a Regenerating (reg) Gene Pancreas Treated wi th
|
|
- Moses Harvey
- 5 years ago
- Views:
Transcription
1 Endocrine Journal 1995, 42(5), Increased Expression of Protein in Neonatal Rat Streptozotocin a Regenerating (reg) Gene Pancreas Treated wi th ToMIO OHNO, CHIKARA ISHII, NoRIHIRO KATO, YOSHITO ITO, MITsuo SHIMIZU, SHDIcHI TOMONO, KAZUHIKO MURATA, AND SHOJI KAWAZU The 2nd Department of Internal Medicine, Gunma University School of Medicine, Gunma 371, Japan Abstract. We examined the expression of reg protein in neonatal rat pancreas treated with streptozotocin (STZ) by means of the immunohistochemical technique and northern blotting. Seven days after STZ injection, the plasma glucose levels in STZ-treated neonatal rats were significantly higher than those in control rats. Scattered distribution of reg protein in pancreatic islet cells was clearly observed in STZ-treated rats, but not in control rats. On the other hand, reg protein was positively stained in the exocrine cells in both groups of rats. Northern blot analyses revealed that the expression of insulin mrna markedly decreased in STZ-treated rat pancreas, but a significant increase in reg mrna expression was recognized in the STZ-treated rat pancreas compared with that of control rats. Rats treated with STZ during the neonatal period have been used as a model of non-insulin-dependent diabetes mellitus (NIDDM) and beta cell regeneration. Thus, the increased reg gene expression in neonatal STZ-treated rat pancreas was therefore described for the first time, and this would be a useful model for studying the relationship between NIDDM and beta cell regeneration or reg gene protein. Key words: reg protein, Pancreatic islet cell, Neonatal rat, Streptozotocin, Beta cell regeneration (Endocrine Journal 42: ,1995) WHEN neonatal rats were treated with streptozotocin (STZ), they exhibitted a transient hyperglycemia that was somewhat restored later, and ultimately developed non-insulin-dependent diabetes in the adult [1-4]. These changes were accompanied by a marked initial destruction and loss of pancreatic beta cells rapidly followed by the signs of repair. This latter process might be caused by beta cell regeneration or differentiation. A cdna termed reg was recently isolated by differential screening of a library prepared from regenerating islets isolated from pancreatic remnants of rats subjected to 90% pancreatectomy and Received: January 12, 1995 Accepted: May 18, 1995 Correspondence to: Dr. Tomio OHNO, The 2nd Department of Internal Medicine, Gunma University School of Medicine, Showa-machi, Maebashi, Gunma 371, Japan nicotinamide treatment [5]. We have previously reported that insulin administration to the BB/ Wor/ /Tky rat, a spontaneously occurring IDDM model, induced remission of diabetes and the concomitant appearance of regenerating gene protein in pancreatic islets [6]. In this study, we examined the expression of reg gene protein in neonatal rat pancreas treated with STZ, by means of the immunohistochemical technique and northern blotting. This study is the first to show the increased reg gene expression in neonatal STZ rat pancreas. Animals Materials and Methods On the second day after birth, 100 mg/ kg body weight of streptozotocin (STZ) dissolved in 25 p1
2 650 OHNO et al. of citrate buffer (50 mm, ph 4.5) was intraperitoneally injected into normal Wistar rats (n=10). STZ was purchased from Sigma (St Louis, MO). Control rats received vehicle alone (n=10). On the 7th day after injection, all the rats were sacrificed for experiments. Biochemical study After anesthesia with ethyl ether, a blood sample was drawn by heart puncture and the pancreas was taken for biochemical and histological examinations. The plasma glucose level was measured by the glucoseoxidase method, applying Glutest E and chips (Sanwa Kagaku Co. Ltd. Japan). Histological observations For light microscopy, pancreatic tissue samples were immediately fixed in formalin solution and then embedded in paraffin. The sections were immunohistochemically stained either with mouse anti-rat reg protein monoclonal antibody (1:500) or guinea pig anti-swine insulin antibody (1:200), applying an LSAB Kit (DAKO Co., Ltd., Calif., USA). Counterstaining was done with Meyer's hematoxylin as the usual method. Anti-reg protein antibody was kindly donated by Prof. H. Okamoto of the 1st Department of Biochemistry, Tohoku University School of Medicine. Northern blotting RNA from the pancreas was isolated by a guanidine thiocyanate method [7], electrophoresed on a 1.5% agarose gel, transferred onto a nitrocellulose filter, and hybridized to the 32P-labeled specific cdna probe of rat preproinsulin or rat reg. The filters were washed and autoradiographed. Quantitation of the target RNAs was performed by scanning densitometry. The rat reg cdna was kindly donated by Prof. H. Okamoto of the 1st Department of Biochemisty, Tohoku University School of Medicine. Results Seven days after STZ-injection, the plasma glucose levels in STZ-treated rats were significantly higher than those in control rats (P<0.01, Table 1). Representative pictures of pancreatic tissues from STZ-treated and control rats are shown in Fig. 1. Islet from control rats was intact and positively stained with anti-insulin antibody, while islet from STZ-treated rat was damaged in the structure. Scattered distribution of reg protein in pancreatic islet cells was observed mainly in STZ-treated rats, but not in islets of the-control rats. On the other hand, reg protein was positively stained in the exocrine cells in both groups of rats. Figure 2 shows northern blots of the pancreas RNA sample hybridized with the radiolabelled preproinsulin and reg cdna probes, respectively. Northern blot analysis revealed that the expression of insulin mrna markedly decreased in STZ-treated rats, but an increase in reg expression was recognized in the STZ-treated rat pancreas compared with that of control rats. When expressed as a percentage of the level found in the non-stz treated rat, the level of reg mrna in the STZ-treated rat was significantly increased (P<0.05, Fig. 3). Discussion Terazono et al. first reported the prominent expression of reg protein in the model of islet regeneration, using 90% pancreatectomized nicotinamide-treated rats [5]. Miyaura reported the rebound expression of reg protein in the insulinoma-bearing NEDH rat after its removal [8]. We recently reported the appearance of reg protein in the pancreatic islets in the remission BB/Wor// Table 1. Profile of study groups Statistical analyses Unpaired Student's t-test was used for statistical analyses with 95% confidence of significance.
3 REG Fig. 1. PROTEIN IN NEONATAL STZ RAT PANCREAS 651 Representative pictures of pancreatic islets obtained by histological examinations. The pictures show the pancreases from STZ-treated (STZ+) and non-stz treated (STZ-) Wistar rats at the 7th day after STZ-injection. Each pancreas was stained with anti-insulin antibody (Insulin) or anti-reg protein antibody (Reg) applying an LSAB kit. Tky rat [6]. In this study, we found a new model in which there was increased reg gene expression in the whole pancreas and the appearance of reg beta cell mass [10] and that this regeneration was characterized by new islets budding from the ducts and by replication of beta cells in preexisting islets protein in the pancreatic islet cells. Neonatal rats treated with STZ exhibit an insulin-deficient acute diabetes which is characterized by spontaneous remission [1-4], in contrast with STZ-induced irreversible diabetes in adults [9]. In the neonatal STZ-induced diabetic rat, it has been shown that the recovery of the pancreatic insulin content was related to an increase in total [11]. There are several reports which indicate a close relationship between reg gene expression and replication of islet beta cells in vivo and in vitro [6, 12-14]. The reg protein is, in some ways, considered to act on pancreatic beta cells as an autocrine growth factor [15]. This finding which revealed stained reg protein in STZ-treated that the strong neonatal rat pan-
4 652 OHNO et al. Fig. 3. Quantitation of insulin and reg mrna expression in pancreas with non-stz treated and STZ treated neonatal rats by densitometric scanning. Data (mean ± SD of 10 samples) are expressed as relative density units (non-stz treated rat=100%). *P<0.05 vs. non-stz treated rats. Fig. 2. Northern blot analysis of RNAs from STZ treated and non-stz treated rat pancreas using rat creas could be new evidence of a correlation between beta cell regeneration after injury and reg protein. preproinsulin and reg cdna, 20 ug of total RNA from non-stz treated (lane 1-3) or STZ treated (lane 4-7) rat pancreas was applied. Total RNA was hybridized with rat preproinsulin cdna (A) and reg cdna (B). C: Picture of EtdBr staining, allowing comparison of the total amount of RNA per sample. Recent reports showed that the reg sequence is identical to that of pancreatic stone protein [14,16,17] and pancreatic thread protein [18] which are expressed as pancreatic acinar cells. We could not clarify whether the increased reg gene expression was mainly derived from acinar or islet cells in this study, however, the strong stained reg protein in islet cells of STZ-treated neonatal rat suggested that the expressing reg protein was also pronounced in islet cells after injury by STZ. In situ hybridization is required to reveal the localization of reg gene expression, but a direct relationship between reg protein and beta cells remains to be clarified. This model would be able to contribute to further investigation of beta cell repair or regeneration including the possible interrelationship between exocrine and endocrine pancreas. Acknowledgment This work was supported by a Grant for Diabetes Research from the Ministry of Health and Welfare in Japan. The authors wish to thank Miss M. Ubukata, Miss A. Kochibe, Mrs Y. Nonaka and Miss M. Okabe for their excellent technical assistance.
5 REG PROTEIN IN NEONATAL STZ RAT PANCREAS 653 References 1. Portha B, Levacher C, Picon L, Rosselin G (1974) Diabetogenic effect of streptozotosin in the rat during the perinatal period. Diabetes 23: Portha B, Picon L, Rosselin G (1979) Chemical diabetes in the adult rat as the spontaneous evolution of neonatal diabetes. Diabetologia 17: Portha B, Blondel 0, Serradas P, McEvoy R, Giroix MH, Kergoat M, Bailbe D (1989) The rat models of non insulin dependent diabetes induced by neonatal streptozotocin. Diabete Metab 15: Weir GC, Leahy JL, Bonner-Weir S (1986) Experimental reduction of B-cell mass: implications for the pathogenesis of diabetes. Diabet Metab Rev 2: Terazono T, Yamamoto H, Takasawa S, Shiga K, Yonemura Y, Tochino Y, Okamoto H (1988) A novel gene activated in regenerating islets. J Biol Chem 263: Ishii C, Kawazu S, Tomono S, Ohno T, Shimizu M, Kato N, Fukuda M, Ito Y, Kurihara S, Murata K, Komeda K (1993) Appearance of a regenerating (reg) gene protein in pancreatic islets of remission BB/Wor/ /Tky rats. Endocr J 40: MacDonald RJ, Swift GH, Przybyla AE, Chirgwin JM (1987) Isolation of RNA using guanidinium salts. Methods Enzymol 152: Miyaura C, Chen L, Appel M, Alam T, Inman L, Hughes SD, Milburn JL, Ungar RH, Newgard CB (1991) Expression of reg/psp, a pancreatic exocrine gene: relationship to changes in islet /3-cell mass. Mol Endo 91: Steiner H, Oeltz 0, Zahn G, Froesch ER (1970) Studies on islet regeneration, hyperplasia and intrainsular interrelations in long-lasting streptozotocin diabetes in rats. Diabetologia 6: Agren A, Portha B, Petersson B (1979) Diabetogenic effect of streptozotocin in the insulin producing cells in neonatal rats. Acta Endocrinol (Suppl) 227: 5A. 11. Cantenys D, Portha B, Dutrillaux MC, Hollande E, Roze C, Picon L (1981) Histogenesis of the endocrine pancreas in newborn rats after destruction by streptozotocin. An immunocytochemical study. Virchows Arch 35: Francis PJ, Southgate JL, Wilkin TJ,Bone AJ (1992) Expression of an islet regenerating (reg) gene in isolated rat islets: Effects of nutrient and non-nutrient growth factors. Diabetologia 35: Terazono K, Uchiyama Y, Ide M, Watanabe T, Yonekura H, Yamamoto H, Okamoto H (1990) Expression of reg protein in rat regenerating islets and its co-localization with insulin in the beta cell secretory granules. Diabetologia 33: Unno M, Yonekura H, Nakagawara K, Watanabe T, Miyashita H, Moriizumi S, Okamoto H, Itoh T, Teraoka H (1993) Structure, chromosomal locarization, and expression of mouse reg genes, regi and regii. J Biol Chem 268: Watanabe T, Yonemura Y, Yonekura H, Suzuki Y, Miyashita H, Sugiyama K, Moriizumi S, Unno M, Tanaka 0, Kondo H, Bone AJ, Takasawa S, Okamoto H (1994) Pancreatic beta cell replication and amelioration of surgical diabetas by reg protein. Proc Nat! Acad Sci USA 91: Stewart TA (1989) The human reg gene encodes pancreatic stone protein. Biochem J 260: Watanabe T, Yonekura H, Terazono K, Yamamoto H, Okamoto H (1990) Complete nucleotide sequence of human reg gene and its expression in normal and tumoral tissue. J Biol Chem 265: Gross J, Carlson RJ, Brauer AW, Morgolies MN, Warshw AL, Wands JR (1985) Isolation, characterization and distribution of an unusual pancreatic human secretory prtotein. J Clin Invest 76:
Strain Differences in the Diabetogenic Activity of Streptozotocin in Mice
1110 Biol. Pharm. Bull. 29(6) 1110 1119 (2006) Vol. 29, No. 6 Strain Differences in the Diabetogenic Activity of Streptozotocin in Mice Koji HAYASHI, Rhyoji KOJIMA, and Mikio ITO* Laboratory of Analytical
More informationExpression of Reg and cytokeratin 20 during ductal cell differentiation and proliferation in a mouse model of autoimmune diabetes
European Journal of Endocrinology (1999) 141 644 652 ISSN 0804-4643 EXPERIMENTAL STUDY Expression of Reg and cytokeratin 20 during ductal cell differentiation and proliferation in a mouse model of autoimmune
More informationDiabetologia 9 Springer-Vcrlag 1993
Diabetologia (1993) 36:305-309 Diabetologia 9 Springer-Vcrlag 1993 Preferential alteration of oxidative relative to total glycolysis in pancreatic islets of two rat models of inherited or acquired Type
More informationDifferential Expression of reg-i and reg-ii Genes During Aging in the Normal Mouse
Journal of Gerontology: BIOLOGICAL SCIENCES 1996, Vol. 51A, No. 5, B308-B315 Copyright 1996 by The Gerontological Society of America Differential Expression of reg-i and reg-ii Genes During Aging in the
More informationWestern Blot Analysis of Rat Pituitar Recognized by Human Antipituitary. y Antigens A. antibodies
Endocrine Journal 1995, 42(1), 115-119 NOTE Western Blot Analysis of Rat Pituitar Recognized by Human Antipituitary y Antigens A ntibodies SHIGEKI YABE, MASAMI MURAKAMI*, KAYOKO MARUYAMA, HIDEKO MIWA,
More informationReversal of Glucose Insensitivity of Pancreatic B-Cells Due to Prolonged Exposure to High Glucose in Culture : Effect of Nicotinamide on
Tohoku J. Exp. Med., 1993, 169, 159-166 Reversal of Glucose Insensitivity of Pancreatic B-Cells Due to Prolonged Exposure to High Glucose in Culture : Effect of Nicotinamide on Pancreatic B-Cells HISAKO
More informationDiabetologia 9 Springer-Verlag 1994
Diabetologia (1994) 37:351-357 Diabetologia 9 Springer-Verlag 1994 Irreversible loss of normal beta-cell regulation by glucose in neonatally streptozotocin diabetic rats K. Inoue ~, M. Cetkovic-Cvrlj c
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationEffect of glucose on beta cell proliferation and population size in organ culture of foetal and neonatal rat pancreases
J. Embryol. exp. Morph. 74, 303-312 (1983) 3Q3 Printed in Great Britain The Company of Biologists Limited 1983 Effect of glucose on beta cell proliferation and population size in organ culture of foetal
More informationDiabetologia 9 Springer-Verlag 1983
Diabetologia (1983) 25: 51-55 Diabetologia 9 Springer-Verlag 1983 Experimental Hypothalamic or Genetic Obesity in the Non-Insulin-Dependent Diabetic Rat B. Portha 1, R. Goursot t, M. H. Giroix 1, S. Nicola'fdis
More informationThe Role of Islet Neogeneis-Associated Protein (INGAP) in Pancreatic Islet Neogenesis
Current Protein and Peptide Science, 2009, 10, 37-45 37 The Role of Islet Neogeneis-Associated Protein (INGAP) in Pancreatic Islet Neogenesis Gary L. Pittenger*, David Taylor-Fishwick, Aaron I. Vinik The
More informationJournal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
More informationProduction and Characterization of Reg Knockout Mice Reduced Proliferation of Pancreatic -Cells in Reg Knockout Mice
Production and Characterization of Reg Knockout Mice Reduced Proliferation of Pancreatic -Cells in Reg Knockout Mice Michiaki Unno, Koji Nata, Naoya Noguchi, Yoichi Narushima, Takako Akiyama, Takayuki
More informationPancreatic Thread Protein Is Mitogenic to Pancreatic-Derived Cells in Culture
GASTROENTEROLOGY 1996;110:1208 1214 Pancreatic Thread Protein Is Mitogenic to Pancreatic-Derived Cells in Culture MICHAEL E. ZENILMAN,* THOMAS H. MAGNUSON,* KEVIN SWINSON,* JOSEPHINE EGAN, RICCARDO PERFETTI,
More informationKeywords FAD-linked glycerol-3-phosphate dehydrogenase,
Diabetologia (1998) 41: 649±653 Ó Springer-Verlag 1998 Overexpression of mitochondrial FAD-linked glycerol-3-phosphate dehydrogenase does not correct glucose-stimulated insulin secretion from diabetic
More informationExperiments were carried out then with the object of producing complete disappearance of the A
Relation of Glucagon to A Cells of the Pancreas*. (22339) SERGIO A. BENCOSME AND J. FREI. (Introduced by J.S.L. Browne Departament of pathology, Queen`s University, Kingston, Ontario, Canada. In spite
More informationReduced expression of the liver/beta-cell glucose transporter isoform in glucose-insensitive pancreatic beta cells of diabetic rats
Proc. Nad. cad. Sci. US Vol. 87, pp. 6492-6496, September 1990 Cell Biology Reduced expression of the liver/beta-cell glucose transporter isoform in glucose-insensitive pancreatic beta cells of diabetic
More informationC Annerén. Introduction
145 Dual role of the tyrosine kinase GTK and the adaptor protein SHB in β-cell growth: enhanced β-cell replication after 60% pancreatectomy and increased sensitivity to streptozotocin C Annerén Department
More informationDistribution of Pancreatic Polypeptide in the Head of the Human Pancreas. By Andrew Kringas
Distribution of Pancreatic Polypeptide in the Head of the Human Pancreas By Andrew Kringas Diabetes (Diabetes mellitus) A condition when the body doesn t properly respond to insulin Type 1 Type 2 Gestational
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationN Dachicourt, P Serradas, D Bailbé, M Kergoat 1, L Doaré 1 and B Portha
369 Glucagon-like peptide-1(7 36)-amide confers glucose sensitivity to previously glucose-incompetent β-cells in diabetic rats: in vivo and in vitro studies N Dachicourt, P Serradas, D Bailbé, M Kergoat
More informationPANCREATIC BETA CELLS PRODUCE AND SECRETE
15 March, 2018 PANCREATIC BETA CELLS PRODUCE AND SECRETE Document Filetype: PDF 374.06 KB 0 PANCREATIC BETA CELLS PRODUCE AND SECRETE Among the oldest and cheapest drugs for diabetes are the drugs that
More informationReceptors of Paraneurons, with Special Reference to Glucoreceptors
Arch. Histol. Cytol., Vol. 52, Suppi. (1989) p. 33-38 Receptors of Paraneurons, with Special Reference to Glucoreceptors Atsushi NIKI, Hatsumi NIKI and Toshiki HASHIOKA Department of Internal Medicine,
More informationDigestive system L 4. Lecturer Dr. Firdous M. Jaafar Department of Anatomy/Histology section
Digestive system L 4 Lecturer Dr. Firdous M. Jaafar Department of Anatomy/Histology section objectives 1-Describe the structure of liver. 2-Define liver lobule, and identify its zones. 3-Define portal
More informationSupplementary Table 1. Antibodies and dilutions used in the immunohistochemical study
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria,
More informationBeta-cell growth in the neonatal Goto-Kakisaki rat and regeneration after treatment with streptozotocin at birth
Diabetologia (1999) 42: 1098±1106 Ó Springer-Verlag 1999 Beta-cell growth in the neonatal Goto-Kakisaki rat and regeneration after treatment with streptozotocin at birth J. Movassat, B. Portha Laboratory
More informationFaculty of Agricultural and Nutritional Science. Animal Health, Institute of Animal Breeding and Husbandry, CAU Kiel, Germany 2
Faculty of Agricultural and Nutritional Science Christian-Albrechts-University Kiel Institute of Animal Breeding and Husbandry Rearing protocol during the first three weeks of life effects histology of
More informationDiabetologia 9 Springer-Verlag 1995
Diabetologia (1995) 38:53-58 Diabetologia 9 Springer-Verlag 1995 Originals The NSY mouse: a new animal model of spontaneous NIDDM with moderate obesity H. Ueda 1, H. lkegami l, E. Yamato 1, J. Fu 1, M.
More informationInsulin resistance and hyposecretion of insulin are. Promotion of -Cell Differentiation by Conophylline in Fetal and Neonatal Rat Pancreas
Promotion of -Cell Differentiation by Conophylline in Fetal and Neonatal Rat Pancreas Takeki Ogata, 1,2 Lei Li, 1 Satoko Yamada, 1 Yoritsuna Yamamoto, 2 Yuji Tanaka, 2 Izumi Takei, 3 Kazuo Umezawa, 4 and
More informationShort communication. Abstract
Diabetologia (1999) 42: 574±578 Short communication Ó Springer-Verlag 1999 Immunological abnormalities in islets at diagnosis paralleled further deterioration of glycaemic control in patients with recent-onset
More informationGRANULOLYSIS IN A CELLS OF ENDOCRINE PANCREAS AND EXPERIMENTAL DIABETES IN ANIMALS
Published Online: 1 August, 1968 Supp Info: http://doi.org/10.1083/jcb.38.2.462 Downloaded from jcb.rupress.org on December 25, 2018 GRANULOLYSIS IN A CELLS OF ENDOCRINE PANCREAS IN SPONTANEOUS AND EXPERIMENTAL
More informationNIH Public Access Author Manuscript Diabetologia. Author manuscript; available in PMC 2014 February 01.
NIH Public Access Author Manuscript Published in final edited form as: Diabetologia. 2013 February ; 56(2): 231 233. doi:10.1007/s00125-012-2788-6. Lipotoxicity impairs incretin signalling V. Poitout 1,2
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSHORT COMMUNICATION. J. C. Reubi & A. Perren & R. Rehmann & B. Waser & E. Christ & M. Callery & A. B. Goldfine & M. E. Patti
Diabetologia (2010) 53:2641 2645 DOI 10.1007/s00125-010-1901-y SHORT COMMUNICATION Glucagon-like peptide-1 (GLP-1) receptors are not overexpressed in pancreatic islets from patients with severe hyperinsulinaemic
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationKnowledge of the growth mode and regulation of
Genetic Background Determines the Size and Structure of the Endocrine Pancreas Troels Bock, 1,2 Bente Pakkenberg, 1 and Karsten Buschard 2 Key parameters of the endocrine pancreas, such as islet number,
More informationPancreatic Insulinoma Presenting. with Episodes of Hypoinsulinemic. Hypoglycemia in Elderly ---- A Case Report
2008 19 432-436 Pancreatic Insulinoma Presenting with Episodes of Hypoinsulinemic Hypoglycemia in Elderly ---- A Case Report Chieh-Hsiang Lu 1, Shih-Che Hua 1, and Chung-Jung Wu 2,3 1 Division of Endocrinology
More informationFigure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
More informationBMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice
SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana
More informationReduced Insulin Signaling and Endoplasmic Reticulum Stress Act Synergistically to Deteriorate Pancreatic β Cell Function
Kobe J. Med. Sci., Vol. 54, No. 2, pp. E114-E121, 2008 Reduced Insulin Signaling and Endoplasmic Reticulum Stress Act Synergistically to Deteriorate Pancreatic β Cell Function TOMOKAZU MATSUDA, YOSHIAKI
More informationDiscussion & Conclusion
Discussion & Conclusion 7. Discussion DPP-4 inhibitors augment the effects of incretin hormones by prolonging their half-life and represent a new therapeutic approach for the treatment of type 2 diabetes
More informationRoles of Insulin Resistance and fl-cell Dysfunction
Roles of Insulin Resistance and fl-cell Dysfunction in Dexamethasone-induced Diabetes Atsushi Ogawa, John H. Johnson, Makoto Ohneda, Chris T. McAllister, Lindsey Inman, Tausif Alam, and Roger H. Unger
More information1. PATHOPHYSIOLOGY OF DIABETES MELLITUS
1. PATHOPHYSIOLOGY OF DIABETES MELLITUS Prof. Vladimir Palicka, M.D., Ph.D. Institute for Clinical Biochemistry and Diagnostics, University Hospital Hradec Kralove, Czech Republic Diabetes mellitus is
More informationMaterials and Methods
280 Fujisawa et al. 5. In order to ascertain the biological signifi cance of CD56 epithelial cells found in the duct system, we made an immunohistochemical study of fetal and normal adult pancreatic tissues
More informationAnti-pituitary Antibody-induced Multiple Endocrine Disorders in Mice
The Journal of International Medical Research 2001; 29: 22 27 Anti-pituitary Antibody-induced Multiple Endocrine Disorders in Mice H KOIKE 1, T KANDA 2, M MOTOOKA 2, J TAMURA 3 AND I KOBAYASHI 1 1 Department
More informationLaboratory of Experimental Medicine, Brussels Free University, Brussels, Belgium
Vol. 45, No. 3, July 1998 Pages 429-434 DUAL EFFECT OF 2-DEOXY-D-GLUCOSE TETRAACETATE UPON GLUCOSE- INDUCED INSULIN RELEASE Willy J. Malaisse, Luis E. Flares and Marcel M. Kadiata Laboratory of Experimental
More informationSupplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance
Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,
More informationPANCREATIC PATHOLOGY IN DASYURID MARSUPIALS
PANCREATIC PATHOLOGY IN DASYURID MARSUPIALS Authors: H. D. ATTWOOD, and P. A. WOOLLEY Source: Journal of Wildlife Diseases, 16(2) : 245-25 Published By: Wildlife Disease Association URL: https://doi.org/1.7589/9-558-16.2.245
More informationSecondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
More informationDiabetologia 9 Springer-Verlag 1993
Diabetologia (1993) 36:3-8 Diabetologia 9 Springer-Verlag 1993 Originals Abnormal insulin secretion and glucose metabolism in pancreatic islets from the spontaneously diabetic GK rat C.-G. Ostenson I,
More informationMucous and ciliated cell metaplasia in epithelial linings of odontogenic inflammatory and developmental cysts
77 Journal of Oral Science, Vol. 47, No. 2, 77-81, 2005 Original Mucous and ciliated cell metaplasia in epithelial linings of odontogenic inflammatory and developmental cysts Yasunori Takeda, Yuko Oikawa,
More informationANTIHYPERGLYCEMIC ACTIVITY OF METHANOLIC EXTRACT OF MADHUCA LONGIFOLIA BARK
1 Departments of Pharmaceutical Chemistry, 2 Pharmacology, 3 Pharmacognosy B. Pharmacy College, Rampura, Kakanpur, Godhara, Dist. Panchmahal, Gujarat, India Original Research Article Received: July 9,
More informationCharacterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma
Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department
More informationPolycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus
Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino
More informationCell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-
Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary
More informationGrowth Factor-dependent Proliferation of the Pancreatic ß-cell line ßTC-tet: An Assay for ß-cell Mitogenic Factors
Int. Jnl. Experimental Diab. Res., 3:69-74, 2002 2002 Taylor and Francis 1560-4284/02 $12.00 +.00 Growth Factor-dependent Proliferation of the Pancreatic ß-cell line ßTC-tet: An Assay for ß-cell Mitogenic
More informationStudy of serum Amylase levels in type 2 Diabetes Mellitus
IOSR Journal of Dental and Medical Sciences (IOSR-JDMS) e-issn: 2279-853, p-issn: 2279-861.Volume 17, Issue 3 Ver.6 March. (218), PP 24-28 www.iosrjournals.org Dr.P.Kiranmai 1 MD, Dr.V.Ratnakumari* 2 MD
More informationCYSTIC FIBROSIS (CF) COMPLICATIONS BEYOND THE LUNGS. A Resource for the CF Center Care Team
CYSTIC FIBROSIS (CF) COMPLICATIONS BEYOND THE LUNGS A Resource for the CF Center Care Team Vertex Pharmaceuticals Incorporated, 50 Northern Avenue, Boston, MA 02210. Vertex and the Vertex triangle logo
More informationEffects of Starvation on Glycogen Contents of Heart, Skeletal Muscle and Liver in Several Mammals
Effects of Starvation on Glycogen Contents of Heart, Skeletal Muscle and Liver in Several Mammals Mitsuto MATSUMOTO and Tatsuo HAMADA National Institute of Animal Industry, Tsukuba Norindanchi P. O. Box
More informationChanges in the Expression Pattern of Luteinizing Hormone Receptor mrna in Rat Testis during Degeneration of Seminiferous Epithelium
ZOOLOGICAL SCIENCE 15: 255 261 (1998) 1998 Zoological Society of Japan Changes in the Expression Pattern of Luteinizing Hormone Receptor mrna in Rat Testis during Degeneration of Seminiferous Epithelium
More informationSupplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and
Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and
More informationIMIDIA IMPROVING BETA-CELL FUNCTION AND IDENTIFICATION OF DIAGNOSTIC BIOMARKERS FOR TREATMENT MONITORING IN DIABETES. A. Ktorza, B.
IMIDIA IMPROVING BETA-CELL FUNCTION AND IDENTIFICATION OF DIAGNOSTIC BIOMARKERS FOR TREATMENT MONITORING IN DIABETES A. Ktorza, B. Thorens DIABETES Definition Diabetes is a metabolic disease characterized
More informationInternational Journal of Health Sciences and Research ISSN:
International Journal of Health Sciences and Research www.ijhsr.org ISSN: 2249-9571 Original Research Article Morphometry and Histogenesis of Human Foetal Pancreas Sujatha Manupati 1, Raju Sugavasi 2*,
More informationGenetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's
More informationDiagnosis of chronic Pancreatitis. Christoph Beglinger, University Hospital Basel, Switzerland
Diagnosis of chronic Pancreatitis Christoph Beglinger, University Hospital Basel, Switzerland Pancreatitis Pancreas Pancreas - an organ that makes bicarbonate to neutralize gastric acid, enzymes to digest
More informationMolecular Probes Introducing 14 new probes
Molecular Probes Introducing 14 new probes Gene and Chromosome Probes Dual Colour ISH INFORM HER2 Dual ISH DNA Probe Cocktail Assay Product Part Number INFORM HER2 Dual ISH DNA Probe Cocktail 800-4422
More informationA novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets
Diabetologia () 5:77 DOI.7/s5--- SHORT COMMUNICATION A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Q. Cheng & Y. C.
More informationAntidiabetic Action of Low Molecular Weight Chitosan in Genetically Obese Diabetic KK-A y Mice
188 Biol. Pharm. Bull. 25(2) 188 192 (2002) Vol. 25, No. 2 Antidiabetic Action of Low Molecular Weight Chitosan in Genetically Obese Diabetic KK-A y Mice Koji HAYASHI and Mikio ITO* Laboratory of Analytical
More informationReport on Pathology. Study: The effect of Compound X on pancreatic islets in rhesus macaques
Report on Pathology Study: The effect of Compound X on pancreatic islets in rhesus macaques Prepared for: Client Name Client Address January 1, 2013 Prepared by: Charter Preclinical Services 21 Main St.,
More informationType 2 diabetes develops as a consequence of
-Cell Function and Viability in the Spontaneously Diabetic GK Rat Information From the GK/Par Colony B. Portha, M.-H. Giroix, P. Serradas, M.-N. Gangnerau, J. Movassat, F. Rajas, D. Bailbe, C. Plachot,
More informationEffects of Diabetes and Insulin on ot-amylase Messenger RNA Levels in Rat Parotid Glands
Effects of Diabetes and Insulin on ot-amylase Messenger RNA Levels in Rat Parotid Glands S.K. KIM""', L.M. CUZZORT2, R.K. McKEAN2, and E.D. ALLEN' 1Research Service, VA Medical Center, Ann Arbor, Michigan
More informationA Single Treatment with IL-4 via Retrovirally Transduced Lymphocytes Partially Protects Against Diabetes in BioBreeding (BB) Rats
A Single Treatment with IL-4 via Retrovirally Transduced Lymphocytes Partially Protects Against Diabetes in BioBreeding (BB) Rats Danny Zipris, Eddy Karnieli The Institute of Endocrinology, Diabetes, and
More informationDiabetologia 9 Springer-Verlag 1989
Diabetologia (1989) 32:577-584 Diabetologia 9 Springer-Verlag 1989 Long-term gliclazide treatment improves the in vitro glucose-induced insulin release in rats with Type 2 (non-insulin-dependent) diabetes
More informationThe enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose
More informationEbrahim Abbasi Oshaghi 1,2
1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi
More informationDr. Heba Kalbouneh. Dr. Heba Kalbouneh. Dr. Heba Kalbouneh
Dr. Heba Kalbouneh Dr. Heba Kalbouneh Dr. Heba Kalbouneh Basement membrane: What is the basement membrane? - It is a layer of ECM separating the epithelial cells from the underlying connective tissue Basement
More informationEFFECT OF VARIOUS FACTORS ON INDUCTION OF URINARY BLADDER TUMORS IN ANIMALS BY N-BUTYL-N-(4-HYDROXYBUTYL) NITROSOAMINE
[GANN, 64, 151-159; April, 1973] UDC 615.277.4: 616-006-021.6[616.62] EFFECT OF VARIOUS FACTORS ON INDUCTION OF URINARY BLADDER TUMORS IN ANIMALS BY N-BUTYL-N-(4-HYDROXYBUTYL) NITROSOAMINE (Plate XXI)
More informationPancreatic islet-specific T-cell clones from nonobese diabetic mice (diabetes/islet antigens)
Proc. Natl. Acad. Sci. USA Vol. 86, pp. 8-84, October 1989 Immunology Pancreatic islet-specific T-cell clones from nonobese diabetic mice (diabetes/islet antigens) KATHRYN HASKINS*, MARY PORTAS, BARBARA
More informationUnit 4 Homeostasis. The term homeostasis refers to the body s attempt. Your body systems must to maintain a stable internal environment -
Unit 4 Homeostasis The term homeostasis refers to the body s attempt Your body systems must to maintain a stable internal environment - The body is trying to maintain, through a series of monitored adjustments.
More informationDiabetologia Springer-Verlag 1986
Diabetologia (1986) 29:267-274 Diabetologia Springer-Verlag 1986 Originals The histopathology of the pancreas in Type 1 (insulin-dependent) diabetes mellitus: a 25-year review of deaths in patients under
More informationEffect of D-400, an Ayurvedic Herbal Formulation on Experimentally-induced Diabetes Mellitus
[Phytotherapy Research (1996): (10), 433-435] Effect of D-400, an Ayurvedic Herbal Formulation on Experimentally-induced Diabetes Mellitus Mitra, S.K., Gopumadhavan, S. and Muralidhar, T.S. R&D Centre,
More informationQuality in Control. ROS1 Analyte Control. Product Codes: HCL022, HCL023 and HCL024
Quality in Control ROS1 Analyte Control Product Codes: HCL022, HCL023 and HCL024 Contents What is ROS1? 2 The Role of ROS1 in Cancer 3 ROS1 Assessment 3 ROS1 Analyte Control Product Details 4 ROS1 Analyte
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationImproving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D.
Improving Diabetes Research: Moving Beyond Animal Models Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. July 19, 2014 From Bench-to-Bedside Sulfonylurea Biguanide Dipeptidyl peptidase-4 inhibitor Glucagon-like
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationFigure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow
Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose
More informationComparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress
omparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress S DAL, S Sigrist, W Bietiger, Peronet, M Pinget and N Jeandidier
More informationEffect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis
212 66 4 329334 Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis a,c a* b b a a b a a b c 33 66 4 ʼ 6 6 6 28 6 5 5 5 28 45 ʼ ʼ ʼ
More informationDIABETES MELLITUS: COMPLICATION. Benyamin Makes Dept. of Anatomic Pathology FMUI - Jakarta
DIABETES MELLITUS: COMPLICATION Benyamin Makes Dept. of Anatomic Pathology FMUI - Jakarta COMPLICATION OF DIABETES Susceptibility to infections including tuberculosis, pneumonia, pyelonephritis, and mucocutaneous
More informationThe -cell mass present in the pancreas plays an
Linear Correlation Between -Cell Mass and Body Weight Throughout the Lifespan in Lewis Rats Role of -Cell Hyperplasia and Hypertrophy Eduard Montanya, Víctor Nacher, Montserrat Biarnés, and Joan Soler
More informationHER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer
P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color
More informationThe regenerative therapy of type 1 diabetes mellitus 21April 2017 Girne, Northern Cyprus 53rd Turkish National Diabetes Congress
The regenerative therapy of type 1 diabetes mellitus 21April 2017 Girne, Northern Cyprus 53rd Turkish National Diabetes Congress Thomas Linn Clinical Research Unit Centre of Internal Medicine Justus Liebig
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationKey words: insulin dependent deabetes mellitus, pancreatic islets, transplantation, cryopreservation, immunomodulat ion
Key words: insulin dependent deabetes mellitus, pancreatic islets, transplantation, cryopreservation, immunomodulat ion Fig. 1 Number of adult islet all grafts by year performed from 1974 through 1993
More informationPartial Pancreatectomy in the Rat and Subsequent Defect in Glucose-induced Insulin Release
Partial Pancreatectomy in the Rat and Subsequent Defect in Glucose-induced Insulin Release S. BONNER-WEIR, D. F. TRENT, and G. C. WEIR, Endocrine Division, Department of Medicine, Medical College of Virginia-Virginia
More informationHuman Saliva as a Convenient Source of Ribonuclease. By S. BRADBURY
Human Saliva as a Convenient Source of Ribonuclease 323 By S. BRADBURY (From the Cytological Laboratory, Department of Zoology, University Museum, Oxford) SUMMARY Saliva, heated to 80 C for 10 minutes
More informationDetermination of serum insulin level by ELISA
Practical course: Basic biochemical methods and ischemic heart models Determination of serum insulin level by ELISA A practical manual Tamas Csont, MD, PhD Supported by: HURO/0901/069/2.3.1 1 BACKGROUND
More informationGlucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon
Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of
More informationInternational Journal of Research in Pharmacology & Pharmacotherapeutics
International Journal of Research in Pharmacology & Pharmacotherapeutics ISSN Print: 2278-2648 IJRPP Vol.3 Issue 4 Oct-Dec-2014 ISSN Online: 2278-2656 Journal Home page: Research article Open Access Anti-diabetic
More information