저작권자로부터별도의허가를받으면이러한조건들은적용되지않습니다. 저작권법에따른이용자의권리는위의내용에의하여영향을받지않습니다.

Transcription

1 저작자표시 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이저작물을영리목적으로이용할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우, 이저작물에적용된이용허락조건을명확하게나타내어야합니다. 저작권자로부터별도의허가를받으면이러한조건들은적용되지않습니다. 저작권법에따른이용자의권리는위의내용에의하여영향을받지않습니다. 이것은이용허락규약 (Legal Code) 을이해하기쉽게요약한것입니다. Disclaimer

2 ABSTRACT HDAC Inhibitor Trichostatin A Promotes Proliferation and Odontoblast Differentiation of Human Dental Pulp Stem Cells Hexiu Jin Department of Oral and Maxillofacial Surgery School of Dentistry The Graduate School Seoul National University (Directed by Prof. Pill-Hoon Choung, D.D.S., M.S.D., Ph.D.) Objectives Mesenchymal stem cells were isolated from the human extracted tooth and named as human dental mesenchymal stem cells (hdmscs). They were originated from various kinds of dental tissues, such as dental pulp, periodontal ligament, periapical follicle, and alveolar bone marrow and proved to have different proliferation and differentiation abilities. Among the hdmscs, dental pulp stem cells (DPSCs) were known as i

3 undifferentiated ectomesenchymal cells which can differentiate into neural cells and mineral forming cells, especially odontoblasts; the precursor cells for dentin formation. Inspite of the crucial functions of odontoblast in tooth development and dental tissue regeneration processes, the studies for searching a key molecule and its essential mechanism for differentiation are still ongoing and not a single factor are related. Various histone deacetylases (HDAC) inhibitors are reported to enhance osteoblast differentiation in multiple cell types, including osteoblasts, bone marrow mesenchymal cells, and adipose-derived stromal cells. Trichostatin A (TSA) is a hydroxamic acid and block the activity of all HDACs with similar affinities. TSA is well known to regulate diverse cellular mechanisms including differentiation of mesenchymal stem cells. However, the effects of TSA on the hdpscs and its precise molecular mechanism remains unclear. Methods We first evaluated the TSA effect on human dental pulp stem cells (hdpscs) in vitro, which were derived from the pulp of human third molars. In order to find out the roles of TSA during mouse tooth development, we next investigated the biological effect of ii

4 morphological structure of dentin, odontoblast differentiation, and odontoblast specific gene, DSP, comparing the dentinogenesis of exogenous TSA treated mouse with control group in vivo. We used 5-day pregnant ICR mice and divided into two experimental groups, a TSA injected group received a TSA injection into the tail vein from pregnancy day 6.5 to 17.5 days before delivery (10 injected) and an un-injected group (control group). Then embryo mice and newborn mice were sacrificed at the embryo 17.5 day (E17.5) and postnatal day 7 (P7). Results We observed that TSA increased the expression of proliferating cell nuclear antigen (PCNA) and Cyclin D1 in hdpscs at a certain concentration and the activation of JNK/c- Jun pathway was essential for TSA-dependent hdpscs proliferation. Furthermore, TSA accelerated mineral nodule formation in vitro and increased gene expression of dentin sialophosphoprotein (DSPP), dentin matrix protein 1 (DMP1), bonesialoprotein (BSP) and osteocalcin (OCN). In addition, TSA significantly up-regulated the levels of phospho-smad2/3, Smad4, and NFI-C. Moreover, TSA-injected hdpscs exhibited strong DSP expression and increased dentin thickness, larger dentin areas and higher odontoblast numbers in their postnatal molars in vivo. Interestingly, the lower cusp tips iii

5 showed that TSA may also influence tooth morphogenesis. These results suggest that TSA induces proliferation and odontoblast differentiation of hdpscs, while promoting dentin formation in dental development stages. Conclusion In this study, we demonstrated that TSA promotes proliferation and odontoblast differentiation of hdpscs in vitro and has the ability to enhance dentin formation and odontoblast differentiation in vivo during tooth development Keywords: HDAC Inhibitor, human dental pulp stem cells, odontoblast, dentin Student Number: iv

6 CONTENTS ABSTRACT i CONTENTS..ⅴ LIST OF FIGURES ⅷ ABBREVIATIONS...x I. INTRODUCTION 1. Dental mesenchymal stem cells Osteoblasts and odontoblasts Roles of histone deacetylases inhibitor Smad-NFIC signaling Purpose of this study...7 II. MATERIALS AND METHODS 1. Primary cell culture Flow cytometric analysis Immunofluorescence staining Cell proliferation assay v

7 5. Western blot analysis RNA preparation and real-time PCR analysis Alkaline phosphatase (ALP) staining Alizarin red S staining ICR pregnant mouse injection model Histological analysis Histomorphometric analysis Immunohistochemical analysis Statistical analysis III. RESULTS 1. Isolation of human dental pulp stem cells Characterization of human dental pulp stem cells TSA increased proliferation of hdpscs in vitro TSA stimulates proliferation of hdpscs via JNK and c-jun phosphorylation TSA induces differentiation of hdpscs in vitro TSA enhances expression of odonto/osteogenic differentiation markers in hdpscs in vitro.36 7.TSA stimulates differentiation of hdpscs via MEK and ERK vi

8 phosphorylation TSA-induced odontoblast differentiation was mediated by Smad2/3 and possible NFI-C dependent pathways.41 9.TSA did not induce odontoblast differentiation of DPSCs at E 17.5 during murine tooth development stages TSA increased dentin formation and possible odontoblast differentiation of DPSCs at P 7 day during murine tooth development stages TSA increased the expression of DSP at P7 during murine tooth development stages. 50 IV. DISCUSSION..54 V. CONCLUSION.60 VI. REFERENCES..61 VII. ABSTRACT IN KOREAN...73 vii

