Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.
|
|
|
- Rafe Porter
- 5 years ago
- Views:
Transcription
1 Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.
2 a Relative apob mrna (%) Relative apob mrna (%) Dose (mg/kg) Dose (mg/kg) Supplementary Figure 1 Comparison of Chol-siApoB-1 to SNALP formulated siapob-1 activity in mice. a, b, Dose-dependent silencing of liver apob mrna after administration of either Chol-siApoB-1 (a) or SNALP siapob-1 (b). Liver apob mrna levels were quantified relative to GAPDH mrna three days after i.v. administration of sirna. Data are mean values relative to the saline treatment group ± s.d. Chol-siApoB- 1 was administered at doses of, 5, 25, or 12.5 mg/kg (n = 6 per group) (a) and SNALP siapob-1 was administered at sirna doses of 1,.5,.25 and.1 mg/kg (n = 4 per group) (b). 12 %Injected Dose Sense Antisense Time (h) Supplementary Figure 2. Pharmacokinetics of SNALP-formulated siapob-2 in cynomolgus monkeys. Plasma clearance over a 24 h period of the sense and antisense strands of siapob-2 in animals treated with 2.5 mg/kg SNALP siapob-2 (n = 2). The time course is shown extending to 12 h as no sirna was detected at 24 h. Each data point represents the group mean ± s.d. of the percent injected dose.
3 a. % Injected Dose 1 1 % Injected Dose Time (h).1 Liver Spleen Lungs Kidney Heart Femur Thymus Small intestine Large intestine Muscle Fat Supplementary Figure 3. Pharmacokinetics and biodistribution of SNALP in mice. a, Plasma clearance and b, Tissue biodistribution of 3 H-CHE-labeled SNALP in BALB/c mice. Each mouse received a single i.v. injection of 2 mg/kg SNALP-formulated siapob-mm via the tail vein. Tissue biodistribution was analyzed 24 h after treatment. Data are expressed as mean ± s.d (n = 4). sirna: LL1 LL2 LL3 M1 M2 M3 RL1 RL2 RL3 C1 C2 C3 LL1 LL2 LL3 M1 M2 M3 RL1 RL2 RL3 C1 C2 C3 LL1 LL2 LL3 M1 M2 M3 RL1 RL2 RL3 C1 C2 C3 ApoB/GAPDH mrna SNALP siapob-2 cyno-1 SNALP siapob-2 cyno-2 Supplementary Figure 4. Uniform biodistribution and silencing activity of SNALPsiApoB-2 in liver. ApoB mrna and siapob-2 accumulation were quantitated in 12 separate liver biopsy samples collected from the left lateral lobe (LL), median lobe (M), right lateral lobe (RL) and caudate lobe (C) 24 h after animals were treated with either saline or 2.5 mg/kg SNALP siapob-2. ApoB mrna was quantified relative to GAPDH mrna. Data are mean values for three measurements per liver biopsy ± s.d.
4 a. c. sirna Cleavage Site siapob-2 Cleavage Site apob mrna 5 uagaagggaaucuuauauuugauccaaataa UCCCUUAGAAUAUAAACUAGGUU-5 siapob-2 AS RNA Adaptor GR5 GR5N ApoB Rev2 ApoB Rev1 ApoB GSP 3' wt apob mrna Sequence SNALP siapob-2 Cyno - 1 Cyno mg/kg Adaptor sirna Cleavage Site Supplementary Figure 5. Confirmation of RNAi-mediated gene silencing in nonhuman primates. a-c, 5 -RACE analysis demonstrating that silencing of apob mrna is due to RNAi-mediated mrna cleavage. (a) Scheme depicting the position of the predicted siapob-2 cleavage site relative to nested primers used for PCR amplification of the cleavage fragment. (b) Agarose gel of 5 RACE-PCR amplification product showing the predicted product of RNAi in the liver of SNALP siapob-2 treated animals and not in a saline-treated control animal. (c) Sequencing chromatograms of 5 -RACE PCR amplification products. The predicted site of siapob-2 mediated cleavage of apob mrna, 1 nucleotides from the 5 end of the antisense strand of siapob-2, is illustrated at top.
5 a apob/gapdh apob/gapdh A1 A2 A3 A4 B1 B2 B3 B4 C1 C2 C3 C4 2.5 mg/kg 1 mg/kg A5 A6 B5 B6 C5 C6 2.5 mg/kg 1 mg/kg Supplementary Figure 6. Silencing of jejunum apob mrna was not observed. a, b, ApoB mrna levels for eight tissue sections isolated from the jejunum were quantified relative to GAPDH mrna for each animal. Data are mean values ± s.d. Jejunum apob mrna levels 48 h after treatment (n = 4) (a) and 11 d after treatment (n = 2) (b).
