8.28% 7.37% 4.23% 1.13% 80 NZW/LacJ % 1.18% 6.50% 9.39% 5.91% 0.16% 81 MA/MyJ % 1.10% 8.11% 8.68% 7.39% 5.65% 2.93% 82 BXA11/PgnJ % 0.18% 8.00% 8.44% 3.28% 0.26% 83 CBA/J % 0.24% 8.36% 8.66% 7.84% 7.41% 0.83% 84 BXD38/TyJ % 1.43% 10.93% 8.41% 5.98% 9.38% 1.76% 85 AXB2/PgnJ % 1.08% 8.28% 6.29% 10.65% 11.11% 5.90% 5.24% 1.10% 86 BXD1/TyJ % 1.99% 6.98% 12.50% 6.19% 2.91% 0.63% 87 BXD8/TyJ % 0.56% 9.20% 8.08% 4.03% 1.35% 88 BXA4/PgnJ % 1.19% 6.98% 9.52% 11.64% 6.56% 6.58% 2.29% 89 BXD69/RwwJ % 1.27% 11.34% 7.08% 8.30% 4.47% 0.08% 90 BXA12/PgnJ % 1.40% 6.14% 9.75% 7.55% 12.55% 3.87% 0.45% 91 BXD15/TyJ % 0.91% 7.57% 9.41% 10.71% 5.04% 0.72% 92 Nor/LTJ % 0.10% 9.55% 9.34% 9.67% 7.29% 0.60% 93 NOD/LtJ % 2.20% 6.99% 7.69% 13.92% 3.47% 1.45% 94 BXA25/PgnJ % 0.50% 9.15% 9.58% 8.98% 11.16% 12.74% 1.03% 95 CXB1/ByJ % 0.06% 9.78% 9.90% 4.20% 0.14% 96 RIIIS/J % 0.68% 10.84% 10.55% 9.31% 7.56% 11.34% 4.71% 1.52% 97 BXD39/TyJ % 1.14% 9.01% 12.23% 8.62% 2.17% 1.51% 98 AXB4/PgnJ % 0.26% 9.70% 10.23% 6.82% 1.13% 99 PL/J % 0.67% 9.28% 10.93% 6.40% 0.06% 100 AXB8/PgnJ % 1.33% 13.28% 9.91% 8.02% 10.15% 10.97% 13.24% 2.10% 101 BXH14/TyJ % 1.37% 13.00% 8.26% 10.81% 5.17% 0.68% 102 I/LnJ % 0.54% 9.73% 11.44% 11.22% 4.37% 1.80% 103 C3H/HeJ % 1.05% 13.64% 9.49% 8.98% 11.17% 7.22% 0.81% 104 BXD19/TyJ % 1.86% 7.59% 11.62% 13.94% 4.96% 0.96% 105 BXD21/TyJ % 1.39% 8.24% 16.31% 8.19% 12.98% 13.13% 8.53% 4.89% 0.95% 106 BXD11/TyJ % 1.95% 8.82% 10.14% 15.22% 2.88% 0.97% 107 CXB2/ByJ % 1.41% 11.65% 15.09% 8.28% 10.8% 3.64% 0.76% 108 BXD84/RwwJ % 1.54% 9.93% 13.02% 11.51% 0.92% 109 AXB6/PgnJ % 1.81% 11.98% 8.30% 14.54% 4.51% 0.92% 110 CXB11/HiAJ % 1.66% 9.09% 14.79% 11.30% 1.16% 0.20% 111 CE/J % 0.96% 13.23% 10.00% 12.37% 6.81% 0.70% 112 BXA16/PgnJ % 1.12% 13.64% 11.64% 10.51% 7.64% 1.71% 113 BXA8/PgnJ % 0.29% 12.55% 11.97% 4.32% 1.75% 114 AXB13/PgnJ % 3.59% 9.09% 16.28% 4.31% 1.98% 115 BXA1/PgnJ % 1.30% 11.63% 13.29% 17.92% 14.21% 9.34% 11.72% 8.17% 2.08% 116 Balb/cByJ % 1.48% 15.69% 16.88% 10.13% 13.40% 9.15% 1.93% 117 BXD12/TyJ % 2.84% 20.00% 11.16% 11.83% 3.23% 0.72% 118 AXB5/PgnJ % 0.18% 14.58% 14.13% 1.41% 0.58% 119 SWR/J % 1.14% 12.22% 17.54% 15.72% 16.33% 4.33% 1.42% 120 A/J % 1.98% 15.87% 12.92% 25.21% 13.93% 13.82% 9.38% 22.43% 22.22% 8.20% 1.43%
