Galactosylceramidase. (glucocerebroside)
|
|
- Chastity Bell
- 6 years ago
- Views:
Transcription
1 Table 10.1 Enzyme deficiencies and accumulating lipids in the main sphingolipidoses. Disease OMIM Clinical features Major lipid accumulation Enzyme defect Gene number affected Farber lipogranulomatosis (Farber disease) Generalized gangliosidosis (GM 1 gangliosidosis) Very early hoarseness, dermatitis, skeletal deformation, mental retardation, death usually before 2 years (Type I) (Type II) (Type III) Gaucher diease (Type I) (Type II) (Type III). Krabbe disease (globoid cell leukodystrophy) Metachromatic leukodystrophy (two forms) Niemann-Pick disease Types A and B Type I is infantile, severe with mental retardation, liver enlargement, skeletal deformities, red spot in retina; Type II is late-infantile/juvenile, Type III adult/chronic. Spleen and liver enlargement, erosion of long bones and pelvis; Types II and III involve nerve damage also; usually diagnosed in childhood but may be later Mental retardation, almost total absence of myelin, globoid bodies in white matter of brain; usual presentation by 6 months, death by 2 years Motor symptoms, rigidity, mental deterioration, and sometimes convulsions, onset in second year of life and death usually before 5 years; there are also later-onset forms including adult with slower progression (Type A) (Type B) As Type C (below) but ranging from a severe infantile form with neurologic degeneration and death by 3 years (type A) to a later-onset non-neurologic form (type B) compatible with survival into adulthood. Niemann-Pick disease Type C Usual onset 2-4 years of age. Neurologic abnormalities (ataxia, seizures, loss of speech), spasticity, dementia, psychiatric manifestations. Ceramide Acid ceramidase ASAH1 Ganglioside GM 1 (monosialotetrahexosylganglioside) Glucosylceramide (glucocerebroside) Galactocerebroside Galactosphingosulphatides Sphingomyelin Cholesterol (various cellular locations) and glycosphingolipids (in lysosomes) β-galactosidase-1 Acid beta-glucosidase (glucocerebrosidase) (cleaves the betaglucosidic linkage of glycosylceramide) Galactosylceramidase (Galactocerebrosidase) Aryl sulphatase A (hydrolyzes cerebroside sulphate) Sphingomyelin phosphodiesterase-1 (acid sphingomyelinase). Niemann-Pick disease, type C1, a sterol transporter (related to NPC1L1; see Box 7.2) GLB1 GBA GALC ARSA SMPD1 NPC1 (95% of cases) NPC2 (5% of cases) (continued ) 1
2 Table 10.1 (Continued ) Disease OMIM Clinical features Major lipid accumulation Enzyme defect Gene number affected Tay-Sachs disease Developmental retardation, paralysis, dementia and blindness; death in the second or third year. There are subtypes with more or less rapid onset. Ganglioside GM 2 (a structural variant of GM 1 ) (both are monosialotetrahexosylgangliosides) α-subunit of Hexosaminidase A Other GM Similar phenotype to Tay-Sachs Sandhoff disease: gangliosidoses disease β-subunit of Hexosaminidase A AB variant: GM2A activator protein Fabry disease (also Reddish purple skin rash, Gal-Gal-Glu-ceramide α-galactosidase A called Anderson- kidney failure, pain in lower (globotriaosylceramide) Fabry disease) extremities, one variant has cardiac disease, often seen in adulthood and may be slowlyprogressing. HEXA HEXB GM2A GLA OMIM: Online Mendelian Inheritance in Man ( and see text). Note that Niemann-Pick disease Type C is not strictly a disorder of sphingolipid catabolism, but that there is a secondary accumulation of sphingolipids. Table based on, and updated from EF Neufeld (1991) Lysosomal storage diseases. Annu Rev Biochem 60: and M Eckhardt (2010) Pathology and current treatment of neurodegenerative sphingolipidoses. Neuromol Med 12: See Chapter 2 for more on structures of lipids involved and Chapter 4 for more on their metabolism. 2
3 Table 10.2 Inborn errors of fatty acid oxidation. System affected Disease and enzyme deficiency OMIM number Gene affected Mitochondrial fatty acid transport Mitochondrial fatty acid oxidation Peroxisomal fatty acid oxidation Systemic carnitine deficiency (resulting from a defect in carnitine transport SLC22A5 into muscle cells through mutation in the transporter). CPT-1A (liver-specific) deficiency; deficiencies in CPT-1B (muscle type) and CPT1A CPT-1C (brain type) have not been reported. CPT-2 deficiency (infantile), (adult form) CPT2 VLCAD deficiency ACADVL MCAD deficiency (may be homozygous) ACADM SCAD deficiency ACADS LCHAD deficiency HADHA Mitochondrial trifunctional protein deficiency may be caused by mutations HADHA (α-subunit) in the α-subunit (includes LCHAD activity) or the β-subunit (LCKAT activity) HADHB (β-subunit) Adrenoleukodystrophy (also known as X-linked adrenoleukodystrophy); ABCD1 deficiency of ABCD1 Acyl-CoA oxidase deficiency ACOX1 Phytanoyl-CoA hydroxylase deficiency, Refsum disease PHYH There are more than 30 defects identified in the pathway of fatty acid oxidation, and this table is representative of the steps affected rather than exhaustive. See Further reading for more information and Section for details of FA oxidation. Based partly on P Rinaldo, D Matern & MJ Bennett (2002) Fatty acid oxidation disorders, Annu Rev Physiol 64: ; RJA Wanders, J Komen & S Kemp (2011) Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans. FEBS J 278: ABCD1, an ATP-binding cassette family transporter: see Section for further information on this family; CPT, carnitine palmitoyltransferase; LCHAD, long-chain 3-hydroxyacylacyl-CoA dehydrogenase; LCKAT, long-chain 3-ketothiolase; MCAD, medium-chain acyl-coa dehydrogenase; SCAD, short-chain acyl-coa dehydrogenase; VLCAD, very long-chain acyl-coa dehydrogenase. 3
4 Table 10.3 Some effects of platelet activating factor (PAF) in different cells/tissues. Cell/tissue Effect Implications Platelet Degranulation, aggregation Amine release, coronary thrombosis Neutrophil and other cells of the Chemotaxis, aggregation, superoxide generation; enhances Antibacterial activity immune system cytokine production Alveolar macrophage Respiratory bursts, superoxide generation Antibacterial activity Liver Inositide turnover, stimulationof glycogen breakdown Overall control of activity Hepatocytes, neurons Induces apoptosis; but in other cell types, e.g. epidermal cells, may be anti-apoptotic Removal of damaged cells, e.g. in alcoholic hepatitis. Exocrine secretory glands Similar effects to acetylcholine Overall control of activity Leukaemic cells Specific cytotoxicity towards the cells Treatment? Vascular permeability Mimics acute and chronic inflammation Pathogenesis of psoriasis? Lungs Increases airway and pulmonary oedema; decreases compliance Asthma and other respiratory conditions Tumours, Endothelial cells Enhanced angiogenesis and vascular remodelling Could contribute towards tumour growth and spread 4
5 Table 10.4 Composition of alveolar surfactant. (% w/w) Human Rabbit Rat Total protein Total lipid (% w/w of total lipid) Phosphatidylcholine (dipalmitoylphosphatidylcholine) (68) (63) (82) Phosphatidylglycerol Sphingomyelin Other phospholipids Cholesterol (free and esterified) Other lipids Percentage of phosphatidylcholine. 5
6 Table 10.5 Some genetic causes of lipodystrophy. Condition OMIM number Characteristics Defect Gene affected Congenital generalized lipodystrophy, or Berardinelli- Seip congenital lipodystrophy (various subtypes as below) Near absence of adipose tissue from birth or early infancy and severe insulin resistance. Altered glucose tolerance or (usually) diabetes, and hypertriacylglycerolaemia. Type acylglycerol-3-phosphate O-acyltransferase-2, involved in triacylglycerol synthesis (Section 4.1.1) Type The most severe form: patients are born Seipin, a protein named after the without any adipose tissue. (In the other condition, involved in lipid droplet subtypes, at least mechanical adipose formation in adipocytes. depots, in joints, are preserved.) Type Caveolin 1, a scaffolding protein involved in membrane function (Section 5.3.3). Type Includes muscular dystrophy Polymerase I and transcript release factor (hence name of gene) but this protein, also called cavin, also plays a critical role in the formation of caveolae and the stabilization of caveolins. Familial partial lipodystrophy Gradual loss of peripheral adipose tissue (FPLD) (various types as below) especially on the limbs and buttocks with preservation of