9 LIST OF FIGURES Figure 1. The destiny of mesenchymal stem cells....2 Figure 2. Osteoblast and odontoblast differentiation Figure 3. Intravenous injection mouse model Figure 4. Characterization of hdpscs with ICC Figure 5. Characterization of the expression of cell surface markers Figure 6. TSA increases the proliferation ability of hdpscs Figure 7. TSA up-regulates the JNK/c-Jun pathway for proliferation in hdpscs..32 Figure 8. Effects of TSA on differentiation of hdpscs 35 Figure 9. Effects of TSA on the expression of odontoblast differentiation markers..37 Figure 10. TSA up-regulates MEK/ERK phosphorylation Figure 11. TSA differentiates hdpscs via Smad2/3, Smad4 and possible NFI-C dependent pathways viii

10 Figure 12. Effects of TSA on odontoblast differentiation at E 17.5 in vivo...46 Figure 13. Effects of TSA on dentin formation at P 7 in vivo Figure 14. Expression of DSP at P ix

11 ABBREVIATIONS HDAC HDACi TSA MSCs hdmscs hdpscs PCNA DSPP histone deacetylase histone deacetylase inhibitor trichostatin a mesenchymal stem cells dental mesenchymal stem cells human dental pulp stem cells proliferating cell nuclear antigen dentin sialophosphoprotein DMP1 dentin matrix protein 1 BSP OCN DSP TGF BMP FGF MAPK FACS bone sialoprotein osteocalcin dentin sialoprotein transforming growth factor bone morphogenetic protein fibroblast growth factor mitogen-activated protein kinase fluorescence activated cell sorting x

12 I. INTRODUCTION 1. Dental mesenchymal stem cells Mesenchymal stem cells (MSCs) were isolated from the human extracted teeth and named as human dental stem cells (hdscs). They were originated from various kinds of dental tissues, such as dental pulp, periodontal ligament, periapical follicle, and alveolar bone marrow. They were proved to have different proliferation and differentiation abilities. 1-3 MSCs can be differentiated into osteoblasts, chondrocytes, odontoblasts, adipocytes, myoblasts, and fibroblasts (Fig. 1). Many studies recently tried to utilize the hdmscs in regenerative medicine and the areas were broad as bone and cartilage regeneration, immunologic disease treatment, chronic heart disease treatment, as well as dental disease treatment and their tissue regeneration. 4-8 Among the hdmscs, human dental pulp stem cells (hdpscs) were known as undifferentiated ectomesenchymal cells which can differentiate into neural cells and mineral forming cells, especially 3, 9-11 odontoblasts, which is the precursor cells for dentin formation. 1

13 Figure 1. The destiny of mesenchymal stem cells. Mesenchymal stem cells can differentiate into a variety of cell types, including osteoblasts, chondrocytes, odontoblasts, adipocytes, astrocytes, myocytes, and fibroblasts. Nowadays, MSCs, which have multipotent capability, are an attractive target for cell therapeutic applications on tissue engineering. 2

14 2. Osteoblasts and odontoblasts Osteoblasts are mononucleate cells that are responsible for bone formation. Osteoblasts produce a matrix of osteoid, which is composed mainly of Type I collagen. Osteoblasts are also responsible for mineralization of the matrix. Bone is a dynamic tissue, which regeneration depends on osteoblasts and osteoclasts. Osteoblasts arise from osteoprogenitor cells located in the deeper layer of bone marrow. Osteoprogenitors are immature progenitor cells that express the master regulatory transcription factor Runx2. Osteoprogenitors are induced to differentiate to osteoblasts under the influence of growth factors: BMP2, Runx2 and TGFβ. 12 Odontoblasts are the cells who secrete extracellular matrix during dentin formation in tooth development stages and known to be effected by several molecules such as TGFβ, BMP2 and BMP4. 13,14 During dentin formation, the secretion and mineralization of dentin matrix proteins, such as the most abundant non-collagenous dentin matrix protein dentin sialophosphoprotein (DSPP), in odontoblast differentiation are controlled by odontoblasts. Dentin sialoprotein (DSP) has been known to be expressed primarily in the dentinal tubule of peritubular dentin rather than in the dentin matrix previously. 1,3,15 In spite of the 3

15 crucial functions of odontoblast in tooth development and dental tissue regeneration processes, the studies for searching a key molecule and its essential mechanism for differentiation are still ongoing and not related to a single factor. 16,17 (Fig. 2). 4

16 Figure 2. Osteoblast and odontoblast differentiation. Osteoblasts and odontoblasts arise from osteo/odonto-progenitor cells located in the deeper layer of bone marrow and dental papilla. Osteoblasts are differentiated under the growth factors: BMP2, Runx2 and TGFβ. Odontoblasts differentiation is also affected by several growth factors: TGFβ, BMP and FGF. 5

17 3. Roles of histone deacetylases inhibitor Histone deacetylases (HDAC) inhibitors are known to modulate the expression of genes by increasing histone acetylation and thereby, regulating chromatin structure and transcription. 18 Various HDAC inhibitors are reported to enhance osteoblast differentiation in multiple cell types, including osteoblasts, bone marrow mesenchymal cells, and adipose-derived stromal cells Current evidence indicates that HDAC inhibitors act not only to block the catalytic activity of the enzyme but may also affect the protein protein interaction of specific HDACs with various critical protein partners. 22 These target proteins are involved in many cell pathways including gene expression, cell proliferation, differentiation, cell migration and cell death, and have a role in angiogenesis and immune response. 23 Among several kinds of HDAC inhibitors, TSA is a hydroxamic acid and block the activity of all HDACs with similar affinities, except class IIa HDACs, which was originally isolated as a fungistatic antibiotic from the Streptomyces platensis strain. 24 However, the effects of TSA on the hdpscs and its precise molecular mechanism remain unclear. 4. Smad-NFIC signaling 6

18 Mitogen-activated protein kinase (MAPK) pathways (ERK, JNK, and p38 MAPK) and phospho-inositide-3-kinase (PI3K)/AKT pathway have been reported to regulate the proliferation and differentiation of MSCs. 25 It is well known that MAPK pathways play important roles in the early signaling pathways. MAPK induces several transcription factors, such as Smad, Runx2, NFIC and so on. NFIC is essential for odontoblast differentiation during root development. 26 It is also reported that TGFβ/BMP signaling controls DMSC in dentin formation, especially, mediated by Smad-Shh-NFIC pathways. 34 However, the molecular mechanisms of the signaling in regulating proliferation and differentiation of hdpscs has not been elucidated clearly. 5. Purpose of this study In this study, we aim to investigate how TSA effects on the proliferation and differentiation of the hdpscs in vitro and identify the molecular mechanisms. Next, we examine whether TSA induces odontoblast differentiation and dentin formation in vivo during tooth development stages. 7

19 II. MATERIALS AND METHODS 1. Primary cell culture Human third molars collected from three healthy young males (18-25 years of age) under the protocol approved by the institutional review board at the Seoul National University Dental Hospital, Seoul, South Korea (IRB Number 05004). The pulp tissue was gently separated from extracted third molars and the separated tissues were digested in a solution of 3 mg/ml collagenase type I (Worthington Biochem, Freehold, NJ, USA) and 4 mg/ml dispase (Boehringer, Mannheim, Germany) for one hour at 37 C. Single cell suspensions were obtained by passing the cells through a 40 µm strainer (Falcon, BD Labware, Frankin Lakes, NJ, USA) and were cultured in alpha-modification of Eagle s medium ( -MEM, GIBCO BRL, Grand Island, NY, USA) supplemented with 10% fetal calf serum (Equitech-Bio Inc, Kerrville, TX, USA), 100 µmol/l ascorbic acid 2- phosphate (WAKO, Tokyo, Japan), 2 mmol/l glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (Biofluids, Rockville, MD, USA) and incubated at 37 C in 5% CO 2. After 24 hours, medium was changed and then changed for every three days. The colonies were picked up and cultured separately. Total three colonies of hdpscs were 8

20 randomly selected and the cellular pool of those colonies was used for in vitro proliferation and differentiation studies. All primary cells used in this study were in passage 2 or Flow cytometric analysis Approximately 1.0 x 10 6 number of cells cultured as hdpscs in their third passage. After trypsin/edta digestion, the cells were fixed with 4% paraformaldehyde for 10 min. After resuspension in 1% BSA (ICN Biomedicals, Aurora, OH, USA) blocking buffer, the cells were incubated with primary STRO-1 (R&D Systems, Minneapolis, MN, USA) or CD146 (abcam, Cambridge, UK) antibodies (experimental cells;10 mg/ml) or PBS (control cells) at 4 C for three hours, followed by secondary antibody of fluorescence at room temperature for one hour. The percentage of STRO-1 positive staining hdpscs was measured with a FACS Calibur flow cytometry (Becton Dickinson Immunocytometry Systems, CA, USA) and the results were analyzed by the software (Cell Quest Pro, Becton Dicknson, CA, USA). For analysis of STRO-1 and CD146 positive cells, the percentage of the cells positioned in the right side of the M1 gate was measured. The M1 gate was defined as a peak of negative control cells without primary antibody. The 9

21 relatively positive cells were calculated from the percentage of the experimental cells minus the percentage of the control cells. 3. Immunofluorescence staining To identify the putative postnatal stem cells from the cultured cells, the expression of STRO-1 and CD146, cell surface markers for mesenchymal stem cells, were confirmed by immunofluorescence staining. Isolated cells from the dental pulp cells were seeded at cells per well in six well plates on 22 22mm cover slips and cultured for 24 hours at 37 in 5% CO 2. After being washed in PBS (ph 7.4) and 3.7% paraformaldehyde in PBS at ph 7.4, and blocked with 1% bovine serum albumin overnight at 4. Then the cells were incubated with STRO-1 and CD146 antibodies (1:200; R&D Systems, Minneapolis, MN) for two hours at room temperature, and incubated as Alexa Fluor 488 anti mouse secondary antibody at a 1:1,000 dilution with Alexa Fluor 568 phalloidin for 30 min at room temperature, and then washed five times with PBS. For nuclear staining, 4 6 -diamidine-2 -phenylindole dihydrochloride (DAPI, Roche Applied Science, CA, USA) was used at a final concentration of 1 μg / ml in PBS for five min followed by 10

22 extensive washing with PBS. Cover slips were mounted, and then cellular imaging was taken using a LSM 510 META confocal laser scanning (Carl ZEISS, Germany). Each analysis was performed at least three times. 4. Cell proliferation assay Cell proliferation and viability were measured using the colometric 3-(4,5- Dimethylthazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay kit (Promega, Madison, WI, USA). Briefly, hdpscs (3.0 x 10 3 cells/ well) were seeded in 96-well plates and cultured for 24 hours. The normal growth medium was made as described before. Various concentrations of TSA (Sigma Aldrich, St. Louis, MO, USA) were added as 0, 5, 10, 20, 50 and 100 nm for final concentration in 100 µl of culture media per well. 15 µl of premixed optimized dye solution was added after different time duration; 0, 12, 24, 48 and 72 hours. The cells were incubated in 5% CO 2 at 37 C for four hours, then 100 µl of a solubilization/stop solution was added to the cultures to solubilize the formazan product. Each condition was prepared triplet and the reactions were assessed with ELISA reader at 595 nm (655 nm as reference) and the values are expressed as O.D, mean ± standard deviation. 11

23 For the experiment of SP600125, a specific JNK inhibitor (Calbiochem, La Jolla, CA, USA), hdpscs (3.0 x 10 3 cells/ well) were seeded and cultured with or without 20 nm TSA in the presence or absence of SP (10 μm) in 96-well plates for the different culture durations (0, 12, 24, 48 and 72 hours). 27 Then the cell proliferation was measured with the same method as above. 5. Western blot analysis To confirm the elevated proliferative capability of the TSA-treated hdpscs, Western blot analysis was performed as resolved on 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The hdpscs (1.0 x 10 6 cells/ dish) were seeded in a 60mm culture dish and cultured for 24 hours. Various concentrations of TSA were added as 0, 5, 10, 20, 50 and 100 nm for final concentration in 3 ml of culture media and cultured for 48 hours. Protein concentrations of cell lysates were determined by using the DC Protein Assay Kit (Bio-Rad Laboratories, Hercules, CA, USA). An equal amount of proteins (30 µg/lane) was resolved by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). Primary antibodies against Proliferative cell nuclear antigen (PCNA, Santa Cruz 12

24 Biotechnology, Santa Cruz, CA, USA) and Cyclin D1 (Cell Signaling Technology, Danvers, MA, USA) were used. Blots were finally developed by using horseradish peroxidase-conjugated secondary antibodies (Cell Signaling) and were visualized by using enhanced chemiluminescence (Enhanced chemiluminescence kit; GE Healthcare, USA). The primary antibodies against p-akt, AKT, p-erk, ERK, p-p38, p38, p-jnk, JNK, p-c-jun, c-jun and α-tubulin (Cell Signaling Technology, Danvers, MA, USA) were used for further mechanism study. To evaluate whether TSA induced odontoblast differentiation of hdpscs, 1.0 x 10 6 cells were seeded in a 60 mm dish and cultured for three weeks under differentiation induction condition. Primary antibodies against HDAC1, HDAC2, HDAC3, HDAC4, HDAC5 (Cell Signaling), p-smad2/3, Smad4, Runx2 and β-actin (Santa Cruz Biotechnology) were used. The specific antibody against nuclear factor I-C (NFI-C) was a kind gift from Dr. JC Park (Seoul National University, Seoul, Korea) RNA preparation and real-time PCR analysis To evaluate gene expression levels in TSA-induced differentiated hdpscs, 1.0 x 10 6 cells were seeded in a 60 mm culture dish and cultured for three weeks under 13

25 differentiation induction condition. Total RNA was prepared by using an RNeasy Mini kit (QIAGEN, Valencia, CA, USA) according to the manufacturer s instructions, and cdna was synthesized from 5 µg of total RNA using reverse transcriptase (Superscript II Preamplification System, Invitrogen, Gaithersburg, MD, USA). Real-time PCR was performed with SYBR Green PCR Master Mix (ABI Prism 7500 sequence detection system, Applied Biosystems, Warrington, Cheshire, UK). The reaction conditions were 40 cycles of 15 sec of denaturation at 95 C, and one min of amplification at 60 C. All reactions were run in triplicate and were normalized to housekeeping gene hypoxanthineguanine phosphoribosyl transferase (HPRT). For comparison of the gene expression between the control and the TSA-treated groups, cycle threshold value was calculated and compared. 28 The relative expression of mrna in hdpscs and their TSA-treated counterparts were compared in a histogram. The specific primers sets for the analysis are listed in Table Alkaline phosphatase (ALP) staining The influence of TSA on the differentiation of hdpscs was observed by ALP staining under the differentiation condition. The hdpscs were seeded on six-well plates 14

26 (8.0 x 10 4 cells/ well) and cultured with normal growth medium. After three days, 20 nm TSA was added for TSA group and the cells were cultured in differentiation medium with 50 g/ml ascorbic acid, 10 mm β-glycerophosphate and 100 nm dexamethasone (Sigma, St. Louis, MO, USA) for the differentiation induction group. The medium was changed every three days and cultured for one week for ALP staining. Cells were fixed with 10% formalin, incubated with 0.1% Triton X-100 for five min, and then stained by the Leukocyte Alkaline Phosphatase Kit (Sigma, St. Louis, MO, USA) according to the manufacturer s protocol. 8. Alizarin red S staining The influence of TSA on the mineralization of hdpscs was observed by alizarin red S staining under the differentiation condition. The hdpscs were also seeded on six-well plates (8.0 x 10 4 cells/ well) and cultured with normal growth medium. After three days, 20 nm TSA was added for TSA group and the cells were cultured in differentiation medium with 50 g/ml ascorbic acid, 10 mm β-glycerophosphate and 100 nm dexamethasone (Sigma, St. Louis, MO, USA) for differentiation induction group. The medium was changed every three days and cultured for three weeks for alizarin red S 15

27 staining. On the days 21, accumulation of mineral nodules was detected by 2% alizarin red S staining at ph 4.2 (Sigma). For destaining procedure for measurement of calcium content, 3 ml of 10 mm sodium phosphate 10% acetylpyrimidium (ph 7.0) solution was added to each stained well and incubated at room temperature for 15 min. The destained sample was transferred to a 96-well plate and the absorbance was measured at 562 nm. For the study with SIS3, the specific inhibitor of Smad3, TSA was added with or without 3 μm of SIS3 after three days of culture in normal growth medium, then the medium was changed into the differentiation medium. Alizarin red S staining and destaining procedures were the same as the above. 9. ICR pregnant mouse injection model To study the effects of TSA on dentin formation during tooth developmental stages in vivo, we used eight pregnant ICR mice in five days of gestation. The mice were divided into two groups: the embryo 17.5 day (E17.5) group and the postnatal 7 day (P7) group. Then, the four pregnant ICR mice from each group were also divided into two groups: control group and TSA group, respectively, TSA group (n=2); 50 µm/ kg of TSA in 100 μl volume was injected via tail vein every day from 6.5 days to 17.5 days of gestation, 16

28 and control group (n=2); the same volume of PBS was injected via tail vein in the same duration. Finally, 12 murine embryos from the E17.5 group (control group: n=6 and TSA group: n=6) and 12 newborn mice from the P7 group (control group: n=6 and TSA group: n=6) were sacrificed and examined at E17.5 and P7 of the first and second lower molar (Fig. 3). 10. Histological analysis For histological analysis, 12 murine embryos and 12 newborn mice from each group (total n=24) were sacrificed at E17.5 and P7. The whole murine heads were cut and fixed in 3.7% paraformaldehyde solution for 48 hours at 4, decalcified with 12% EDTA, and then the whole heads were cut into two pieces following the cranial sagittal suture. After paraffin embedding, the sections were cut serially in sagittal plane from the most lingual side. During sectioning procedure, the mid-sagittal plane of the tooth germ (E17.5) or molar (P7) was defined when the highest point of the crown and the most middle portion of the pulp chamber appeared at the same time. Semi-serial 5 μm sections of first and second molars were prepared and three mid-sagittal sections were selected for hematoxylin and eosin (H&E) staining. Three more sections were processed for 17