6 Supplementary Table 2. Statistics for Figure 1F. Ejection Fraction across 4 strains. ANOVA - Repeated Measures: P-value (interstrain): P = 0.11 P-value (intrastrain*day): P < INTERSTRAIN VARIATION: ANOVA - Baseline P = 0.94 ANOVA - 3 day P = 0.50 ANOVA - 28 day P = Bonferonni P-value Significant Bonferonni P-value Significant Bonferonni P-value Significant A vs SWR A vs SWR A vs SWR A vs C A vs C A vs C A vs SJL A vs SJL A vs SJL SWR vs C SWR vs C SWR vs C SWR vs SJL SWR vs SJL SWR vs SJL C57 vs SJL C57 vs SJL C57 vs SJL INTRASTRAIN VARIATION INTERSTRAIN VARIATION (low vs high strains) Paired T-tests (intrastrain: EF day 3 to day 28) T-Test (combined low strains vs combined high strains) Strain P-value Significant Time point P-value Significant A Baseline SWR trending 3 day C57Bl/ day SJL High strains combined Low strains combined 8.70E-04 Supplementary Table 3. Statistics for Figures S1B-E. Additional parameters of echocardiography across strains at 28 days post infarction. Figure S1B. LV Anterior Wall (28 day) Figure S1C. Stroke Volume (28 day) ANOVA - 28 day P = 3E-05 ANOVA - 28 day P = Bonferonni Correction P-value Significant Bonferonni Correction P-value Significant A vs SWR A vs SWR A vs C57Bl/ A vs C57Bl/ A vs SJL A vs SJL SWR vs C57Bl/ SWR vs C57Bl/ SWR vs SJL 1.1E-04 SWR vs SJL C57Bl/6 vs SJL C57Bl/6 vs SJL Figure S1D. LV Volume (systole, 28 day) Figure S1E. LV Volume (diastole, 28 day) ANOVA - 28 day P = 9E-04 ANOVA - 28 day P = 2E-04 Bonferonni Correction P-value Significant Bonferonni Correction P-value Significant A vs SWR A vs SWR A vs C57Bl/ A vs C57Bl/ A vs SJL A vs SJL SWR vs C57Bl/ SWR vs C57Bl/6 1.8E-04 SWR vs SJL SWR vs SJL C57Bl/6 vs SJL C57Bl/6 vs SJL 0.483
7 Full Western blot images corresponding to Figure 3C. Cropped off 3 A/J samples (irrelevant), #1969 (misloaded or degraded), and last two samples (unrelated experiment)
8 mou se mou heart cmlc se heart cmlc 2-GFP 2 cmlc -Tnni3k # 2-T 1 H2O nni3k #1 Full Western blot images corresponding to Figure S2B. 2 samples cropped after SWR (unrelated experiment) zebrafish - Tnni3k mtnni3k (primer set 2) mou se mou heart cmlc se heart cmlc 2-GFP 2 cmlc -Tnni3k # 2-T 1 H2O nni3k #1 mou se mou heart cmlc se heart cmlc 2-GFP 2 cmlc -Tnni3k # 2-T 1 H2O nni3k #1 mtnni3k (primer set 1) zebrafish - eef1g Full RT-PCR gel images corresponding to Figure S2J. Full Western blot images corresponding to Figure S2K. Anti-Tnni3k blot on left. Anti-Gapdh blot on right.