subcutaneous fat on the trunk; often starts to become apparent around puberty. FPLD Type 2, Dunnigan type The commonest form. Mutations Lamin A/C is a member of the family of lipodystrophy elsewhere in the same gene cause lamin proteins involved in nuclear muscular dystrophy. Heterozygous stability. condition. FPLD Type The next most common form. Severe PPAR -γ (Section 7.3.2) is a key regulator insulin resistance. Heterozygous of adipocyte differentiation. condition. FPLD Type Rare cause of FPLD. Heterozygous Perilipin 1, a lipid droplet-associated condition. protein involved in adipocyte lipolysis (Box 9.1). FPLD Type One patient described. Adipocytes in Cell-death-inducing DNA fragmentation affected patient have multilocular rather factor a-like effector c (CIDEC), a lipid than unilocular lipid droplets. droplet protein. AKT2 mutations Not Very rare cause of severe insulin Akt1 and Akt2 are protein serine/ listed resistance, diabetes and lipodystrophy. threonine kinases, also known as protein Heterozygous condition. kinase B, involved in insulin signalling. CAV1 mutations Not Atypical partial lipodystrophy with Caveolin 1, mutations of which may also listed hypertriacylglycerolaemia; only cause generalized lipodystrophy (see described in small number of patients. above; see also Section for Fat loss from upper body only. description of caveolins). Heterozygous condition. AGPAT2 BSCL2 CAV1 PTRF LMNA PPARG PLIN1 CIDEC AKT2 CAV1 OMIM: Online Mendelian Inheritance in Man ( and see Section 10.1). PPAR-γ, peroxisome proliferator-activated receptor-γ. Note: FPLD Type 1, or Kobberling-type lipodystrophy, does not have a defined genetic cause. The classification of FPLD sub-types here is based on OMIM. Garg (2011) in Further reading numbers them differently. Conditions noted as heterozygous are inherited inanautosomaldominantmanner; othersare autosomal recessive (i.e. manifest inthe homozygousform). 6
7 Table 10.6 The classification of hyperlipidaemias according to phenotype. Type Serum cholesterol Serum triacylglycerol Particles accumulating Usual underlying defect Treatment I Chylomicrons Lipoprotein lipase deficiency; apolipoprotein CII deficiency IIa ++ N LDL LDL receptor defect or LDL overproduction IIb VLDL, LDL VLDL or LDL overproduction or impaired clearance III + ++ Chylomicronand Impaired remnant removal; may be due VLDL- to particular isoform of apolipoprotein remnants E, or apo-e deficiency IV N or + ++ VLDL VLDL overproduction or clearance defect V Chylomicrons, Lipoprotein lipase defect (not complete VLDL and absence) or apolipoprotein CII remnants deficiency Low-fat diet; medium-chain triacylglycerols to replace long-chain fatty acids Reduce dietary saturated fat and cholesterol; resins; statin drugs (HMGCoA reductase inhibitors) Reduce dietary saturated fat and cholesterol; reduce weight; fibrate drugs (PPAR-α activators); statins Reduce dietary saturated fat and cholesterol; fibrates; statins Reduce weight if obese, reduce alcohol intake; n-3 PUFA supplementation; fibrates This is known as the Fredrickson classification. N, normal; +, mildly raised; ++, moderately raised; +++, severely raised. Resins are nonabsorbed compounds that bind bile salts and cholesterol in the gastrointestinal tract so that they are excreted (see Section 7.1.2). 7
8 Table 10.7 Inborn errors of lipoprotein metabolism. Disease and enzyme deficiency Characteristics OMIM number Gene affected Conditions raising lipoprotein concentrations Familial hypercholesterolaemia (LDL-receptor deficiency) Familial combined hyperlipidaemia Lipoprotein lipase deficiency or familial chylomicronaemia syndrome (Fredrickson Type I hyperlipoproteinaemia) Sitosterolaemia Heterozygous form leads to isolated raised serum cholesterol concentration (Fredrickson Type IIa) and, if not recognized and treated, often myocardial infarction in early middle-age. It is very readily treated with statin drugs (inhibitors of HMG-CoA reductase: Section 7.3.1), and adequately-treated patients have normal life expectancy. Elevation of both cholesterol and TAG concentrations in serum in a variable fashion. Accumulation of chylomicrons in the plasma gives creamy appearance (reflecting the normal role of LPL in hydrolysing or clearing chylomicron-triacylglycerols: Section 7.2.5). In the heterozygous state there is sufficient LPL activity for almost normal triacylglycerol clearance but carriers may display features of familial combined hyperlipidaemia. Clinical manifestations similar to familial hypercholesterolaemia but with normal or moderately elevated serum cholesterol concentrations. Plant sterol concentrations in blood are markedly elevated LDLR Heterogeneous: see text LPL ABCG5 or ABCG8 Conditions resulting in lower lipoprotein concentrations Chylomicron retention disease or Anderson Severe fat malabsorption and failure to thrive in infancy. (or Anderson s) disease Deficiency of fat-soluble vitamins, low serum cholesterol concentrations, and a selective absence of chylomicrons from blood. Accumulation of chylomicron-like particles in membrane-bound compartments of enterocytes, which contain large cytosolic lipid droplets. Abetalipoproteinaemia Defect in microsomal triacylglycerol transfer protein which plays a critical role in VLDL assembly (Sections 5.6.2, and Fig. 7.5). There may be signs of fat malabsorption, and neurological and visual impairment. A characteristic finding is abnormally shaped red blood cells (often star-shaped) reflecting abnormal membrane phospholipid composition, secondary to the changes in lipoprotein concentration and composition. Tangier disease Very low circulating high-density lipoprotein (HDL)-cholesterol concentrations. Clinically, a peculiar and distinguishing feature is large orange-yellow tonsils. In the absence of normal ABCA1-mediated cholesterol efflux, cholesterol-laden macrophages accumulate in lymphoid tissues such as the tonsils, and since their lipids are derived ultimately from the diet, they include fat-soluble pigments such as β-carotene. Lecithin-cholesterol acyltransferase deficiency Clinical manifestation differs according to the exact nature of (one variant called fish-eye disease) the mutation. Fish-eye disease is so-called because of corneal opacities. Despite low HDL-cholesterol concentrations (see Section below), patients do not seem to have increased risk of CHD SAR1B MTTP ABCA LCAT and OMIM: Online Mendelian Inheritance in Man ( and see Section 10.1). 8
9 Table 10.8 Features of the atherogenic lipoprotein phenotype. Feature Hypertriacylglycerolaemia (often called hypertriglyceridaemia) Low serum HDL-cholesterol concentration Small, dense LDL particles Hyperapobetalipoproteinaemia (high concentration of apob-100 in serum) Insulin resistance Comment May by relatively mild, but usually is more marked after meals Reflects impairment of triacylglycerol-rich lipoprotein metabolism Total LDL-cholesterol concentration may be normal, hence number of particles must be increased Reflects increased number of LDL particles, as above These features are often associated with impaired action of insulin on metabolic processes 9
METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS. Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry
METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry STORAGE AND MEMBRANE LIPIDS STORAGE LIPIDS Mainly as triacylglycerols (triglycerides) in adipose cells Constitute
More informationMetabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
More informationFatty Acids Synthesis L3
Fatty Acids Synthesis L3 The pathway for fatty acid synthesis occurs in the cytoplasm, whereas, oxidation occurs in the mitochondria. The other major difference is the use of nucleotide co-factors. Oxidation
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More informationThe role of the laboratory in diagnosing lysosomal disorders
The role of the laboratory in diagnosing lysosomal disorders Dr Guy Besley, formerly Willink Biochemical Genetics Unit, Manchester Children s Hospital, Manchester M27 4HA, UK. Lysosomal disorders What
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationMEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS
December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,
More informationChapter VIII: Dr. Sameh Sarray Hlaoui
Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.