6 Supplementary Table 1 a, ALT, AST, total bilirubin and urea nitrogen levels for saline and SNALP-treated cynomolgus monkeys.* ALT (U/l) AST (U/l) Bilirubin (mg/dl) Urea Nitrogen (mg/dl) Pre-dose 52 ± ± ±.8 22 ± 3 24 h 58 ± ± ±.8 19 ± 3 48 h 52 ± ± 18.4 ±.9 19 ± h 36 ± ± ±.7 21 ± h 34 ± 9 39 ± 5.3 ±. 24 ± 1 1. mg/kg Pre-dose 5 ± ± ±.8 21 ± 6 24 h 47± ± ±.4 19 ± 2 48 h 48 ± ± 2.3 ±. 19 ± h 51 ± ± ±.7 22 ± h 43 ± 7 38 ± 4.25 ±.7 21 ± mg/kg Pre-dose 47 ± ± ±.5 22 ± 3 24 h 152 ± ± ±.4 2 ± 3 48 h 1167 ± ± ± ± h 582 ± ± 16.3 ±. 2 ± h 151 ± ± ±.7 24 ± 1 *Values reported are the mean ± s.d. for each group. Pre-dose, 24 and 48 h time points had a group size of six and 144 and 264 h time points had a group size of two.
7 b, APTT, complement Bb, CH5, IL-6 and IFN-γ levels for saline and SNALP-treated cynomolgus monkeys. APTT (sec)* Complement Bb (µg/ml)* CH5 (U/ml)* IL-6 (pg/ml)** IFN-γ (IU/ml)** Pre-dose 26.8 ± ± ± h 25.7 ± ± ± h h h 25.2 ± ± ± h 25.9 ± h 25.6 ± mg/kg Pre-dose 24.6 ± ± ± h 24.2 ± ± ± h 24 h 48 h 24.3 ± 2..6 ± ± h 28.2 ±. 264 h 25.3 ± mg/kg Pre-dose 27. ± ± ± ± h 27. ± ± ± h 49.9 ± h 33.4 ± h 33.3 ± ± ± h 27.9 ± h 25.7 ± 4.2 *Values reported for APTT, complement Bb and CH5 are the mean ± s.d for each treatment group. Predose,.25 and 48 h time points had a group size of six and 144 and 264 h time points had a group size of two. **Values reported for the cytokines, IL-6 and IFN-γ, are derived from one saline animal or two 2.5 mg/kg treated animals (mean ± s.d.) in the case of IL6 and only one animal for each treatment for IFN-γ.
Phase 1 Trial of ALN-VSP in Cancers Involving the Liver. Annual Meeting of the Controlled Release Society August 2, 2011
Phase 1 Trial of ALN-VSP in Cancers Involving the Liver Annual Meeting of the Controlled Release Society August 2, 2011 Agenda ALN-VSP: Background Phase 1 Trial Study Design Safety Data Tumor Response
Pair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics. March 1, 2012 Akin Akinc, PhD
AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics March 1, 2012 Akin Akinc, PhD Lead Selection Alnylam RNAi Product Platform Turning
2011 ASH Annual Meeting Targeting the Hepcidin Pathway with RNAi Therapeutics for the Treatment of Anemia. December 12, 2011
211 ASH Annual Meeting Targeting the Hepcidin Pathway with RNAi Therapeutics for the Treatment of Anemia December 12, 211 Hepcidin is Central Regulator of Iron Homeostasis Hepcidin is liver-expressed,
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
Supplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in
T u m o r v o lu m e (m m 3 ) P e rc e n t s u rv iv a l P e rc e n t s u rv iv a l Supplementary data a 1 8 6 4 2 5 1 1 5 2 2 5 3 3 5 4 T im e a fte r tu m o r in o c u la tio n (d ) b c 1 5 1 1 5 * *
Translatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal
Translatability of cytokine data: from animals to humans Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Presentation outline Overview of cytokines Factors related
Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
Table S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
PCSK9 RNAi Therapeutics. Kevin FitzGerald
PCSK9 RNAi Therapeutics Kevin FitzGerald Presenter Disclosure Information PSCK9 RNAi Therapeutics The following relationships exist related to this presentation:» Kevin Fitzgerald and Alnylam team members:
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the
P-gp expression (% of control) 12 1 8 6 4 2 * * Untreated SipA SipA/pSipA WT Supplementary Figure 1. SipA modulates the expression of P-gp in healthy murine intestinal epithelium in vivo. Salmonella Typhimurium
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
Therapeutic Efficacy of a TLR7 Agonist for HBV Chronic Infection in Chimpanzees
Therapeutic Efficacy of a TLR7 Agonist for HBV Chronic Infection in Chimpanzees Robert Lanford 1, Bernadette Guerra 1, Deborah Chavez 1, Vida L. Hodara 1, Xubin Zheng 2, Grushenka Wolfgang 3, Daniel B.
Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supplementary Information Geometrical Confinement Directed Albumin-Based
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies Saul Kivimäe Senior Scientist, Research Biology Nektar Therapeutics NK Cell-Based Cancer Immunotherapy, September 26-27,
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Stacey Melquist #AHA16
Targeting apolipoprotein(a) with a novel RNAi delivery platform as a prophylactic treatment to reduce risk of cardiovascular events in individuals with elevated lipoprotein(a) Monday, November 14, 2016
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
O CYP1B1 CYP1A1 +DNA meh HO OH H NO 2. N OR NATs NQO1 N OH. SULTs
CYP CYP CYP +DN meh H H H H enzo[a]pyrene (ap) ap-7,8-dihydrodiol ap-7,8-dihydrodiol-9,0-epoxide (PDE) H H N N H N R NTs NQ SULTs +DN DN adducts DN adducts -Nitrobenzanthrone (-N) N-Hydroxy--aminobenzanthrone
Detection and significance of PD-1.3 SNP (rs ) and IL28B SNP (rs ) in patients with current or past hepatitis B virus (HBV) infection
Detection and significance of PD-1.3 SNP (rs11568821) and IL28B SNP (rs12979860) in patients with current or past hepatitis B virus (HBV) infection Asterios Saitis 1, Nikolaos K. Gatselis 1, Kalliopi Azariadi
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided into five regions: cortex, hippocampus,
Supplemental material Supplemental method RNA extraction, reverse transcription, and real-time PCR The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
Phenomena first observed in petunia
Vectors for RNAi Phenomena first observed in petunia Attempted to overexpress chalone synthase (anthrocyanin pigment gene) in petunia. (trying to darken flower color) Caused the loss of pigment. Bill Douherty
PK and PD Properties of Antisense Oligonucleotides: Bridging Nonclinical to Clinical
PK and PD Properties of Antisense ligonucleotides: Bridging Nonclinical to Clinical Rosie Z. Yu, Ph.D. Pharmacokinetics & Clinical Pharmacology Isis Pharmaceuticals, Inc. Carlsbad, CA USA 2 Antisense Mechanism
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
Supplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
Supplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
John Langowski, Ph.D. Nektar Therapeutics San Francisco, CA USA
NKTR-38: a selective, first-in-class IL-2 pathway agonist which increases number and suppressive function of regulatory T cells for the treatment of immune inflammatory disorders John Langowski, Ph.D.
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Nature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
ALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results
ALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results Kevin Fitzgerald, PhD Co-authors: Amy Simon 1, Suellen White 1,
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
LNA-mediated silencing of microrna-122 in African green monkeys
LNA-mediated silencing of microrna-122 in African green monkeys Supplementary information for Elmen and Lindow et al. February 25, 2008 This document contains details about the clinical parameters measured
Doctor of Philosophy
Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.
Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4
Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection
Supplemental Materials Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic hepatitis B infection Cai-Feng Chen 1#, Xia Feng 2#, Hui-Yu Liao 2#, Wen-Jing Jin 1, Jian Zhang 3, Yu Wang
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Cystinosis Research Foundation Progress Report. Energy homeostasis and muscle wasting in nephropathic cystinosis. Final Report
Cystinosis Research Foundation Progress Report Energy homeostasis and muscle wasting in nephropathic cystinosis Principle Investigator: Robert Mak, MD, PhD Institution: University of California, San Diego
Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of
Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of phosphatidylserine and phosphatidylcholine. The instrinsic
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Supporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
Supplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Alnylam RNAi Roundtable. May 13, 2011
Alnylam RNAi Roundtable May 13, 2011 Agenda & Introductions Welcome Cynthia Clayton» Senior Director, Investor Relations and Corporate Communications Program Overview Akshay Vaishnaw, M.D., Ph.D. (Moderator)»
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
Prurisol: A New Small Molecule under investigation for the treatment of Psoriasis
Prurisol: A New Small Molecule under investigation for the treatment of Psoriasis Krishna Menon, RCM, PhD, VMD, President of Research and Chief Scientific Officer MEDICAL DERMATOLOGY THERAPEUTIC R&D AND
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Supplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09626 Suppl. Table 1. Sequencing primers. B-RAF Forward Reverse Exon1 CGGCGACTTCTCGTCGTCTC CTGCATGACGGAGAGGGACA Exon2 CTGGCAGTTACTGTGATGTAGTTG CTTCCCAAATCTATTCCTAATCCCACC Exon3 GGACCATCTAGATATCACATATG
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION
BALANCE BETWEEN ESTROGE AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION Nadine Dragin 1, 2, 3,, Patrice Nancy 4, José Villegas 2, 3, 5, Régine
Serum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
VITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
Pharmaceutical Drug Development Consulting
Dr. Julia Eva Diederichs Pharmaceutical Drug Development Consulting Preclinical investigations and animal studies: for comprehensive characterisation what is scientifically possible and meaningful A Case
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)