Chow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationE10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)
Myociyte cross-sectional Relative mrna levels Relative levels Relative mrna levels Supplementary Figures and Legends a 8 6 4 2 Ezh2 E1.5 E18.5 P2 1w 83w b Ezh2 p16 amhc b-actin P2 43w kd 37 86 16 wt mouse
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in
More informationSupplementary Figure 1. c Human
Supplementary Figure 1 a b c Human Mouse d Gapdh Amino acid sequence and baseline expression of MYDGF N-terminal signal peptides (S-scores) and signal peptide cleavage sites (C-scores) of (a) human MYDGF
More informationSupplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
More informationTcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
More informationhemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSantulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
More information(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
More informationPostn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
More informationSUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSupporting Information. Calculation of the relative contributions of myocyte proliferation, stem cell. Supporting Information Fig 1 (page 9)
Supporting Information Table of contents Calculation of the relative contributions of myocyte proliferation, stem cell differentiation and cardioprotection (page 2) Supporting Information Fig 1 (page 9)
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSupplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationBNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine
Kanazawa, et al. Supplementary figure legends Supplementary Figure 1 DS rats had congestive heart failure. (A) DR and DS rat hearts. (B) QRT-PCR analysis of BNP mrna expression in DR and DS rat left ventricles
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary material page 1/10
Supplementary Figure 1. Metoprolol administration during ongoing AMI reduces MVO in STEMI patients (a, b) Complete representative CMR exams (short-axis covering the entire left ventricle (LV) from base
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationSerum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationSupplementary figures
Supplementary figures Supplementary Figure 1. B cells stimulated with pokeweed mitogen display normal mitotic figures but not cells infected with B95-8. The figures show cells stimulated with pokeweed
More informationSupplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Edn1-knockout (Edn1-KO) (c, d) hearts. The boxed areas
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationGenetic influence on immune phenotype revealed strain-specific variations in peripheral blood lineages
Physiol Genomics 34: 304 314, 2008. First published June 10, 2008; doi:10.1152/physiolgenomics.00185.2007. Genetic influence on immune phenotype revealed strain-specific variations in peripheral blood
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationDiabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationGallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
More informationControl. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
More informationWHICH C57BL/6 SUBSTRAIN WAS USED FOR THE BACKGROUND STRAIN OF YOUR MOUSE?
Вестник ВОГиС, 2009, Том 13, 3 523 WHICH C57BL/6 SUBSTRAIN WAS USED FOR THE BACKGROUND STRAIN OF YOUR MOUSE? K. Mekada, A. Yoshiki RIKEN BioResource Center, Tsukuba, Ibaraki, Japan, e-mail: yoshiki@brc.riken.jp
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationGenetic ablation of Acp1 (Lmptp) in mice prevents heart failure
Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure Coralie Poizat, Ph.D. Director, Cardiovascular Research Program KFSHRC-Riyadh Saudi Heart Failure Working Group Jeddah, 5 December 2015 Cardiovascular
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationSupplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
More informationSupplementary Figure 1
Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific
More informationSupplementary Table I Blood pressure and heart rate measurements pre- and post-stroke
SUPPLEMENTARY INFORMATION doi:10.1038/nature09511 Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke Pre Post 7-days Systolic Diastolic BPM Systolic Diastolic BPM Systolic
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationNature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling
More informationTitle: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationB lymphocytes trigger monocyte mobilization and impair heart function after acute myocardial infarction
Supplementary Figures to 3 B lymphocytes trigger monocyte moilization and impair heart function after acute myocardial infarction Yasmine Zouggari, Hafid Ait-Oufella, Philippe Bonnin, Taassome Simon, Andrew
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
More informationFetal gene upregulation by 1-wk TAC is significantly increased in mice lacking RGS2.
3562-RG-1 Supplementary Figure 1 Fetal gene upregulation by 1-wk is significantly increased in mice lacking RGS2. ANP(Nppa) /BNP(Nppb) A-type and B-type natriuretic peptide; β-mhc (Myh7) beta myosin heavy
More informationdoi: /nature14508 Rappsilber et al.
SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa
More informationProbe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
More informationSpecimen. Humeral Head. Femoral Head. Objective. Femoral Condyle (medial) Supplementary Figure 1
A B Specimen Humeral Head 2 1 µm 76 µm Femoral Head Objective Femoral Condyle (medial) Supplementary Figure 1 A Femoral Head Global Cell Density Superficial Cell Density Cell Number at 1 µm Nuclei /.1
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationInternational Graduate Research Programme in Cardiovascular Science
1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.
More informationSupplementary Material
Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationVelocity Vector Imaging as a new approach for cardiac magnetic resonance: Comparison with echocardiography
Velocity Vector Imaging as a new approach for cardiac magnetic resonance: Comparison with echocardiography Toshinari Onishi 1, Samir K. Saha 2, Daniel Ludwig 1, Erik B. Schelbert 1, David Schwartzman 1,
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationNature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
More informationnature methods Organelle-specific, rapid induction of molecular activities and membrane tethering
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary
More information