More informationRegulating Hepatic Cellular Cholesterol
Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More informationPPAR history of research
PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,
More informationLipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
More informationLipid storage diseases
Lipid storage diseases What are lipid storage diseases? Lipid storage diseases, or the lipidoses, are a group of inherited metabolic disorders in which harmful amounts of fatty materials called lipids
More informationATP III (Adult Treatment Panel III) CLASSIFICATION C IN ADULTS
LABORATORY AND RISK FACTORS OF ATHEROSCLEROSIS S R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty RISK FACTORS FOR CHD Clinical Risk Factors Laboratory Risk Factors MAJOR CLINICAL RISK
More informationTest Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationAbdallah Q& Razi. Faisal
27 & Ahmad Attari م ح م د ي وس ف Abdallah Q& Razi Faisal Sphingophospolipids - The backbone of sphingophospholipids is sphingosine, unlike glycerophospholipids with a glycerol as the backbone. Which contains
More informationLipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationTHE CLINICAL BIOCHEMISTRY OF LIPID DISORDERS
THE CLINICAL BIOCHEMISTRY OF LIPID DISORDERS Hormonal regulation INSULIN lipid synthesis, lipolysis CORTISOL lipolysis GLUCAGON lipolysis GROWTH HORMONE lipolysis CATECHOLAMINES lipolysis LEPTIN catabolism
More informationANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD
ANTIHYPERLIPIDEMIA Darmawan,dr.,M.Kes,Sp.PD Plasma lipids consist mostly of lipoproteins Spherical complexes of lipids and specific proteins (apolipoproteins). The clinically important lipoproteins, listed
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationBy: Dr Hadi Mozafari 1
Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms
More informationLipid Metabolism in Familial Hypercholesterolemia
Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationOVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S
LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin
More informationWhat s New in Newborn Screening?
What s New in Newborn Screening? Funded by: Illinois Department of Public Health Information on Newborn Screening Newborn screening in Illinois is mandated and administered by the Illinois Department of
More informationDr. Nafith Abu Tarboush
6 Dr. Nafith Abu Tarboush June 26 th 2013 Noor Salem 1 Not corrected Review Lipids are composed of two main connected parts : o Alcohol Sphingosine Glycerol o Fatty Acids (3 in number) Saturated Long Chain
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship
More informationLipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals
Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationWhat s New in Newborn Screening?
What s New in Newborn Screening? Funded by: Illinois Department of Public Health Information on Newborn Screening Newborn screening in Illinois is administered by the Illinois Department of Public Health.
More informationLipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10
1 Lipids Lehninger 3 rd ed. Chapter 11 (For biosynthesis see Chapter 21) 2 Lipids: a Diverse group of chemicals Insolubility in water. Fats and oils: energy stores. Phospholipids and sterols: structural
More informationLipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels
Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital
More informationLipids, lipoproteins and cardiovascular disease
Lipids, lipoproteins and cardiovascular disease Presented by Dr. Mohammad Saadeh The requirements for the Clinical Chemistry Philadelphia University Faculty of pharmacy Cardiovascular disease Plasma enzymes
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Lipid disorders: Disorders of lipid metabolism are manifest by elevation of the plasma concentrations of the various lipid and lipoprotein fractions (total and LDL cholesterol,
More informationSphingolipids. Sphingolipids are an additional type of membrane lipids, after glycerophospholipids, galactolipids and sulfolipids
Lipids 2 Steven E. Massey, Ph.D. Assistant Professor of Bioinformatics Department of Biology and Environmental Sciences University of Puerto Rico Río Piedras Office & Lab: Bioinformatics Lab NCN#343B Tel:
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationTEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON
Link full download: https://testbankservice.com/download/testbank-for-lehninger-principles-of-biochemistry-6th-edition-bynelson TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON
More informationLecture 3 6/28/10. Membrane Lipids. Importance of Membranes. Categories of Lipids. Lipids: Chapter 20 Sections 4-7. ! Membranes are important in
Lecture 3 Lipids: Chapter 20 Sections 4-7! The most polar lipids are found in the membranes of cells and organelles! Why?! These lipids are amphipathic! Membranes are complex and have many components Membrane
More informationGlossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
More informationLipoatrophic Diabetes: What can zebras teach us about horses? Ranganath Muniyappa, MD, PhD Diabetes, Endocrinology, and Obesity Branch NIDDK, NIH
Lipoatrophic Diabetes: What can zebras teach us about horses? Ranganath Muniyappa, MD, PhD Diabetes, Endocrinology, and Obesity Branch NIDDK, NIH Objectives 1. Describe the clinical manifestations of abnormal
More informationLipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague
Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationCellular control of cholesterol. Peter Takizawa Department of Cell Biology
Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationBIOL2171 ANU TCA CYCLE
TCA CYCLE IMPORTANCE: Oxidation of 2C Acetyl Co-A 2CO 2 + 3NADH + FADH 2 (8e-s donated to O 2 in the ETC) + GTP (energy) + Heat OVERVIEW: Occurs In the mitochondrion matrix. 1. the acetyl portion of acetyl-coa
More informationHypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002
Hypertriglyceridemia Ara Metjian, M.D. Resident s Report 20 December 2002 Review of Lipids Chylomicrons (CM): Dietary lipids absorbed through the GI tract are assembled intracellularly into CM. Very Low
More informationPart 1 Risk Factors and Atherosclerosis. LO1. Define the Different Forms of CVD
Week 3: Cardiovascular Disease Learning Outcomes: 1. Define the difference forms of CVD 2. Describe the various risk factors of CVD 3. Describe atherosclerosis and its stages 4. Describe the role of oxidation,
More informationCHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna
Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationSTRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty
STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE OF LIPIDS AND LIPOPROTEINS DEFINTITION: Compounds Insoluble in water But
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationPodcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam
Podcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam Howard J. Sachs, MD www.12daysinmarch.com Email: Howard@12daysinmarch.com Podcast (Video Recorded
More informationFABRY DISEASE 12/30/2012. Ataxia-Telangiectasia. Ophthalmologic Signs of Genetic Neurological Disease
Ophthalmologic Signs of Genetic Neurological Disease ES ROACH,MD. Ophthalmologic Signs of Genetic Neurological Disease Conjunctival lesions Corneal lesions Lesions of iris & lens Retinal vascular lesions
More informationClinical Approach to Diagnosis of Lysosomal Storage Diseases
Clinical Approach to Diagnosis of Lysosomal Storage Diseases M. Rohrbach, MD, PhD FMH Pädiatrie und FMH Medizinische Genetik Abteilung Stoffwechsel Universitätskinderklinik Zürich Lysosomal storage disorders
More informationMembrane Lipids & Cholesterol Metabolism
Membrane Lipids & Cholesterol Metabolism Learning Objectives 1. How Are Acylglycerols and Compound Lipids Produced? 2. The synthesis of Sphingolipids from Ceramide 3. Diseases due to Disruption of Lipid
More informationAcetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
More informationBBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester
BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester Section Director: Dave Ford, Ph.D. Office: MS 141: ext. 8129: e-mail: fordda@slu.edu Lecturers: Michael Moxley, Ph.D. Office: MS
More informationnumber Done by Corrected by Doctor
number 26 Done by حسام أبو عوض Corrected by Zaid Emad Doctor فيصل الخطيب 1 P a g e A small note about phosphatidyl inositol-4,5-bisphosphate (PIP2) before moving on: This molecule is found in the membrane
More informationSome common classifications of lipids and their general biologic functions Primary Functions Energy sources, biosynthetic precursors
NATURE F LIPIDS. Lipids have a hydrophobic nature because of the predominance of hydrocarbon chains ( H 2 H 2 H 2 ) in their structure. They are insoluble or only poorly soluble in water, but readily soluble
More informationThin layer absorption chromatography can achieve very good separation of small lipid samples
Abbreviations Preface Acknowledgements Lipids: definition, isolation, separation and detection p. 1 Introduction p. 1 Definitions p. 1 Structural chemistry and nomenclature p. 1 Extraction of lipids from
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationEffects of Infection and Inflammation on Lipid and Lipoprotein Metabolism: Mechanisms and
Effects of Infection and Inflammation on Lipid and Lipoprotein Metabolism: Mechanisms and Consequences to the Host Weerapan Khovidhunkit*, Min-Sun Kim, Riaz A. Memon**, Judy K. Shigenaga, Arthur H. Moser,
More informationSELECTIVE VULNERABILITY (HYPOXIA AND HYPOGLYCEMIA)
DEFICIENCY OF METABOLITE -HYPOXIA AND HYPOGLYCEMIA -HYPOVITAMINOSIS SELECTIVE VULNERABILITY (HYPOXIA AND HYPOGLYCEMIA) -SPECIFIC CELL TYPE NEURONS>OLIGODENDROCYTES>ASTROCYTES -SPECIFIC BRAIN REGION PYRAMIDAL