29 immunohistocheimcal staining and examined under light microscope (Olympus U-SPT, Japan). 11. Histomorphometric analysis For quantitative analysis of TSA-induced dentin formation, histomorphometric analysis was performed with the LS starter program (OLYMPUS Soft Imaging Solution, Müster, Germany). Dentin thickness (μm) was measured as the shortest vertical distances. The distances from the three different enamel cusp tips were measured and the average value was used for thickness evaluation. The gross area of the dentin was calculated with the software as the measured, by pointing manually and demarcating along the boundary of the dentin on the magnified H&E stained slides. Dentin thickness and dentin area were measured from the six different slides which were randomly selected from the total 18 slides. The number of odontoblasts was also counted manually by the two different investigators and the average value was evaluated. The number was counted from the three different slides which were randomly selected from the total 18 slides. The difference between control group and TSA group was evaluated statistically (p<0.01, p<0.05). 18

30 12. Immunohistochemical analysis The deparaffinized sections were immersed in 0.6% H 2 O 2 /methanol for 20 min to quench the endogenous peroxidase activity. Then they were preincubated with 1% bovine serum albumin in PBS for 30 min and incubated overnight at 4 C with rabbit polyclonal anti- mouse DSP antibody (a kind gift from Dr. JC Park, Seoul National University, Seoul, Korea, 1:100). Sections were incubated for one hour at room temperature with the secondary antibody and reacted with avidin-biotin-peroxidase complex (Vectastain ABC Systems, Vector Laboratories, Burlingame, CA, USA) in PBS for 30 min. After color development with 0.05% 3,3 -diaminobenzidine tetrahydrochloride (DAB Peroxidase Substrate, Vector Laboratories), the sections were counterstained with hematoxylin. 13. Statistical analysis Data are expressed as mean ± standard deviation. Statistical significance of differences between the groups in histomorphometric measurements; dentin thickness, gross area of dentin and number of odontoblasts in TSA group and control group was analyzed by Mann-Whitney U test. A p-value less than 0.05 or 0.01 was considered statistically significant. 19

31 Table 1. Primer sequences for real-time quantitative PCR Gene GenBank No. Sequences DSPP BSP DMP1 OCN HPRT NM_ L09555 U89012 AL NM_ GTGAGGACAAGGACGAATCTGA CACTACTGTCACTGCTGTCACT AACTTTTATGTCCCCCGTTGA TGGACTGGAAACCGTTTCAGA ACAGGCAAATGAAGACCC TTCACTGGCTTGTATGG TGAGAGCCCTCACACTCCTC ACCTTTGCTGGACTCTGCAC GGCTATAAGTTCTTTGCTGACCTG CCACAGGGACTAGAACACCTGCTA -3 20

32 Figure 3. Intravenous injection mouse model. Intravenous injection of exogenous TSA to ICR mouse via mother s tail vein was performed from pregnant 6.5 day to 17.5 day before delivery. 12 murine embryos and 12 newborn mice from each group (total n=24) were sacrificed at E17.5 and P7. Excision was performed as shown in the picture. 21

33 III. RESULTS 1. Isolation of human dental pulp stem cells The isolated cells formed single cell derived colonies and most of the cells retained their fibroblastic spindle shape (Fig. 4A). Single cell colonies were picked up and cultured separately. Three different colonies from three donors were randomly selected and the cellular pool of the colonies was used as human dental pulp stem cells (hdpscs) for in vitro studies (Fig. 4B). To identify putative postnatal stem cells from the cultured cells, we stained with STRO-1 and CD146 which were mesenchymal stem cells markers in immunocytochemistry. 29 As shown in Figure 4D, approximately 50.0 percent of STRO- 1 and CD146 positive cells were expressed on hdpscs. 22

34 Figure 4. Characterization of hdpscs with ICC. (A) A single cell colony from the dental pulp of one third molar donor. (B) Three different colonies were randomly selected and the pool of the colonies was used as hdpscs for in vitro experiments. (D) Immunocytochemical staining using STRO-1 and CD146. Cells were incubated with anti-stro-1 and anti-cd146 by labeling with anti-mouse FITC (Green). Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) (Blue). Cytoskeleton was visualized as phalloidine (Red) by confocal microscopic analysis. (C) Higher magnification of STRO-1. A and B, 40X; C, 400X; D, 200X. 23

35 2. Characterization of human dental pulp stem cells We also confirmed cells population of DPSCs physiologically, using flow cytometric analysis (FACS). The FSC (Forware Scatter) parameter is a measurement of the amount of the laser beam that passes around the cell. This gives a relative size for the cell. The SSC (Side Scatter) parameter is granularity as internal complexity of particulates inside of the cell. FACS showed the hdpscs contained approximately 45.2 percent of STRO-1, 53.0 percent of CD146 positive cells (Fig. 5A). STRO-1 and CD146 are known as the representative putative mesenchymal stem cell markers. 30,31 The percentage of STRO-1 and CD146 positive cells was determined by relative intensity of antibody binding cells. The percentage of control cells (46.6%) at the right side of M1 gate was deducted from the percentage of the experimental cells (STRO-1; 91.8% and CD146; 99.6%) at the right side of M1 gate (Fig. 5B). 24

36 25

37 Figure 5. Characterization of the expression of cell surface markers. (A) and (B) Two mesenchymal stem cell markers, STRO-1 and CD146 were used for FACS analysis of hdpscs. For analysis of STRO-1 and CD146 positive cells, the percentage of the cells positioned in the right side of the M1 gate was measured. The M1 gate was defined as a peak of negative control cells without primary antibody. The relatively positive cells were calculated from the percentage of the experimental cells minus the percentage of the control cells. The pooled hdpscs contained approximately 45.2 percent of STRO-1, 53.0 percent of CD146 positive cells. 26

