Results and discussion

Size: px
Start display at page:

Download "Results and discussion"

Transcription

1 Supplementary Figure 1. Assessment of the cross-talk between FuraPE3 and D4ER fluorescent spectra. Cells were perifused with 15 mmol/l glucose (G15) in the presence of 250 µmol/l of the KATP channel opener diazoxide (Dz). Acetylcholine (ACh; 100 µmol/l) or KCl (K45; 45 mmol/l) was added as indicated. Cells were first infected with the D4ER adenovirus and then loaded for 13 min with 100 nmol/l FuraPE3/AM before imaging. The traces are representative of experiments performed on 33 cells.

2 Supplementary Figure 2. Assessment of the cross-talk between FuraPE3 and D4ER fluorescent spectra. Cells were perifused with 15 mmol/l glucose (G15) in the presence of 250 µmol/l of the KATP channel opener diazoxide (Dz). Acetylcholine (ACh; 100 µmol/l) or KCl (K45; 45 mmol/l) was added as indicated. Cells were infected with the D4ER adenovirus but not loaded with FuraPE3/AM before imaging. The traces are representative of experiments performed on 30 cells.

3 Supplementary Figure 3. Assessment of the cross-talk between FuraPE3 and D4ER fluorescent spectra. Cells were perifused with 15 mmol/l glucose (G15) in the presence of 250 µmol/l of the KATP channel opener diazoxide (Dz). Acetylcholine (ACh; 100 µmol/l) or KCl (K45; 45 mmol/l) was added as indicated. Cells were not infected with the D4ER adenovirus but were loaded for 13 min with 100 nmol/l FuraPE3/AM before imaging. Images above the panels show representative cells visualized at the different excitation and emission wavelengths used for FuraPE3 and D4ER imaging. The traces are representative of experiments performed on 15 cells.

4 Results and discussion In cells loaded with FuraPE3 and expressing D4ER, application of 45 mmol/l K and 100 µmol/l ACh induced antiparallel changes of the 340 and 380 nm excitation wavelengths of FuraPE3 and of the 475 and 540 nm emission wavelengths of D4ER (Suppl. Fig. 1). K45 increased both FuraPE3 (340/380 = [Ca 2+ ] c ) and D4ER (540/475 = [Ca 2+ ] ER ) ratios, whereas subsequent addition of ACh elicited the expected antiparallel changes in [Ca 2+ ] c and [Ca 2+ ] ER. To evaluate to which extent the D4ER signal might contaminate the FuraPE3 signal, experiments were performed on cells expressing D4ER but not loaded with FuraPE3 (Suppl. Fig. 2). This revealed that D4ER emits a substantial fluorescent signal when recorded at the wavelengths used for FuraPE3 measurement (keeping the same intensity of light and duration of acquisition of the excitation and emission wavelengths as used for Suppl. Fig. 1, 3). In average, the signal originating from D4ER (measured in 30 cells expressing D4ER but not loaded with FuraPE3) represents 48% and 60% of the global D4ER + FuraPE3 signal recorded, respectively, at 340 nm and 380 nm from 33 cells expressing D4ER and loaded with FuraPE3. This is expected from the overlap of the excitation spectrum of CFP in the D4ER indicator and the excitation spectra of FuraPE3. However, importantly, no change in the 340/380 ratio (FuraPE3 ratio) was observed in response to high K and ACh which, on the other hand, affected [Ca 2+ ] ER (Suppl. Fig. 2). This demonstrates that changes in the D4ER signal do not affect the FuraPE3 ratio. Nevertheless, the substantial contamination of the FuraPE3 signal by D4ER diminishes the amplitude of the true changes in the FuraPE3 ratio when [Ca 2+ ] c changes, which precludes any calibration of the [Ca 2+ ] c signal during simultaneous [Ca 2+ ] c and [Ca 2+ ] ER measurements. To evaluate to which extent the FuraPE3 signal contaminates the D4ER signal, cells were loaded with FuraPE3 but not infected with the D4ER adenovirus (Suppl. Fig.3). This showed that, in average, this signal originating from FuraPE3 (measured in 15 cells loaded with FuraPE3 but that did not express D4ER) represents only 4.1% and 7.3% of the global D4ER + FuraPE3 signal recorded, respectively, at 540 nm and 475 nm from 33 cells expressing D4ER and loaded with FuraPE3. Although changes in the FuraPE3 signal induced changes of the D4ER signal, the changes of the signal at both emission wavelengths of D4ER were of the same amplitude, so that, very importantly, changes in [Ca 2+ ] c did not induce apparent changes in the ratio of the emission wavelengths of D4ER (Suppl. Fig. 3). Overall these experiments demonstrate that, although there is some cross-talk between the two Ca 2+ probes, any change in one signal does not affect the ratio of the other.

5 Supplementary Figure 4. [Ca 2+ ] c measurements (FuraPE3) in β-cells from the experiments illustrated in Fig. 4I. SERCA3 +/+ (solid line) or SERCA3 -/- (dashed line) mice perifused with 15 mmol/l glucose (G15) and 250 µmol/l diazoxide (Dz). Cells were stimulated with 15 mmol (K15) and 45 mmol/l (K45) K when indicated. K45 elicited a large [Ca 2+ ] c hump immediately after the rise in [Ca 2+ ] c in SERCA3 +/+ β-cells only. Values are means ± SE of 37 SERCA3 +/+ and 54 SERCA3 -/- β-cells from 3 islet preparations.

6 Supplemenatry Figure 5. [Ca 2+ ] c and metabolism dependence of Ca 2+ uptake by the ER via pumps other than SERCAs. [Ca 2+ ] ER (D4ER) was measured in β-cells from SERCA3 +/+ mice pretreated for 30 min with 1 µmol/l thapsigargin (pre Thapsi) and perifused in a glucose-free medium (G0) before being submitted to 20 mmol/l glucose (G20), 250 µmol/l diazoxide (Dz), 45 mmol/l K (K45) or 100 µmol/l ACh as indicated on top of the panels. Values are means ± SE for cells from 3 experiments with 3 islet preparations.

7 Supplementary Figure 6. Quenching experiments with Mn 2+ support the existence Ca 2+ influx in hyperpolarized β-cells. After 1h loading with 2 µmol/l FuraPE3/AM, β-cells from SERCA3 +/+ mice were perifused with 15 mmol/l glucose (G15) and 250 µmol/l diazoxide (Dz) throughout. 45 mmol/l (K45) K and 500 µmol/l MnCl 2 (Mn) were added when indicated. The fluorescence of FuraPE3 was recorded at 510 nm upon excitation at 340, 360 or 380 nm. The dashed line in panel A illustrates that the ratio 340/380 nm does no longer accurately reflect [Ca 2+ ] c because of the quenching of the Fura fluorescence by Mn 2+. The traces are representative of experiments performed on 32 cells from 3 islet preparations.

8 Results and discussion The 340 and 380 nm excitation wavelengths of FuraPE3 are Ca 2+ sensitive and hence report the changes in [Ca 2+ ] c, whereas the 360 nm excitation wavelength is Ca 2+ insensitive (= isosbestic point). Mn 2+ can enter through Ca 2+ permeable channels and has the characteristic to quench the fluorescence of Fura. The quenching of the fluorescence of Fura trapped within the cell by Mn 2+ applied in the extracellular medium is often used as an indicator of Ca 2+ entry (1, 2). A first application of K45 elicited the expected antiparallel changes in fluorescence upon excitation at 340 and 380 nm, but did not affect the fluorescence upon excitation at 360 nm, which indicates that 360 nm was the true isosbestic point (does not report changes in Ca 2+ ). Application of Mn 2+ significantly decreased the fluorescence at 360 nm in cells hyperpolarized with diazoxide (see slope of trace 1), i.e. under conditions where voltage-dependent Ca 2+ are closed. This unequivocally shows that there is already a significant entry of Ca 2+ (reported by Mn 2+ ) when the cell is hyperpolarized and [Ca 2+ ] c stays at basal level. As expected, subsequent application of K45 in the presence of Mn 2+ strongly accelerated the speed of the quenching (see steeper slope of trace 2), because of Mn 2+ entry through opened voltage-dependent Ca 2+ channels.

9 Supplementary Figure 7. Characteristics of Ca 2+ uptake by the ER in response to activation of cell metabolism. [Ca 2+ ] ER (D4ER) was measured in -cells from SERCA3 +/+ (A) or SERCA3 -/- (B) mice perifused with a Ca 2+ free medium (Ca0-EGTA) throughout (A) or only at the beginning of the experiment (B). A: 10 mmol/l -ketoisocaproate (KIC) was added when indicated. B: The medium contained 250 µmol/l diazoxide (Dz) throughout, and the glucose concentration was increased from 0 (G0) to 20 mmol/l (G20) before the readmission of 2.5 mmol/l CaCl 2 (Ca2.5). A, B: 100 µmol/l acetylcholine (ACh) was added at the end of the experiments. Values are means ± SE for 17 (A) and 23 (B) cells from 3 islet preparations.

10 Supplementary Figure 8. RNA extraction from freshly isolated mouse control tissues for ryanodine receptor (Ryr) expression (gastrocnemius muscle, total heart and brain cortex) was done using TRIzol Reagent as described before (3). Total RNA from freshly isolated islets, FACS purified β-cells and MIN6 cells was extracted as described in ref. 3 using the Absolutely RNA microprep (Stratagene, CA). FACS purified β-cells were obtained from islets of RIPYY mice expressing EYFP under the rat insulin promoter, i.e. specifically in β-cells (4), and contained > 99% pure β-cells. The abundance of mrna signals corresponding to Ryr1, Ryr2, Ryr3 and the 3 SERCA pumps Atp2a1 (SERCA1), Atp2a2 (SERCA2) and Atp2a3 (SERCA3) were quantified with previously published (3) methods using two Affymetrix microarray platforms: Gene array 1.0 ST (exon oriented) and arrays (3 UTR oriented). Gene array 1.0 ST image files were generated using the Affymetrix GeneChip command console (AGCC). Raw data were analyzed with RMA sketch using the standard settings for Gene 1.0 ST arrays of Expression Console in the AGCC software (affymetrix). The arrays were analyzed using GCOS with the MAS5 algorithm. The fluorescence intensity of each individual chip was scaled to a target intensity of 150 using the global scaling method. Data were log2 transformed for normalization. Two reference genes, beta actin (Actb) and glyceraldehyde-3-phosphate dehydrogenase (Gapdh), were used to assess expression levels in all tested conditions. The identifiers of the informative probe sets for both arrays are shown in the table below. In order to estimate background level of signals for genes which are considered as non expressed, we analyzed the mean signal intensity of a set of 41 olfactory receptor genes for which probe sets exist both on the Gene 1.0 ST arrays and arrays. Mean background signal intensity for this set of negative control genes set was 24±3 for the Gene 1.0 ST arrays and 17±7 for the arrays. probeset probeset GENE array array Ryr _at Ryr _at Ryr _at Atp2a _at Atp2a _at Atp2a _a_at Actb _a_at Gapdh _s_at

11

12 Results and discussion Analysis of gene expression by two different methods (Gene array 1.0 ST (exon oriented) and arrays (3 UTR oriented) give very similar results in all tissues. As expected, skeletal muscles (gastrocnemius) and the heart strongly express mrna levels of Ryr1 and Ryr2, respectively. The brain expresses moderate levels of Ryr2 and Ryr3 mrna. However, FACS purified mouse pancreatic β-cells, mouse islets and the mouse insulin-secreting cell line, MIN6 cells, do not express significant amounts of Ryr mrna since the signals for the 3 Ryr isoforms are close to that of the background signal of a set of 41 olfactory receptor genes which are considered to be non expressed in any of the tissue studied. To validate further the method of gene expression analysis, we also evaluated the gene expression of the three SERCA isoforms (Atp2a1 to 3). ATP2a2 (SERCA2) gene (irrespective of both SERCA2a or SERCA2b isoforms) is expressed in all tested tissue, whereas ATP2a1 (SERCA1) and ATP2a3 (SERCA3) genes are specifically expressed in skeletal muscle cells and pancreatic β-cells, respectively. On the other hand, the 2 references genes Actb and Gapdh are, as expected for references genes, expressed at fairly constant levels across all tested tissues. References 1. Liu YJ, Gylfe E. Store-operated Ca 2+ entry in insulin-releasing pancreatic beta-cells. Cell Calcium 22: , Vasudevan SR, Lewis AM, Chan JW, Machin CL, Sinha D, Galione A, Churchill GC: The calciummobilizing messenger nicotinic acid adenine dinucleotide phosphate participates in sperm activation by mediating the acrosome reaction. J Biol Chem 285: Thorrez L, Laudadio I, Van Deun K, Quintens R, Hendrickx N, Granvik M, Lemaire K, Schraenen A, Van Lommel L, Lehnert S, Aguayo-Mazzucato C, Cheng-Xue R, Gilon P, Van Mechelen I, Bonner- Weir S, Lemaigre F, Schuit F. Tissue-specific disallowance of housekeeping genes: the other face of cell differentiation. Genome Res 21: Quoix N, Cheng-Xue R, Guiot Y, Herrera PL, Henquin JC, Gilon P. The GluCre-ROSA26EYFP mouse: a new model for easy identification of living pancreatic alpha-cells. FEBS Lett 581:

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the

More information

Supporting Information

Supporting Information Supporting Information Gerasimenko et al..73/pnas.39 SI Materials and Methods Reagents used in this study include Fluo-4/Fura- (Invitrogen), thapsigargin (albiochem), collagenase (Worthington), palmitoleic

More information

A thallium based screening procedure to identify molecules that modulate the activity of Ca 2+ -activated monovalent cation selective channels.

A thallium based screening procedure to identify molecules that modulate the activity of Ca 2+ -activated monovalent cation selective channels. Supplemental Material A thallium based screening procedure to identify molecules that modulate the activity of Ca 2+ -activated monovalent cation selective channels. Koenraad Philippaert *,1,2,3, Sara

More information

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

The sarcoendoplasmic reticulum Ca

The sarcoendoplasmic reticulum Ca SERCA3 Ablation Does Not Impair Insulin Secretion but Suggests Distinct Roles of Different Sarcoendoplasmic Reticulum Ca 2 Pumps for Ca 2 Homeostasis in Pancreatic -cells Abdelilah Arredouani, 1 Yves Guiot,

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

Store-operated influx of Ca 2+ in pancreatic β-cells exhibits graded dependence on the filling of the endoplasmic reticulum

Store-operated influx of Ca 2+ in pancreatic β-cells exhibits graded dependence on the filling of the endoplasmic reticulum RESEARCH ARTICLE 2179 Store-operated influx of Ca 2+ in pancreatic β-cells exhibits graded dependence on the filling of the endoplasmic reticulum Oleg Dyachok 1,2 and Erik Gylfe 1, * 1 Department of Medical

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 16, 2017 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin

More information

Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC

Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya

More information

Gene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering

Gene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering Gene expression analysis Roadmap Microarray technology: how it work Applications: what can we do with it Preprocessing: Image processing Data normalization Classification Clustering Biclustering 1 Gene

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 15, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 15, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 15, 2018 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

Glucose homeostasis is supported in a complex. Involvement of K ATP Channels From Both a-cells and

Glucose homeostasis is supported in a complex. Involvement of K ATP Channels From Both a-cells and ORIGINAL ARTICLE Tolbutamide Controls Glucagon Release From Mouse Islets Differently Than Glucose Involvement of K ATP Channels From Both a-cells and d-cells Rui Cheng-Xue, 1 Ana Gómez-Ruiz, 1 Nancy Antoine,

More information

Ca 2+ controls slow NAD(P)H oscillations in glucose-stimulated mouse pancreatic islets

Ca 2+ controls slow NAD(P)H oscillations in glucose-stimulated mouse pancreatic islets J Physiol 572.2 (2006) pp 379 392 379 Ca 2+ controls slow NAD(P)H oscillations in glucose-stimulated mouse pancreatic islets Dan S. Luciani 1,2, Stanley Misler 3 and Kenneth S. Polonsky 3 1 Department

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage

More information

Comprehensive and Easy Course Notes for BIOL1040 Exams and Assessment

Comprehensive and Easy Course Notes for BIOL1040 Exams and Assessment Comprehensive and Easy Course Notes for BIOL1040 Exams and Assessment MODULE 1: PRINCIPLES OF CELL FUNCTION Membrane Structure & Function Cellular membranes are fluid mosaics of lipids and proteins Phospholipids

More information

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Ivan Zanoni*, Renato Ostuni*, Simona Barresi, Marco Di Gioia, Achille Broggi, Barbara Costa, Roberta

More information

Organismic Biology Bio 207. Lecture 6. Muscle and movement; sliding filaments; E-C coupling; length-tension relationships; biomechanics. Prof.

Organismic Biology Bio 207. Lecture 6. Muscle and movement; sliding filaments; E-C coupling; length-tension relationships; biomechanics. Prof. Organismic Biology Bio 207 Lecture 6 Muscle and movement; sliding filaments; E-C coupling; length-tension relationships; biomechanics Prof. Simchon Today s Agenda Skeletal muscle Neuro Muscular Junction

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 18, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 18, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 18, 2016 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Alterations of the Ca 2+ signaling pathway in pancreatic beta-cells isolated from db/db mice

Alterations of the Ca 2+ signaling pathway in pancreatic beta-cells isolated from db/db mice Protein Cell 214, 5(1):783 794 DOI 1.17/s13238-14-75-7 Alterations of the Ca 2+ signaling pathway in pancreatic beta-cells isolated from db/db mice Kuo Liang 1, Wen Du 2, Jingze Lu 2, Fei Li 1&, Lu Yang

More information

High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart.

High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. Daniel Aston, Rebecca A. Capel, Kerrie L. Ford, Helen C. Christian,

More information

Animal Physiology Study Guide

Animal Physiology Study Guide Animal Physiology Study Guide 1. Which of the following are an example of passive transport? 2. Which active transport? 3. How can you tell? 1. Which of the following are an example of passive transport?

More information

Cholesterol determination using protein-templated fluorescent gold nanocluster probes

Cholesterol determination using protein-templated fluorescent gold nanocluster probes Electronic Supplementary Information for Cholesterol determination using protein-templated fluorescent gold nanocluster probes Xi Chen and Gary A. Baker* Department of Chemistry, University of Missouri-Columbia,

More information

G-PROTEIN-INDEPENDENT ACTIVATION OF AN INWARD Na + CURRENT

G-PROTEIN-INDEPENDENT ACTIVATION OF AN INWARD Na + CURRENT JBC Papers in Press. Published on August 2, 2002 as Manuscript M203888200 1 G-PROTEIN-INDEPENDENT ACTIVATION OF AN INWARD Na + CURRENT BY MUSCARINIC RECEPTORS IN MOUSE PANCREATIC β-cells Jean-François

More information

Supplementary legends

Supplementary legends Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:

More information

Inhibition of Fructose Diphosphate Aldolase by Phosphatidylserine Liposomes

Inhibition of Fructose Diphosphate Aldolase by Phosphatidylserine Liposomes Gen. Physiol. Biophys. (1994), 13, 425 431 425 Short communication Inhibition of Fructose Diphosphate Aldolase by Phosphatidylserine Liposomes D. KWIATKOWSKA 1, T. MODRZYCKA 2 and A. SIDOROWICZ 2 1 Department

More information

Objectives. Functions of smooth muscle. Smooth muscle. Smooth Muscle Contraction: Mechanism. Latch state. Smooth muscle contraction

Objectives. Functions of smooth muscle. Smooth muscle. Smooth Muscle Contraction: Mechanism. Latch state. Smooth muscle contraction Objectives Functions of smooth muscle Sompol Tapechum,, M.D., Ph.D. Department of Physiology Faculty of Medicine Siriraj hospital อธ บายล กษณะการหดต วของกล ามเน อเร ยบได อธ บายกลไกและป จจ ยท ม ผลต อการหดต

More information

GLP-1 stimulates insulin secretion by PKC-dependent TRPM4 and TRPM5 activation

GLP-1 stimulates insulin secretion by PKC-dependent TRPM4 and TRPM5 activation GLP-1 stimulates insulin secretion by PKC-dependent TRPM4 and TRPM5 activation Makoto Shigeto, 1,2,3 Reshma Ramracheya, 1 Andrei I. Tarasov, 1,4 Chae Young Cha, 1,2 Margarita V. Chibalina, 1 Benoit Hastoy,

More information

Fluorescent Ion and ph Indicators

Fluorescent Ion and ph Indicators Fluorescent Ion and ph Indicators And Related Products Overview... p. 2 Calcium indicators Fluo-3... p. 2 Fluo-4... p. 2 Fura-2... p. 3 Bis-fura-2... p. 3 Furaptra... p. 3 Indo-1... p. 3 Rhod-2... p. 4

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

Calcium Signalling and Regulation of Cell Function

Calcium Signalling and Regulation of Cell Function Calcium Signalling and Regulation of Cell Function Martin D Bootman, The Babraham Institute, Cambridge, UK Peter Lipp, The Babraham Institute, Cambridge, UK The calcium ion (Ca 2+ ) is an almost universal

More information

Prasanna K. Dadi, Nicholas C. Vierra, and David A. Jacobson

Prasanna K. Dadi, Nicholas C. Vierra, and David A. Jacobson DIABETES-INSULIN-GLUCAGON-GASTROINTESTINAL Pancreatic -Cell specific Ablation of TASK-1 Channels Augments Glucose-stimulated Calcium Entry and Insulin Secretion, Improving Glucose Tolerance Prasanna K.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Cellular Bioelectricity

Cellular Bioelectricity ELEC ENG 3BB3: Cellular Bioelectricity Notes for Lecture 22 Friday, February 28, 2014 10. THE NEUROMUSCULAR JUNCTION We will look at: Structure of the neuromuscular junction Evidence for the quantal nature

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona.

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene therapy: State of the art Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene Therapy: First Steps Type 1 diabetes: An islet disease Alpha cell Beta cell Pancreatic

More information

The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman

The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman The spread of tumors, a process called metastasis, is a dreaded complication

More information

Functions of Lysosomes

Functions of Lysosomes Functions of Lysosomes Intro - Degradation of cell components -Cell death -Autophagy 1st - Exocytosis / Secretory pathway - Calcium signalling 2nd O BayDH., (2009) Phosphatidylcholine Intro Phosphatidylcholine

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.

Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain. Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain. A B C (A) Schematic representation of the new constructs designed for local camp imaging.

More information

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino

More information

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified

More information

Nature Biotechnology: doi: /nbt.3828

Nature Biotechnology: doi: /nbt.3828 Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus

More information

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,

More information

Mechanisms of Cell Injury: Loss of Calcium Homeostasis

Mechanisms of Cell Injury: Loss of Calcium Homeostasis Mechanisms of Cell Injury: Loss of Calcium Homeostasis SCPA610: Cellular Pathology Amornrat N. Jensen, Ph.D. amornrat.nar@mahidol.ac.th Leading questions Why is intracellular calcium important for the

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

5-Nervous system II: Physiology of Neurons

5-Nervous system II: Physiology of Neurons 5-Nervous system II: Physiology of Neurons AXON ION GRADIENTS ACTION POTENTIAL (axon conduction) GRADED POTENTIAL (cell-cell communication at synapse) SYNAPSE STRUCTURE & FUNCTION NEURAL INTEGRATION CNS

More information

2017, Pharmapex USA, A Member of Apex Group of Companies

2017, Pharmapex USA, A Member of Apex Group of Companies 2017, Pharmapex USA, A Member of Apex Group of Companies Natural Blood Health Aid uses a proprietary and licensed Virgin Isolate Technology, invented which recreates the Ayurvedic method used in ancient

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains

Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's

More information

Gene annotation for heart rhythm. 1. Control of heart rate 2. Action Potential 3. Ion channels and transporters 4. Arrhythmia 5.

Gene annotation for heart rhythm. 1. Control of heart rate 2. Action Potential 3. Ion channels and transporters 4. Arrhythmia 5. Gene annotation for heart rhythm 1. Control of heart rate 2. Action Potential 3. Ion channels and transporters 4. Arrhythmia 5. EC coupling Control of heart rate Autonomic regulation of heart function

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Muscle Cells & Muscle Fiber Contractions. Packet #8

Muscle Cells & Muscle Fiber Contractions. Packet #8 Muscle Cells & Muscle Fiber Contractions Packet #8 Skeletal muscle is attached to bones and is responsible for movement. Introduction Introduction II Skeletal muscle is composed of bundles of muscle fibers

More information

Challenges and Opportunities for In Vivo Imaging in Oncology

Challenges and Opportunities for In Vivo Imaging in Oncology Challenges and Opportunities for In Vivo Imaging in Oncology Daniel C. Sullivan, M.D. Unraveling of the genome and proteome, and advances in biomedical technology are changing the practice of medicine

More information

Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection

Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic

More information

TA Review. Neuronal Synapses. Steve-Felix Belinga Neuronal synapse & Muscle

TA Review. Neuronal Synapses. Steve-Felix Belinga Neuronal synapse & Muscle TA Review Steve-Felix Belinga sbelinga@wustl.edu Neuronal synapse & Muscle Neuronal Synapses 1 Things you should know beyond the obvious stuff 1. Differences between ionotropic and metabotropic receptors.

More information

Synthetic microrna Reference Standards Genomics Research Group ABRF 2015

Synthetic microrna Reference Standards Genomics Research Group ABRF 2015 Synthetic microrna Reference Standards Genomics Research Group ABRF 2015 Don A. Baldwin, Ph.D. support@signalbiology.com Reference samples for Platform evaluation Protocol development Assay service improvement

More information

Endocrine Journal 2013, 60 (5),

Endocrine Journal 2013, 60 (5), Endocrine Journal 2013, 60 (5), 599-607 Or i g i n a l A new experimental model of ATP-sensitive K + channelindependent insulinotropic action of glucose: a permissive role of camp for triggering of insulin

More information

Receptors Families. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia

Receptors Families. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Receptors Families Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Receptor Families 1. Ligand-gated ion channels 2. G protein coupled receptors 3. Enzyme-linked

More information

Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells

Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Supporting Information for Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Sasa Zhu, Weiying Lin,* Lin Yuan State Key Laboratory of Chemo/Biosensing

More information

Control of Glucose Metabolism

Control of Glucose Metabolism Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream

More information

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.

More information

Outline. Neuron Structure. Week 4 - Nervous System. The Nervous System: Neurons and Synapses

Outline. Neuron Structure. Week 4 - Nervous System. The Nervous System: Neurons and Synapses Outline Week 4 - The Nervous System: Neurons and Synapses Neurons Neuron structures Types of neurons Electrical activity of neurons Depolarization, repolarization, hyperpolarization Synapses Release of

More information

Gene expression in insulin resistance

Gene expression in insulin resistance Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

The central importance of glucose homeostasis. Dynamics of Calcium Clearance in Mouse Pancreatic -Cells

The central importance of glucose homeostasis. Dynamics of Calcium Clearance in Mouse Pancreatic -Cells Dynamics of Calcium Clearance in Mouse Pancreatic -Cells Liangyi Chen, 1 Duk-Su Koh, 1,2 and Bertil Hille 1 Pancreatic -cells maintain glucose homeostasis by their regulated Ca 2 -dependent secretion of

More information

(6, 7) and is referred to as the KATp-channel-independent. to affect the KATP channel-for example, after closing the

(6, 7) and is referred to as the KATp-channel-independent. to affect the KATP channel-for example, after closing the Proc. Natl. cad. Sci. US Vol. 9, pp. 178-173, November 1995 Cell iology Glucose stimulation of insulin release in the absence of extracellular Ca' and in the absence of any increase in intracellular Ca

More information

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of

More information

Simple, rapid, and reliable RNA sequencing

Simple, rapid, and reliable RNA sequencing Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the

More information

Closing in on the Mechanisms of Pulsatile Insulin Secretion

Closing in on the Mechanisms of Pulsatile Insulin Secretion Diabetes Volume 67, March 2018 351 Closing in on the Mechanisms of Pulsatile Insulin Secretion Richard Bertram, 1 Leslie S. Satin, 2 and Arthur S. Sherman 3 Diabetes 2018;67:351 359 https://doi.org/10.2337/dbi17-0004

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature6416 Supplementary Notes Spine Ca 2+ signals produced by glutamate uncaging We imaged uncaging-evoked [Ca 2+ ] transients in neurons loaded with a green Ca 2+ - sensitive indicator (G;

More information

BIOL Week 6. Nervous System. Transmission at Synapses

BIOL Week 6. Nervous System. Transmission at Synapses Collin County Community College BIOL 2401 Week 6 Nervous System 1 Transmission at Synapses Synapses are the site of communication between 2 or more neurons. It mediates the transfer of information and

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Alteration of Expression of Ca 2+ Signaling Proteins and Adaptation of Ca 2+ Signaling in SERCA2 +/- Mouse Parotid Acini

Alteration of Expression of Ca 2+ Signaling Proteins and Adaptation of Ca 2+ Signaling in SERCA2 +/- Mouse Parotid Acini Yonsei Med J 49(2):311-321, 2008 DOI 10.3349/ymj.2008.49.2.311 Alteration of Expression of Ca 2+ Signaling Proteins and Adaptation of Ca 2+ Signaling in SERCA2 +/- Mouse Parotid Acini Jong-Hoon Choi, 1

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Depletion of Ca 2 from the sarcoplasmic reticulum of cardiac muscle prompts phosphorylation of phospholamban to stimulate store refilling

Depletion of Ca 2 from the sarcoplasmic reticulum of cardiac muscle prompts phosphorylation of phospholamban to stimulate store refilling Proc. Natl. Acad. Sci. USA Vol. 95, pp. 1484 1489, February 1998 Biochemistry Depletion of Ca 2 from the sarcoplasmic reticulum of cardiac muscle prompts phosphorylation of phospholamban to stimulate store

More information

Different Effects of Verapamil on Cytosolic Ca 2+ and Contraction in Norepinephrine-Stimulated Vascular Smooth Muscle

Different Effects of Verapamil on Cytosolic Ca 2+ and Contraction in Norepinephrine-Stimulated Vascular Smooth Muscle Japan. J. Pharmacol. 55, 35-42 (1991) Different Effects of Verapamil on Cytosolic Ca 2+ and Contraction in Norepinephrine-Stimulated Vascular Smooth Muscle Hideaki Karaki, Koichi Sato and Hiroshi Ozaki

More information

Problem Set 3 - Answers. -70mV TBOA

Problem Set 3 - Answers. -70mV TBOA Harvard-MIT Division of Health Sciences and Technology HST.131: Introduction to Neuroscience Course Director: Dr. David Corey HST 131/ Neuro 200 18 September 05 Explanation in text below graphs. Problem

More information

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

UMBC REU Site: Computational Simulations of Pancreatic Beta Cells

UMBC REU Site: Computational Simulations of Pancreatic Beta Cells UMBC REU Site: Computational Simulations of Pancreatic Beta Cells Sidafa Conde 1, Teresa Lebair 2, Christopher Raastad 3, Virginia Smith 4 Kyle Stern, 5 David Trott 5 Dr. Matthias Gobbert 5, Dr. Bradford

More information

18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin

18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin 18. PANCREATIC FUNCTION AND METABOLISM ISLETS OF LANGERHANS Some pancreatic functions have already been discussed in the digestion section. In this one, the emphasis will be placed on the endocrine function

More information

ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION

ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION ABS04-2004 Applied Bayesian Statistics School STATISTICS & GENE EXPRESSION GENOMICS: METHODS AND COMPUTATIONS Mike West Duke University Centro Congressi Panorama, Trento,, Italy 15th-19th 19th June 2004

More information

Component Analysis of an Excitation-Emission Matrix of Water Samples Using PARAFAC Analysis

Component Analysis of an Excitation-Emission Matrix of Water Samples Using PARAFAC Analysis FP-2 Introduction Excitation-Emission Matrix (EEM) can be used in a wide variety of applications, especially in the analysis of environmental water. EEM provides the following information; (1) determining

More information

The rabbit femoral artery was prepared and each arterial ring was permeabilized

The rabbit femoral artery was prepared and each arterial ring was permeabilized Online Supplement Nakmura et al. cgmp-dependent relaxation of smooth muscle Materials and Methods Measurement of tension The rabbit femoral artery was prepared and each arterial ring was permeabilized

More information

Supplementary Material

Supplementary Material Supplementary Material Fig. S1. Gpa33 -/- mice do not express Gpa33 mrna or GPA33 protein. (A) The Gpa33 null allele contains a premature translational stop codon (STOP) in exon 2, and almost all of the

More information

Chapter 11 Calcium Signaling in the Islets

Chapter 11 Calcium Signaling in the Islets Chapter 11 Calcium Signaling in the Islets Md. Shahidul Islam Abstract Easy access to rodent islets and insulinoma cells and the ease of measuring Ca 2+ by fluorescent indicators have resulted in an overflow

More information

Biology 2100 Human Physiology C. Iltis SLCC March 8, Midterm Examination #2

Biology 2100 Human Physiology C. Iltis SLCC March 8, Midterm Examination #2 Biology 2100 Human Physiology Name: KEY C. Iltis SLCC March 8, 2000 Midterm Examination #2 Multiple Choice Questions (2 POINTS EACH) 1. When glucose levels are above 100 mg/dl, which of the following is

More information

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells a CD11c Na + K + ATPase Na + K + ATPase CD11c x-y CD11c Na + K + ATPase Na + K + ATPase CD11c x-z c b x-y view BoNT NAPs CD11c BoNT CD11c NAPs BoNT NAPs CD11c 90 x-z view Apical Basolateral Supplementary

More information

Synaptic Transmission

Synaptic Transmission Synaptic Transmission Graphics are used with permission of: Pearson Education Inc., publishing as Benjamin Cummings (http://www.aw-bc.com) Page 1. Introduction Synaptic transmission involves the release

More information