More informationAntihyperlipidemic drugs
Antihyperlipidemic drugs The clinically important lipoproteins are LDL low density lipoprotein, VLDL very low density lipoprotein, HDL high density lipoprotein. Hyperlipidemia may caused 1. by individual
More informationPhospholipids, Triglycerids. Léránt István
Phospholipids, Triglycerids Léránt István Membran lipids Phosphatidic acids COMMON INTERMEDIER IN Biosynthesis of Glycerol Fatty acid Fatty acid Fatty acid Glycerol Fatty acid Fatty acid P Alcohol phospholipids
More informationChapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
More informationInborn Error Of Metabolism :
Inborn Error Of Metabolism : Inborn Error Of Metabolism inborn error of metabolism are a large group of hereditary biochemical diseases in which specific gene mutation cause abnormal or missing proteins
More informationHypertriglyceridemia: Why, When, and How to Treat. Gregory Cohn, MD, FNLA, FASPC
Hypertriglyceridemia: Why, When, and How to Treat Gregory Cohn, MD, FNLA, FASPC DISCLOSURES Consultant to Akcea Therapeutics (in the past 12 months). OUTLINE I. Lipoproteins II. Non-HDL-C III. Causes and
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types
More informationDietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)
Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild
More informationBio 366: Biological Chemistry II Test #1, 100 points (7 pages)
Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the
More informationLIPIDS II: TRIACYLGLYCEROLS:
LIPIDS II: TRIACYLGLYCEROLS: How are they broken down? o Hydrolyzed into 3 fatty acids and 1 glycerol o Physiologically in body: Enzyme called a LIPASE present in adipocytes and intestines o Saponification
More informationChapter 16 - Lipid Metabolism
Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them
More informationQuestion (1) ) Put the sign ( ) against the right sentences and the sign (X) against the wrong sentences:(10 Marks)
Course No: PHARM 2315 Course Title:Biochemistry Date: 01/06/ 2017 No. of Questions: (5) Time: TWO hours Using Calculator (Yes) University of Palestine Final Exam Second Semester 2016/2017 Total Grade:
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationI. Structure and Properties of Lipids
I. Structure and Properties of Lipids Lipids: A diverse group of compounds characterized by their low solubility in water and a high solubility in organic solvents such as chloroform and methanol. Nonpolar
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationFatty Acid and Triacylglycerol Metabolism 1
Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure
More informationChapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids
Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids Sven-Olof Olofsson, Pontus Boström, Jens Lagerstedt, Linda Andersson, Martin Adiels, Jeanna Perman,
More informationCholesterol Metabolism
Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationThematic review series: The Pathogenesis of Atherosclerosis
thematic review Thematic review series: The Pathogenesis of Atherosclerosis Effects of infection and inflammation on lipid and lipoprotein metabolism: mechanisms and consequences to the host 1 Weerapan
More informationDYSLIPIDEMIA PHARMACOLOGY. University of Hawai i Hilo Pre- Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D
DYSLIPIDEMIA PHARMACOLOGY University of Hawai i Hilo Pre- Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D 1 LEARNING OBJECTIVES Know normal cholesterol levels Understand what the role
More informationClinical Cell Biology Organelles in Health and Disease
Department of Ophthalmology University of Kiel, University Medical Center Director: Prof. Dr. Johann Roider Clinical Cell Biology Organelles in Health and Disease Prof. Dr. Alexa Klettner Clinical cell
More information23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in
Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets
More informationPhospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
More informationMMBS, MMED (Path),MAACB, MACTM, MACRRM
Dr Mere Kende MMBS, MMED (Path),MAACB, MACTM, MACRRM Lecturer- SMSH Brief Overview of Lipids What is dyslipidemia? Classification of hyperlipidemia Primary vs secondary hyperlipidemia Hypercholesterolaemia
More informationN-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP
Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA
More informationIs it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics
Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein
More informationIntermediary metabolism. Eva Samcová
Intermediary metabolism Eva Samcová Metabolic roles of tissues Four major tissues play a dominant role in fuel metabolism : liver, adipose, muscle, and brain. These tissues do not function in isolation.
More information