38 3. TSA increases proliferation of hdpscs in vitro As hdpscs have potential to differentiate into odontoblast, we focused on the effect of TSA on hdpscs. We first examined the effect of TSA on proliferation of hdpscs in vitro. To examine the effect of TSA on proliferation of hdpscs in vitro, 0, 5, 10, 20, 50,100 nm of TSA were added to the hdpscs. At 48 hours of culture, MTT assay showed that TSA increased proliferation of hdpscs by 20 nm but O.D. value slightly decreased at 50 nm (Fig. 6A). When 100 nm of TSA was added, O.D. value decreased as the same as the control and showed cytotoxicity (data is not shown). To confirm the elevated proliferative capability of hdpscs in protein level, PCNA and Cyclin D1 were detected by Western blot with the same serial concentrations of TSA treatment. Expression of PCNA increased according to the TSA concentration by 20 nm, while Cyclin D1 also increased by 20 nm (Fig. 6B). Expression of these proteins were almost diminished at 100 nm of TSA because of cytotoxicity (data is not shown). Therefore, it was concluded that 20 nm of TSA showed highest proliferative effect on hdpscs in vitro. As found out available working dosage for cell proliferation without cell toxicity in vitro, we next examined the effect of TSA on hdpscs in a time-dependent manner. When 20 nm of TSA added to hdpscs, proliferation increased in time dependent manner 27

39 (Fig. 6C). During 72 hours of culture, O.D. value was higher than the control group. We also examined the effect of TSA on the expression levels of PCNA, which is required for DNA replication and drives cell cycle progression in proliferating cells. 32 Treatment of hdpscs with 20 nm of TSA increased the expression levels of PCNA from 24 hours (Fig. 6D). These results suggest that the proliferative effects of TSA on hdpscs are presumably due to up-regulation of PCNA. 28

40 Figure 6. TSA increases the proliferation ability of hdpscs. (A) HDPSCs were cultured with TSA (0, 5, 10, 20, 50, 100 nm) for 48 hours in normal growth medium in vitro. Then, the cell proliferation and cytotoxicity rates were determined by MTT assay. (B) HDPSCs were also cultured for 48 hours in normal growth medium at the indicated doses of TSA. The expression of PCNA and Cyclin D1 were detected by Western blot analysis and α-tubulin served as an internal control. (C) HDPSCs were cultured with TSA (20 nm) in normal growth medium at the indicated 29

41 times. The cell proliferation rate was determined by MTT assay. (D) HDPSCs were cultured with TSA (20 nm) in normal growth medium at the indicated times. The expression of PCNA was detected by Western blot analysis and α-tubulin served as an internal control. 30

42 4. TSA stimulates proliferation of hdpscs via JNK and c-jun phosphorylation To explore the molecular mechanisms how TSA induces proliferation of hdpscs, we examined the key molecule levels of early signaling pathways; ERK, JNK, p38 and AKT pathways (Fig. 7A). Among the four proteins and their phosphorylated forms, p-jnk was the only protein increased by 20 nm of TSA, and phosphorylated c-jun (p-c-jun), the downstream target protein of JNK was also increased by TSA treatment (Fig. 7A). Pretreatment of hdpscs with 10 μm of SP600125, a specific JNK inhibitor, completely decreased TSA-induced proliferation during 72 hours of culture (Fig. 7B) without changing proliferation of hdpscs (data not shown). Therefore, it was speculated that JNK signaling pathways played an essential role in TSA-induced proliferation of hdpscs. 31

43 Figure 7. TSA up-regulates JNK/c-Jun pathway for proliferation in hdpscs. (A) HDPSCs were cultured in normal growth medium for 48 hours with or without TSA (20 nm). Whole cell lysates were subjected to Western blot analysis with indicated antibodies. α-tubulin served as an internal control. (B) For the experiment of SP600125, a specific JNK inhibitor, hdpscs were cultured in normal growth medium with or without 20 nm TSA in the presence or absence of SP (10 μm) for the different culture durations (0, 12, 24, 48 and 72 hours). The cell proliferation rate was determined 32

44 by MTT assay. MTT assay showed that SP completely decreased TSA-induced proliferation during 72 hours of culture. 33

45 5. TSA induces differentiation of hdpscs in vitro After one week of differentiation induction, control group (0 nm of TSA) showed no change by ALP staining compared to the normal growth condition (Fig. 8A, the first column). However, 20 nm of TSA induced positive ALP staining and the whole well showed the difference of staining positivity between control and TSA groups (Fig. 8A, the second column). After three weeks of differentiation induction, control group (0 nm of TSA) began to show mineralized nodules stained by alizarin red S (Fig. 8B, the first column). However, TSA group showed more and larger calcified nodules and stronger staining by alizarin red S. The results of destaining procedure showed higher calcium contents in TSA group (Fig. 8B, the second column). Therefore, it was concluded that 20 nm of TSA under differentiation induction condition promotes differentiation of hdpscs into mineral forming cells, such as odontoblasts or osteoblasts in vitro. 34

46 Figure 8. Effects of TSA on differentiation of hdpscs. (A) HDPSCs were cultured with normal growth medium and differentiation induction medium for one week in the presence or absence of TSA (20 nm). After one week differentiation of hdpscs was determined by ALP staining. (B) HDPSCs were cultured with normal growth medium and differentiation induction medium for three weeks in the presence or absence of TSA (20 nm). After three weeks, the effect of TSA on mineral nodule formation of hdpscs was determined by alizarin red S staining. The results of destaining procedure showed higher calcium contents in TSA group (the right histograms). Scale bars: 1.0 mm. 35

47 6. TSA enhances expression of odonto/osteogenic differentiation markers in hdpscs in vitro To further investigate whether TSA differentiates hdpscs into osteoblasts or odontoblasts, the related gene expression was checked by real-time PCR. DSPP is known as a single gene odontoblast can express and its mrna expression was slightly increased at 21 days of culture under differentiation induction condition without TSA (Fig. 9A, white histograms). However, with TSA treatment, expression of DSPP was significantly increased at 21 days of differentiation induction compared to control group (Fig. 9A, black histograms). DMP1 is able to bind to DSPP promoter and activate transcription during early differentiation of odontoblasts. 33 BSP and OCN are known as the genes expressed commonly by osteoblasts and odontoblasts. 3 Without TSA, the mrna expressions of DMP1, BSP and OCN showed tendency to increase during 21 days of differentiation induction, and BSP and DMP1 in TSA treatment group were significantly increased and higher than control group (Fig. 9B and C). The expression of DMP1 mrna in TSA group was especially higher, approximately seven times higher than control group at 21 days. Interestingly, OCN was slightly decreased in TSA group at 21 days compared to control group (Fig. 9D). 36

48 Figure 9. Effects of TSA on the expression of odontoblast differentiation markers. The osteoblasts or odontoblasts related genes expression were checked. (A) and (B) HDPSCs were cultured with differentiation induction medium in the presence or absence of TSA (20 nm) at the indicated times. DSPP and DMP1 were known as odontoblast differentiation markers and mrna expression was analyzed by real-time PCR with HPRT mrna as an endogenous control. (C) and (D) HDPSCs were also cultured with differentiation induction medium in the presence or absence of TSA (20 nm) at the 37

49 indicated times. The expression of mrna for BSP and OCN was analyzed by real-time PCR with HPRT mrna as an endogenous control. All reactions were run in triplicate and relative differences of gene expression were evaluated by using the comparative cycle threshold method. 38

50 7. TSA stimulates differentiation of hdpscs via MEK and ERK phosphorylation The molecular mechanisms by which TSA induces differentiation of hdpscs has been still unclear. Here, we also examined the effect of TSA on early signaling pathways including ERK, JNK, P38, and AKT. Among the four proteins and their phosphorylated forms, p-erk was the only protein increased by 20 nm of TSA at 48 hours in differentiation induction (Fig. 10B). Treatment of hdpscs with 20 nm of TSA resulted in increased p-erk and its upstream target p-mek, after 48 hours of differentiation induction (Fig. 10A). Therefore, it was speculated that ERK signaling pathway might mediate TSA-induced differentiation of hdpscs. 39

51 Figure 10. TSA up-regulates MEK/ERK phosphorylation. To explore the molecular mechanisms how TSA induces differentiation of hdpscs, the key molecule levels of signaling pathways; ERK, JNK, p38 and AKT pathways were examined. (A) HDPSCs were cultured with TSA (20 nm) or vehicle for the indicated times in differentiation induction medium. Whole cell lysates were subjected to Western Blot analysis with p-mek, p-erk, ERK and α-tubulin served as an internal control. (B) HDPSCs were also treated with TSA (20 nm) or vehicle for 48 hours in differentiation induction medium. Western Blot analysis with the indicated antibodies and α-tubulin served as an internal control. 40

52 8. TSA-induced odontoblast differentiation is mediated by Smad2/3 and possible NFI-C dependent pathways To inspect the key molecular mechanisms by which TSA induces differentiation of hdpscs, the target HDAC should be examined firstly among the members of HDAC family. Protein level of HDAC3 was decreased by 20 nm of TSA treatment, while HDAC1, HDAC2, HDAC4, and HDAC5 showed no changes (Fig. 11A). Then the levels of NFI-C and Runx2 were evaluated, as NFI-C was known as one of the key genes for odontoblast differentiation, while Runx2 is the representative transcriptional factor of osteoblast differentiation. 34,35 The results of western blot showed increased level of NFI-C by 20 nm of TSA, while no effect on the level of Runx2 (Fig. 11B). The levels of p- Smad2/3 and Smad4 were also tested as they were thought to be the upstream proteins for NFI-C targeting signaling pathway. 36,37 As expected, TSA significantly up-regulated the levels of p-smad2/3 and Smad4 (Fig. 11B). To confirm whether Smads plays an essential role in TSA-induced odontoblast differentiation of hdpscs, SIS3 (a Specific Inhibitor of Smad3) was used in differentiation induction of hdpscs. 38 Compared to staining positivity of TSA group after three weeks of differentiation induction, decreased mineral nodule formation was shown in TSA with SIS3 group by alizarin red S staining (Fig. 41

53 11C). The increased calcium contents by TSA treatment was verified again after destaining procedures and decreased calcium contents by SIS3 was also shown (Fig. 11C). Therefore, SIS3 inhibited TSA induced-mineralization differentiation of hdpscs in vitro and Smad2/3 and Smad4 seems to play an essential role in TSA-induced odontoblast differentiation of hdpscs. 42

54 Figure 11. TSA differentiates hdpscs via Smad2/3, Smad4 and possible NFI-C dependent pathways. (A) The target HDAC by TSA was examined among the members of HDAC family. HDPSCs were cultured with differentiation induction medium for three weeks in the 43

55 presence or absence of TSA (20 nm). Whole cell lysates were subjected to Western blot analysis with indicated antibodies. β-actin served as an internal control. (B) HDPSCs were also cultured with differentiation induction medium for three weeks in the presence or absence of TSA (20 nm). To inspect the key molecular mechanisms by which TSA induces differentiation of hdpscs, the levels of p-smad2/3, Smad4, NFI-C and Runx2 were evaluated by western blot analysis. β-actin served as an internal control. (C) HDPSCs were cultured in differentiation induction medium with or without 20 nm TSA in the presence or absence of SIS3 (3 μm) for three weeks. Alizarin red S staining showed that mineral nodule formation was decreased in TSA with SIS3 group compared to TSA group after three weeks of differentiation induction. The decreased calcium content by SIS3 was also shown in the right histograms. Scale bars: 1.0 mm 44

56 9. TSA did not induce odontoblast differentiation of DPSCs at E 17.5 day during murine tooth development stages We have established that TSA stimulates odontogenic differentiation in vitro. To examine how TSA affect tooth development in vivo, 50 µm/ kg of TSA was injected to four pregnant ICR mice (TSA group). All of the mice were divided into two groups: the E17.5 group and the P7 group. 12 murine embryos from the E17.5 group and 12 newborn mice from the P7 group were sacrificed and examined at E17.5 and P7 of the first lower molar. At the early bell stage (E17.5), the enamel organ and dentin formation at the edge began to slowly progress. 39,40 H&E staining of the mid-sagittal sections of the first lower molar at E17.5 showed that there was no difference between control group and TSA group in odontoblast differentiation of DPSCs (Fig. 12). 45

57 Figure 12. Effects of TSA on odontoblast differentiation at E 17.5 in vivo. H&E staining of the mid-sagittal sections of the first lower molar in TSA group showed no difference compared to control group at E (C) and (D) were higher magnification figures of (A) and (B), respectively. O.N. Scale Bars: 200 m. 46

58 10. TSA increased dentin formation and possible odontoblast differentiation of DPSCs at P 7 day during murine tooth development stages 12 newborn mice from the P7 group were sacrificed for evaluation of the late bell stage of the first lower molar. The progenitor cells in dental papilla began to differentiate into odontoblasts at P7. Especially, Dentin formation was stimulated actively at the late bell stage (P7). H&E staining of the mid-sagittal sections of the first lower molar showed thicker dentin layer and lower cusp tips compared to control group (Fig. 13A and B). Higher magnification figures clearly showed that more odontoblasts were definite in TSA group (Fig. 13C and D, white arrows). Histomorphometric analysis showed that dentin was thickened by 1.64 fold; dentin area became larger by 1.70 fold and the number of odontoblasts in the same gross area was higher by 1.74 fold in TSA group, compared to control group (Fig. 13E, F and G). The difference of data showed statistical significance (**p<0.01, **p<0.01 and *p<0.05 in Fig. 13E, F and G, respectively). 47

59 48

60 Figure 13. Effects of TSA on dentin formation at P 7 in vivo. (A) and (B) H&E staining of the mid-sagittal sections of the first lower molar in TSA group showed thicker dentin layer and lower cusp tips compared to control group. (C) and (D) are higher magnification figures of (A) and (B), respectively. (Control group: n=12 and TSA group: n=12) (E-G) Histomorphometric analysis showed that dentin was thickened by 1.64 fold; dentin area became larger by 1.70 fold and the number of odontoblasts in the same gross area was higher by 1.74 fold in TSA group, compared to control group. The difference of data showed statistical significance (n=6, **p<0.01, **p<0.01 and *p<0.05 in Fig. E, F and G, respectively). e, enamel; d, dentin; o, odontoblasts; p, pulp; dentin thickness, D.Th.; dentin area, D.A.; odontoblast number, O.N. Scale Bars: 200 m. 49

61 11. TSA increased the expression of DSP at P7 during murine tooth development stages Subsequently, we examined whether the phenotypically changed odontoblasts had an increased ability to secrete dentin sialoprotein (DSP), the odontoblast-specific protein which regulate initiation of dentin mineralization. 41 Immunohistocheimcal staining showed that stronger staining positivity of DSP in TSA group in the first molar (Fig. 14). The stronger expression of DSP was shown especially under the cusp tips, where the differentiation of the dentin matrix began during tooth development (Fig. 14C, D, G and H, red arrows). The morphodifferentiation of second lower molars were later than that of first molars and the trend was also shown in this study (Fig. 14). 42 Interestingly, Immunohistocheimcal staining also showed that stronger staining positivity of DSP in TSA group in the second molar (Fig. 14). DSP was mostly found in the odontoblasts which were not lined up yet and more dispersed inside the dental papilla, compared to the first molar. However, inclination of the differentiated odontoblasts has begun and DSP expression was much stronger in TSA group (Fig. 14, 2 nd molars, red arrows). Therefore, it was concluded that prenatally injected TSA possibly promoted odontoblast 50

62 differentiation and higher DSP production, and finally enhanced dentin formation in murine teeth in vivo. 51

63 52

64 Figure 14. Expression of DSP at P7 Expression of DSP in the first and second molars at P7 from control group and TSA group mice was analyzed by immunohistochemical staining. Immunohistochemistry showed that stronger staining positivity of DSP in TSA group in both of the first and the second molars (B, D, F and H). The magnified view of the black squares were positioned under (A;C, B;D, E;G, F;H). The stronger expression of DSP was shown especially under the cusp tips (red arrows). The morphodifferentiation of second lower molars were later than that of first molars and the trend was also shown (E-H). e, enamel; d, dentin; o, odontoblasts; p, pulp; dentin thickness, D.Th.; dentin area, D.A.; odontoblast number, O.N. Scale Bars: 200 m. 53

65 IV. DISCUSSION For the first time our present study showed that TSA promoted proliferation and odontoblast differentiation of hdpscs in vitro and has the ability to enhance dentin formation in vivo during murine tooth development. TSA is known as a potent HDAC inhibitor that suppresses the activities of HDACs, including all eleven known human class I and class II HDACs. 43 HDACs have been recently implicated as co-regulators in diverse tissue differentiation, such as adipogenesis and osteogenesis Treatment of human mesenchymal stem cells with TSA stimulates their osteogenic differentiation with increased expression of ALP and mineralization in vitro. 19 Another study reported that inhibition of histone deacrtylase activity resulted in adipocyte differentiation in 3T3-L1 cells. 46 However, the effects of TSA on dental stem cells for their proliferation and differentiation in vitro and in vivo have never been elucidated. Our previous studies showed successful isolation and characterization of various human dental stem cells and there were differences in proliferation and differentiation abilities among the stem cell kinds. 1 The differences exist depending on the cell donors, tooth developmental stages and even cell colonies, although the colonies were isolated 54