AGENDA for 02/11/14 AGENDA: HOMEWORK: Due Thurs, OBJECTIVES: Quiz tomorrow, Thurs, : The Genetic Code

Size: px

Start display at page:

Download "AGENDA for 02/11/14 AGENDA: HOMEWORK: Due Thurs, OBJECTIVES: Quiz tomorrow, Thurs, : The Genetic Code"

Catherine Gregory
6 years ago
Views:

1 AGENDA for 02/11/14 AGENDA: : The Genetic Code HOMEWORK: Due Thurs, Activity Packet OBJECTIVES: 1. Decode the DNA message 2. Investigate the effect that various mutations have on protein production Quiz tomorrow, Thurs, 02-13

2 3.2 Key Terms 1. Amino Acid 2. Anticodon 3. Codon 4. Hydrophilic 5. Hydrophobic 6. Messenger RNA (mrna) 7. Mutation 8. Nucleotide 9. Protein 10.Protein Synthesis 11.Ribonucleic Acid (RNA) 12.Ribosome 13.Transcription 14.Transfer RNA (trna) 15.Translation

3 Essential Questions for How does the sequence of nucleotides in DNA determine the sequence of amino acids in a protein? 5. What is a mutation?

4 Activity Objectives Decode the DNA message 2. Investigate the effect that various mutations have on protein production

5 Conclusion Question 1. Describe (in words) the effect of the mutation. 2. Was the mutational effect greater in a substitution or a deletion? Explain your answer clearly. 3. Why do you think scientists call a substitution a point mutation? Why do you think scientists call a deletion (or an insertion) a frameshift mutation? 4. Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the 15 th base was changed from a G to a T. Fill in the corresponding mrna, trna, and letter in the blanks below for the mutated DNA strip. In the space below, explain how this point mutation changes the protein. Normal DNA: GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG mrna: CAACCGCUUACUUGCCUCCGACUGCAGATTCGGAUCUUU UUAACC trna: GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG Sentence: SHE READS A LOT Mutated DNA: GTTGGCGAATGAAC_T GAGGCTGACGTCTAAGCCTAGAAAAATTGG mrna: CAACCGCUUACUUG CUCCGACUGCAGATTCGGAUCUUU UUAACC trna: GUUGGCGAAUGAAC GAGGCUGACGUCUAAGCCUAGAAAAAUUGG Sentence: SHE EADS A LOT 5. What is the difference between normal and sickle hemoglobin at the DNA, RNA, and protein (amino acid) level? 6. What type of mutation is the sickle hemoglobin mutation? Explain. 7. Glutamic acid (Glu) and valine(val) are two amino acids with different molecular structures. (Glutamic acid is a strongly hydrophilic molecule, and valineis a strongly hydrophobic molecule. This is something you will learn more about in the next activity). Why do you think switching the hemoglobin gene s sixth amino acid from glutamic acid to valinewould affect the hemoglobin protein?

6 3.2.2 Activity Checklist Transcribe and Translate Animation (NB) STAMP DNA, mrna and Protein Cut-Outs (NB) STAMP Mistakes Happen (NB) Hemoglobin Sequences (NB) Conclusion Questions 4 (NB) Participation STAMP Total = 16

7 Activity Directions

8 Transcribe and Translate Animation (NB) 1. Refer to curriculum file for more detailed instructions 2. Refer to steps Complete the animation 4. In your NB, write the: 1. Original DNA message 2. mrna codon 3. trna anticodon 4. Sequence of animo acid produced 5. Raise your hand that you have completed the animation (Mr. Hwang will check on his monitor that you have reached the final step of the animation) 6. Get a stamp

9 DNA, mrna and Protein Cut-Outs (NB) 1. Refer to curriculum file for more detailed instructions 2. Refer to steps Each group will be assigned 2DNA sequences in order to decode a protein message 4. From your assigned DNA fragment: 1. Create the corresponding mrna sequence using the cutouts 2. Create the corresponding trna and protein sequence 5. Write the DNA, mrna and the resulting protein sentence in your NB (see step 12) 6. Get a stamp for your cut-out sequences

11 Mistakes Happen 1. Refer to curriculum file for more detailed instructions 2. Refer to steps You will create 2 mutations to each of your 2 DNA sequences (this will be done in your NB with a pen/pencil instead of using the cut-outs) 1. Create substitution mutation (see step 13) 2. Create a deletion mutation (see step 16) 4. Write out the DNA, mrna and resulting proteins for each of the mutations to your 2 DNA sequences in your NB

12 Hemoglobin Sequences (NB) 1. Refer to curriculum file for more detailed instructions 2. Refer to steps You will transcribe and translate 2 sequences in your NB: 1. DNA sequence for normal hemoglobin 2. DNA sequence for Sickle hemoglobin 4. Write the DNA, mrna and amino acid sequences in your NB

13 Conclusion Questions 4 (NB) 1. Refer to curriculum file for more detailed instructions 2. Answer Conclusion Question 4 in your NB

14 Participation 1. Instead of answering Conclusion Questions, we will be trying something different this semester 2. After the activity, reflect on the questions and the objectives of the activities 3. Be prepared to give your responses to: a) Essential Questions b) Conclusion Questions c) Questions about Key Terms d) Questions about the activities e) Your thoughts and explanations 4. You will receive a stamp for 3satisfactory responses

15 Career Journals 1. Refer to curriculum file for more detailed instructions. 2. The career journals will be turned in separately and scored separately from this activity packet 3. Refer to steps You will research 2 careers: 1. Hematologist 2. You get to choose, but it must be a professional mentioned in the diary entries or approved by Mr. Hwang (must be related to this topic and activity) 5. Due Tues, (turned in separately) Next slide has instructions for the correct formatting of your career journals Worth 10 points (5 points each)

16 Career Journals 1. Correct Title All CAPS 2. Education and Training include all required degrees, field and major of study Specific types of certifications, licensing, or training Time/years of study Bullet each of the above 3. Responsibilities and Duties Bullet each responsibility and duty starting with a verb (action word leave out the subject) Must include at least 5 4. Salary Low High Average 5. Documentation At least 2 Must use.edu,.gov,.org (.com only if approved by Mr. Hwang first) Must be in correct APA format 6. Self-Reflection Summary of the description of job 1 advantage of job 1 disadvantage of job Reason you would like or dislike the job

AGENDA for 03/06/14 AGENDA: HOMEWORK: Due Fri, 03/07 OBJECTIVES: Unit 3 Exam on Tues, What is the Probability?

AGENDA for 03/06/14 AGENDA: HOMEWORK: Due Fri, 03/07 OBJECTIVES: Unit 3 Exam on Tues, What is the Probability? AGENDA for 03/06/14 AGENDA: 1. 3.4.2. What is the Probability? OBJECTIVES: 1. Use pedigrees and Punnett squares to calculate the probability than an individual will inherit sickle cell disease HOMEWORK: