Report on Pathology. Study: The effect of Compound X on pancreatic islets in rhesus macaques
|
|
|
- Henry Smith
- 5 years ago
- Views:
Transcription
1 Report on Pathology Study: The effect of Compound X on pancreatic islets in rhesus macaques Prepared for: Client Name Client Address January 1, 2013 Prepared by: Charter Preclinical Services 21 Main St., Suite 3A Hudson, MA Tel:
2 REPORT ON PATHOLOGY Date: January 1, 2013 Study: The effect of Compound X on pancreatic islets in rhesus macaques Study Contact Person: Study Pathologist: Conclusions: Under the conditions of the study, Compound X when administered orally at 150 mg/kg into non-diabetic rhesus macaques significantly increased islet size and density in normal rhesus macaques compared to placebo-treated controls. In addition this treatment at the 150 mg/kg dose also resulted in a significantly higher relative islet mass and islet cell proliferation compared to placebo-treated controls. These effects were not seen when Compound X was used at a lower dose suggesting that this dose did not reach therapeutic levels. These findings suggest that Compound X would potentially be beneficial in upregulating insulin production in some diabetic patients thus improving the clinical outcome. However, this study was performed in normal rhesus macaques without clinical or pathologic evidence of diabetes. Repeating this experiment in animals identified as diabetic or prediabetic would potentially be worthwhile to determine if Compound X effectively upregulates insulin production in diabetic animals. Study Design: 18 rhesus macaques (9 males and 9 females) aged 3-4 years old were enrolled in this study and randomly assigned to one of four study groups representing placebo, low-dose, and high-dose of compound X according to the table below. Animals were dosed orally twice daily approximately 8 hours apart for 120 days. On day 120, all animals were euthanized and the pancreas was harvested and fixed in formalin. Formalin-fixed pancreases were shipped for processing. Group # Group Name # Females # Males Daily Dose (mg/kg/day) Dose Level (mg/kg/dose) 1 Placebo Low-Dose High Dose
3 Tissues examined: Each pancreas was embedded in paraffin and stained with hematoxylin and eosin (HE). In addition, Ki67 and insulin immunohistochemistry were performed on all pancreata for all animals. All slides were evaluated for the following criteria by a pathologist at Charter Preclinical Services. 1) Cell Proliferation: A cell proliferation index was calculated for each slide. Ten random islets were assessed at 200x magnification for the presence of Ki67+ cells. The number of Ki67+ cells was reported for each field. These data were then used to generate a mean for each slide. 2) Relative Acinar/Islet Cell Mass: The relative proportion of acinar cells, and islets was estimated by the pathologist. This was generally accomplished with the HE stained slides. For each cell type, the percentage of the overall pancreatic mass was estimated to the nearest 5-10%. Blood vessels, fat, and other supportive structures were not included. 3) Islet Density: The number of islets in each of five 100x (10x objective) fields was counted and reported. This was used to generate the mean number of islets/100x field for each slide. Individually stained beta cells were not counted, only areas which had multiple insulin+ cells together forming an islet. 4) Beta Cell Area/Representative 20x Field: For each slide, a photograph of a single 20x field (2x objective) was obtained with a Nikon DS-Ri1 camera attached to a Nikon Eclipse-Ci microscope. Images were analyzed with Nikon Elements-D image analysis software. Images were thresholded using hue, saturation, and intensity to highlight immunostained beta cells in pancreatic islets. In general, the same basic parameters were used for most slides, but it was sometimes necessary to adjust the threshold parameters between slides due to changes in the staining profile of the slides. Background staining was minimal and excluded as necessary. The thresholded area (positively stained beta cells) was calculated by the software and reported as m 2 for each slide. Graphs and statistical analysis were generated using GraphPad Prism software and statistical significance is noted in the chart, figure legend, and/or tables when appropriate. A one-way ANOVA was used to compare groups. Results: The graphs below depict the data generated for the study. In all graphs bars represent group means with standard errors shown. 3
4 Islet Cell Proliferation 1.5 p < 0.05 Ki67+ cells/islet p < 0.01 p < Plaebo Males Low-Dose Males High Dose Males Placebo Females Low Dose Females High Dose Females Figure 1: Islet cell proliferation index for sample study All Placebos All Low Dose All High Dose Islet cell proliferation was calculated as the number of Ki67+ cells/islet. Treatment significantly effected islet density for males (one-way ANOVA, p = ), females (one-way ANOVA, p = ), and when all animals were considered together (oneway ANOVA, p = ). Compound X at a low dose did not have any effect on the islet proliferation index. However, at a high dose, Compound X significantly increased cellular proliferation compared to both placebo and low dose treatment (Bonferroni Multiple Comparison Test). 4
5 25 Islet Density p < p < p < # Islets/100x Field Plaebo Males Low-Dose Males High Dose Males Placebo Females Low Dose Females High Dose Females All Placebos All Low Dose All High Dose Figure 2: Relative islet density in pancreases for Sample Study Islet density was calculated as the number of islets/representative 100x (10x objective) field). Treatment significantly effected islet density for males (one-way ANOVA, p < ), females (one-way ANOVA, p = ), and when all animals were considered together (one-way ANOVA, p < ). Compound X at a low dose did not have any effect on the islet density. However, at a high dose, Compound X significantly increased the number of islets in each field compared to both placebo and low dose treatment (Bonferroni Multiple Comparison Test). 5
6 Beta Cell Area Area ( m 2 ) p < 0.01 p < 0.01 p < Plaebo Males Low-Dose Males High Dose Males Placebo Females Low Dose Females High Dose Females All Placebos All Low Dose All High Dose Figure 3: Beta cell area in representative 20x fields from pancreases for sample study Beta cell area was calculated using quantitative image analysis. Treatment significantly effected overall beta cell area for males (one-way ANOVA, p = ), females (oneway ANOVA, p = ), and when all animals were considered together (one-way ANOVA, p < ). Compound X at a low dose did not have a significant effect on the beta cell area compared to placebo. However, at a high dose, Compound X significantly increased the beta cell area in each field compared to both placebo and low dose treatment (Bonferroni Multiple Comparison Test). 6
7 50 40 Relative Islet Mass p < 0.01 p < 0.05 p < % Islets Plaebo Males Low-Dose Males High Dose Males Placebo Females Low Dose Females High Dose Females Figure 4: Islet area from pancreases for sample study All Placebos All Low Dose All High Dose The relative percentage of the overall pancreatic mass occupied by islets was estimated to the nearest 5%. Treatment significantly effected overall islet mass for males (oneway ANOVA, p = ), females (one-way ANOVA, p = ), and when all animals were considered together (one-way ANOVA, p < ). Compound X at a low dose did not have a significant effect on the relative islet mass compared to placebo. However, at a high dose, Compound X significantly increased the area occupied by islets compared to both placebo and low dose treatment (Bonferroni Multiple Comparison Test). 7
8 Description and Representative Photomicrographs: Placebo: Animals treated with placebo had essentially normal pancreata. There were a normal number of islets which were generally a normal size. Islets were scattered throughout the pancreas randomly. There was no significant inflammation or pancreatic necrosis and cell proliferation within islets as measured by Ki67 immunoreactivity was rare. Insulin immunostaining was moderate to strong in most islets. In most animals, immunostaining was seen diffusely through the islets indicating an even distribution of beta cells within the islet. This is considered the normal beta cell distribution in nonhuman primates. Low-Dose: There were no notable differences between animals treated with a low-dose of Compound X and placebo. High-dose: Animals treated a high dose of Compound X had, compared to placebo-treated animals, larger pancreata and more cellular proliferation. Compound X appeared to increase both the number (islet density) and size (beta cell area) of islets compared to placebo. Additionally, the relative percentage of islet area was increased compared to placebo and low-dose treatment. Pancreata were still morphologically normal and insulin immunostaining was moderate to strong in most islets. 8
9 Placebo HE 40x Placebo Ki67 200x Placebo Insulin 40x Placebo Insulin 40x with overlay Figure 5: Representative photomicrographs of placebo and low-dose animals for sample study Placebo-treated animals had a normal number of islets of normal size. Islets were evenly scattered within the pancreas and were generally small in size. There were few Ki67+ cells limited to scattered cells in some islets. The islet is outlined in a dashed red line and the arrow points to a Ki67+ cell. Insulin immunostaining was present in all islets. Most animals had normal diffuse immunostaining, which has been reported to be normal in cynomolgus macaques 1 and marmosets. 2 Areas in red on the overlay image represent areas that were included in the quantification of beta cell area. 9
10 Compound X High Dose HE 40x Compound X High Dose Ki67 200x Compound X High Dose Insulin 40x Compound X High Dose Insulin 40x with overlay Figure 6: Representative photomicrographs of animals treated with high dose Compound X Compound X administered at a high dose resulted in a significant increase in islet area and density. Islets were more numerous and larger and occupied a larger percentage of the total area of the pancreas. Ki67 immunoreactivity (islet proliferation) was also increased compared to placebo. 10
11 Conclusions: Under the conditions of the study, Compound X when administered orally at 150 mg/kg into non-diabetic rhesus macaques significantly increased islet size and density in normal rhesus macaques compared to placebo-treated controls. In addition this treatment at the 150 mg/kg dose also resulted in a significantly higher relative islet mass and islet cell proliferation compared to placebo-treated controls. These effects were not seen when Compound X was used at a lower dose suggesting that this dose did not reach therapeutic levels. These findings suggest that Compound X would potentially be beneficial in upregulating insulin production in some diabetic patients thus improving the clinical outcome. However, this study was performed in normal rhesus macaques without clinical or pathologic evidence of diabetes. Repeating this experiment in animals identified as diabetic or prediabetic would potentially be worthwhile to determine if Compound X effectively upregulates insulin production in diabetic animals. References: 1. Cabrera et al. The unique cyto-architecture of human pancreatic islets has implications for islet cell function. Proceedings of the National Academy of Sciences of the United States of America (7): Wachtman et al. Differential Contribution of Dietary Fat and Monosaccharide to Metabolic Syndrome in the Common Marmoset (Callithrix jacchus). Obesity Raw Data Follows on Next Page: 11
12 Group 1 - Placebo Animal ID Cell proliferation (#Ki67+ cells/islet) Acinar Cell Mass (%) Beta Cell Mass (%) Islet Density (# islets/10x field) Islet Area / Rep. 2x field ( m) Comments Islet 1 Islet 2 Islet 3 Islet 4 Islet 5 Islet 6 Islet 7 Islet 8 Islet 9 Islet 10 Mean Field 1 Field 2 Field 3 Field 4 Field 5 Mean Male Male Male Mean NA Standard Deviation NA Female Female Female Mean NA Standard Deviation NA Total Group Mean NA Total Group SD NA Group 2 - Low Dose Compound X Animal ID Cell proliferation (#Ki67+ cells/islet) Acinar Cell Mass (%) Beta Cell Mass (%) Islet Density (# islets/10x field) Islet Area / Rep. 2x field ( m) Comments Islet 1 Islet 2 Islet 3 Islet 4 Islet 5 Islet 6 Islet 7 Islet 8 Islet 9 Islet 10 Mean Field 1 Field 2 Field 3 Field 4 Field 5 Mean Male Male Male Mean NA Standard Deviation NA Female Female Female Mean NA Standard Deviation NA Total Group Mean NA Total Group SD NA 12
13 Group 3 - High Dose Compound X Animal ID Cell proliferation (#Ki67+ cells/islet) Acinar Cell Mass (%) Beta Cell Mass (%) Islet Density (# islets/10x field) Islet Area / Rep. 2x field ( m) Comments Islet 1 Islet 2 Islet 3 Islet 4 Islet 5 Islet 6 Islet 7 Islet 8 Islet 9 Islet 10 Mean Field 1 Field 2 Field 3 Field 4 Field 5 Mean Male Male Male Mean NA Standard Deviation NA Female Female Female Mean NA Standard Deviation NA Total Group Mean NA Total Group SD NA 13
Mass Histology Service
Mass Histology Service A complete anatomical pathology laboratory www.masshistology.com Telephone: (877) 286-6004 Report on Pathology A Time Course Study of the Local Effects of Intramuscular XXXXXXX Injection
Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on
Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
Stromal Fat Content of the Parathyroid Gland
Stromal Fat Content of the Parathyroid Gland TAKAO OBARA,* YOSHIHIDE FUJIMOTO* AND MOTOHIKO AIBA** *Department of Endocrine Surgery and **Department of Surgical Pathology, Tokyo Women's Medical College,
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
CHAPTER IV RESULT 5.1 RESULT OF LIVER TISSUE DAMAGE FROM H&E STAINING. Tissue damage were observed from H&E staining examination by Olympus PX51
CHAPTER IV RESULT 5.1 RESULT OF LIVER TISSUE DAMAGE FROM H&E STAINING. Tissue damage were observed from H&E staining examination by Olympus PX51 light microscope with ocular lens 10 and objective lens
Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
LOCAL INFLAMMATION IN BREAST TISSUE AND MAMMOGRAPHIC DENSITY AMONG PREMENOPAUSAL AND POSTMENOPAUSAL WOMEN
LOCAL INFLAMMATION IN BREAST TISSUE AND MAMMOGRAPHIC DENSITY AMONG PREMENOPAUSAL AND POSTMENOPAUSAL WOMEN Mirette Hanna MD Clinical pathology PhD (candidate) Experimental medicine MSc Clinical and chemical
Supplementary Figure 1
Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Faculty of Agricultural and Nutritional Science. Animal Health, Institute of Animal Breeding and Husbandry, CAU Kiel, Germany 2
Faculty of Agricultural and Nutritional Science Christian-Albrechts-University Kiel Institute of Animal Breeding and Husbandry Rearing protocol during the first three weeks of life effects histology of
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
SUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies
SUPPLEMENTARY INFORMATION GENOTOXICITY In vitro Genotoxicity Studies The in vitro immortalisation (IVIM) assay relies on the induction of a survival advantage by insertional activation of cellular proto-oncogenes,
To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
<20 <20 <20 < <20 <20 <20 <20. Mock
Cross-Lineage Neutralization PRNT 80 Titers Asian Asian West African Indian Ocean Group NHP Strain 181/25 Strain 99659 Strain 37997 Strain LR 142590 80 80 20 40 EILV/CHIKV 150844 640 640 160 320 Mock 150849
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
APPENDIX 1 ETHICAL CLEARANCE
APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition
Int J Clin Exp Pathol 2017;10(3): /ISSN: /IJCEP
Int J Clin Exp Pathol 2017;10(3):3671-3676 www.ijcep.com /ISSN:1936-2625/IJCEP0046381 Original Article Comparison of immunofluorescence and immunohistochemical staining with anti-insulin antibodies on
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
The Endocrine Pancreas (Chapter 10) *
OpenStax-CNX module: m62118 1 The Endocrine Pancreas (Chapter 10) * Ildar Yakhin Based on The Endocrine Pancreas by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
* * * * Supplementary Figure 1. DS Lv CK HSA CK HSA. CK Col-3. CK Col-3. See overleaf for figure legend. Cancer cells
Supplementary Figure 1 Cancer cells Desmoplastic stroma Hepatocytes Pre-existing sinusoidal blood vessel New blood vessel a Normal liver b Desmoplastic HGP c Pushing HGP d Replacement HGP e f g h i DS
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-4-1-82 TITLE: Effect of Saw Palmetto on the Development and Progression of Prostate Carcinoma in TRAMP Mice PRINCIPAL INVESTIGATOR: Charles E. Roselli CONTRACTING ORGANIZATION:
Journal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Medical School Histology Basics Introduction to Microscopy. VIBS 289 lab
Medical School Histology Basics Introduction to Microscopy VIBS 289 lab Larry Johnson Texas A&M University Objectives Learn the difference in magnification and resolution Learn about different types of
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
Soy phytoestrogen effects on progesterone receptor and ovalbumin synthesis in the chick oviduct.
Soy phytoestrogen effects on progesterone receptor and ovalbumin synthesis in the chick oviduct. L.M. STEVENSON*, S.H. OATES, A.L. DOERNTE, J.B. HESS and W.D. BERRY Poultry Science Department, Auburn University,
Liqui-PREP TM The Next Generation of Liquid Cytology
TECHNICAL TIP OVERVIEW: This Technical Tip is the result of many requests for Cytology Staining procedures. There are perhaps as many Cytology Staining procedures as there are Cytology processing laboratories.
Effect of glucose on beta cell proliferation and population size in organ culture of foetal and neonatal rat pancreases
J. Embryol. exp. Morph. 74, 303-312 (1983) 3Q3 Printed in Great Britain The Company of Biologists Limited 1983 Effect of glucose on beta cell proliferation and population size in organ culture of foetal
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
Supporting Information
Supporting Information Soltani et al. 10.1073/pnas.1102715108 SI Experimental Procedures Evaluation of Mice and Drug Administration. IPGTT, insulin tolerance test, and glucagon tolerance test were performed
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,
Interpretation guide. Abnormal cytology can t hide anymore
Interpretation guide Abnormal cytology can t hide anymore Unique dual-biomarker technology makes you certain about the presence of transforming HPV infection. The science that creates certainty. Table
Sequence Coverage (%) Profilin-1 P UD 2
Protein Name Accession Number (Swissprot) Sequence Coverage (%) No. of MS/MS Queries Mascot Score 1 Reference Cytoskeletal proteins Beta-actin P60709 37 14 298 Alpha-actin P68032 33 10 141 20 Beta-actin-like
Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
islets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with
The Endocrine System Pituitary
The Endocrine System Pituitary Look at your slide of the human pituitary with your naked eye. You should see a cellular region and a more fibrous region. Then view each region with your microscope under
Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma
Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay
Histochemical and histological studies on the pancreas in mature pigeon (Columba Livia)
Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2013, 3(2):148-152 ISSN: 2248 9215 CODEN (USA): EJEBAU Histochemical and histological studies on the pancreas
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
This is the second learning component (Learning Component 2) in our first learning module (Learning Module 1). In this component we review a very
This is the second learning component (Learning Component 2) in our first learning module (Learning Module 1). In this component we review a very basic response to injury inflammation. We ll look at examples
Dealing with the Complications of Diabetes. Neuropathy Vision Problems Heart Disease
Dealing with the Complications of Diabetes Neuropathy Vision Problems Heart Disease Diabetes: Quick Review Diabetes = high blood sugar levels Pancreas secretes the hormone insulin Insulin carries sugar
Supplemental Methods: Histopathology scoring of individual components of Valentino
Supplementary Materials Online: Supplemental Methods: Histopathology scoring of individual components of Valentino synovitis grade and Mankin cartilage pathology scale Hemophilic synovitis was graded 0-10
Tissue Microarray - Human Pancreas Carcinoma
Tissue Microarray - Human Pancreas Carcinoma Cat.-No.: PACA0909-2-OL (2 slides), PACA0909-5-OL (5 slides) Lot: 097P a b c d e f g h 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Technical Information: 96 Spots - Spot
SalvinOss Xenograft Bone Graft Material In Vivo Testing Summary
SalvinOss Xenograft Bone Graft Material In Vivo Testing Summary Summary of In Vivo Use Of Bioresorbable Xenograft Bone Graft Materials In The Treatment Of One-Walled Intrabony Defects In A Canine Model
Inhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
VENTANA PD-L1 (SP263) Assay Staining in Urothelial Carcinoma Interpretation Guide
VENTANA PD-L1 (SP263) Assay Staining in Urothelial Carcinoma Interpretation Guide 2 VENTANA PD-L1 (SP263) Assay in Urothelial Carcinoma Interpretation Guide Table of Contents Introduction 4 Intended Use
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2697 Figure S1 Cytokeratin 5 is a specific marker for basal and intermediate cells in all mouse prostate lobes. (a) Immunofluorescence staining showing co-localization of YFP with p63 in
NACC Vascular Consortium. NACC Vascular Consortium. NACC Vascular Consortium
NACC Vascular Consortium NACC Vascular Consortium Participating centers: Oregon Health and Science University ADC Rush University ADC Mount Sinai School of Medicine ADC Boston University ADC In consultation
Mammary Nodular Hyperplasia in Intact R hesus Monkeys
Vet. Path. 10: 130-134 (1973) Mammary Nodular Hyperplasia in Intact R hesus Monkeys L. W NELSON and L. D. SHOTT Department of Pathology and Toxicology, Mead Johnson Research Center, Evansville, Ind., and
Tissue Microarray - Human Pancreas Carcinoma
Provitro GmbH Charitéplatz 1 tel +49.30.450 578 358 sales@provitro.de Charité Campus Mitte 10117 Berlin fax +49.30.450 578 919 www.provitro.de Tissue Microarray - Human Pancreas Carcinoma Cat.-No.: 401
Interpreting Therapeutic Response on Immune Cell Number and Spatial Distribution within the Tumor Microenvironment. Lorcan Sherry, CSO OracleBio
Interpreting Therapeutic Response on Immune Cell Number and Spatial Distribution within the Tumor Microenvironment Lorcan Sherry, CSO OracleBio Company Overview OracleBio is a specialised CRO providing
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AWARD NUMBER: W81XWH-16-1-0737 TITLE: Developing a PTEN-ERG Signature to Improve Molecular Risk Stratification in Prostate Cancer PRINCIPAL INVESTIGATOR: Tamara Lotan CONTRACTING ORGANIZATION: Johns Hopkins
Comparison and Evaluation of Mitotic Figures in Oral Epithelial Dysplasia using Crystal Violet and Feulgen Stain
Comparison and Evaluation of Mitotic Figures in Oral Epithelial Dysplasia using 10.5005/jp-journals-10024-1527 Crystal Violet and Feulgen Stain Original research Comparison and Evaluation of Mitotic Figures
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Material and Methods. Flow Cytometry Analyses:
Material and Methods Flow Cytometry Analyses: Immunostaining of breast cancer cells for HER2 was performed by incubating cells with anti- HER2/neu APC (Biosciences, Cat# 340554), anti-her2/neu PE (Biosciences,
Independent Forensics 4600 West Roosevelt Road Suite 201 Hillside IL 60162, USA. Telephone: (708) Fax: (708)
Developmental validation of SPERM HY-LITER A Specific, Sensitive and Confirmatory Microscopic Screening Method for the Detection of Human Sperm from Sexual Assault Evidence Independent Forensics 4600 West
Improved efficacy and in vivo cellular properties of human embryonic stem cell derivative
Supplementary Information Improved efficacy and in vivo cellular properties of human embryonic stem cell derivative in a preclinical model of bladder pain syndrome Aram Kim 1,11,, Hwan Yeul Yu 1,2,, Jisun
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Pair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
Greater Manchester and Cheshire HPB Unit Guidelines for the Assessment & Management of Hepatobiliary and Pancreatic Disease Chapter 14
Greater Manchester and Cheshire HPB Unit Guidelines for the Assessment & Management of Hepatobiliary and Pancreatic Disease Chapter 14 Contents 14. Neuroendocrine Tumours 161 14.1. Diagnostic algorithm
VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
American Association of Bioanalysts 5615 Kirby Drive, Suite 870 Houston, TX
Q3 2018 Parasitology American Association of Bioanalysts 5615 Kirby Drive, Suite 870 Houston, TX 77005 800-234-5315 281-436-5357 Specimen 1 Referees Extent 1 Extent 2 Total Few to 534 Giardia lamblia Many
Appendix 1. A. Procedure for preparing histopathology slides. The liver removed and stored immediately in buffered formalin 10 % for
Appendix 1 A. Procedure for preparing histopathology slides. The liver removed and stored immediately in buffered formalin 10 % for histopathological examination. The tissue fixed for at least 48 hours
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
Metabolic Disease drug discovery at Evotec
Metabolic Disease drug discovery at Evotec Evotec, Metabolic Disease Drug Discovery, 2016 Evotec, an ideal partner in metabolic disease drug discovery The different ways to work with us On your specific
Evaluation of the Protective Effect of Plant Extracts Against Pheophorbide a-induced Photosensitive Damage
Trace Nutrients Research 26 : 88 92 (2009) Evaluation of the Protective Effect of Plant Extracts Against Pheophorbide a-induced Photosensitive Damage Amy TOMITA, Tomoyo KAJIURA and Shuichi KIMURA Showa
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Schuster SJ, Svoboda J, Chong EA, et al. Chimeric antigen receptor
1 (a) State the maximum magnification that can be achieved by a light microscope and a transmission electron microscope.
1 (a) State the maximum magnification that can be achieved by a light microscope and a transmission electron microscope. Select your answers from the list below. 10x 40x 100x light microscope... x transmission
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
SUPPLEMENTAL INFORMATION FOR. PAX7 expression defines germline stem cells in the adult testis
SUPPLEMENTAL INFORMATION FOR PAX7 expression defines germline stem cells in the adult testis Gina M. Aloisio, Yuji Nakada, Hatice D. Saatcioglu, Christopher G. Peña, Michael D. Baker, Edward D. Tarnawa,
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
S100 protein expression in pituitary adenomas
S100 protein expression in pituitary adenomas Eugen MELnIc Department of Morphopathology, Nicolae Testemitsanu State University of Medicine and Pharmacy Chisinau, the Republic of Moldova Corresponding
Transport in Animals Question Paper
Transport in Animals Question Paper Level Subject Exam Board Topic Sub-Topic Paper Type Booklet IGCSE Biology CIE Transport in Animals Alternative to Practical Question Paper Time Allowed: 64 minutes Score:
Pancreatobiliary Frozen Section Nightmares
Pancreatobiliary Frozen Section Nightmares Aatur D. Singhi, MD PhD Assistant Professor University of Pittsburgh Medical Center Department of Pathology singhiad@upmc.edu Objectives Briefly give an overview
Quantification of early stage lesions for loss of p53 should be shown in the main figures.
Reviewer #1 (Remarks to the Author): Expert in prostate cancer The manuscript "Clonal dynamics following p53 loss of heterozygosity in Kras-driven cancers" uses a number of novel genetically engineered
Mucin-producing urothelial-type adenocarcinoma of prostate: report of two cases of a rare and diagnostically challenging entity
& 2005 USCAP, Inc All rights reserved 0893-3952/05 $30.00 www.modernpathology.org Mucin-producing urothelial-type adenocarcinoma of prostate: report of two cases of a rare and diagnostically challenging
Nature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
F/G 6/18 MECHANISMS OCT 75 T LAWHILL, F SHARP, N SPEED DAMD17-74-C-4026 IHEF. NL UNCLASSIFIlED
F/G 6/18 MECHANISMS 7 A-AI03 183 LOUISVILLE UNIV OF RETINAL KY SCHOOL DAMAGE OF FROM MEDICINE CHRONIC LASER RAOIATION.(U) OCT 75 T LAWHILL, F SHARP, N SPEED DAMD17-74-C-4026 IHEF NL UNCLASSIFIlED )J yreport
chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists.
chapter 1 - fig. 1 The -omics subdisciplines. chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists. 201 figures chapter 1 chapter 2 - fig. 1 Schematic overview of the different steps
Control of Glucose Metabolism
Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream
Longitudinal Validation Study: Streptozotocin-Induced Diabetes as a Model of Diabetic Retinopathy in Brown Norway Rats
Longitudinal Validation Study: Streptozotocin-Induced Diabetes as a Model of Diabetic Retinopathy in Brown Norway Rats Robin Dean, Robert Sukhu, Leslie Nemeth, Qin Zhang, Isaac Hakim, Ali Ebramhimnejad,
3/22/2017. Disclosure of Relevant Financial Relationships. Ki-67 in Pancreatic Neuroendocrine Neoplasms According to WHO 2017.
Disclosure of Relevant Financial Relationships Ki-67 in Pancreatic Neuroendocrine Neoplasms According to WHO 2017. USCAP requires that all planners (Education Committee) in a position to influence or control
Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance
Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,
A 53 year-old woman with a lung mass, right hilar mass and mediastinal adenopathy.
November 2015 Case of the Month A 53 year-old woman with a lung mass, right hilar mass and mediastinal adenopathy. Contributed by: Rasha Salama, M.D., IU Department of Pathology and Laboratory Medicine
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
Digital Pathology and CAP Guidelines
Digital Pathology and CAP Guidelines Frequently asked questions The VENTANA family of digital pathology products empowers you with the convenience of a comprehensive image and workflow solution. When used
Inflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11463 %Sox17(+) 9 8 7 6 5 4 3 2 1 %Sox17(+) #Sox17(+) d2 d4 d6 d8 d1 d12 d14 d18 25 2 15 1 5 Number of Sox17(+) cells X 1 Supplementary Figure 1: Expression of