Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.
|
|
|
- Luke Horn
- 5 years ago
- Views:
Transcription
1 Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with paraformaldehyde, embedded in paraffin and analyzed by immunofluorescence. Example islet images are shown for insulin (green), proinsulin (red) and DAPI nuclei (blue); bar = 20 µm.
2 Supplementary Figure S2. Conventional EM analysis of db/db mouse islets. Example high-pressure fixed-frozen electron microscopy images of ß-cells from freshly isolated db/db mouse islets are shown. Expansion of the rough endoplasmic reticulum (RER) and Golgi apparatus (G), decreased number of mature ß-granules, and increased number of immature ß-granules (IG) are observed.
3 Supplementary Video S1 and Figure S3. EM tomography analysis of a Multivesicular Body (MVB) from a 6J db/db mouse islet ß-cell. MVBs were much more frequent in db/db mouse islet ß-cells than in control islet ß-cells, although still too few to quantify. EM tomography and subsequent 3D reconstruction was performed as described in the Methods (Marsh et al., 2007). The Movie S1 shows the compiled stacked images from the EM tomogram melding into a 3D reconstruction of the MVB where each individual membrane bilayer of the MVB is labeled in yellow, pink and blue. A ß-granule inside the MVB is shown in purple. Figure S2 compiles various views of the 3D reconstruction of the MVB.
4 Supplementary Figure S4. Conventional electron microscopy analysis of db/db mouse islets. High-pressure fix-freezing electron microscopy images from freshly isolated db/db mouse islets showing degranulated ß-cells, but normal morphology of α-, δ- and PP-cells in the same db/db islets.
5 Supplementary Figure S5. Insulin content, secretion and proinsulin:insulin ratio in freshly isolated islets. Isolated islets from control (WT) and db/db mice were treated with glucose (3 mm or 17 mm for 3.5 h), and then proinsulin and insulin concentrations measured in the islet lysates and the incubation media by ELISA. (A) Islet insulin content normalized to islet protein content. (B) Islet proinsulin percentage of the total insulin+proinsulin content. (C) Secreted insulin normalized to islet insulin content. (D) Percentage of proinsulin of the total insulin+proinsulin secreted. Results are presented as mean ± SE (n 5), where * indicates a statistically significant difference of p 0.05 vs. respective (WT) controls. -
6 Supplementary Figure S6. Insulin content and proinsulin:insulin ratio in overnight-recovered islets. Isolated islets from control (WT) and db/db mice were cultured overnight in RPMI medium containing normoglycemic 5.6 mm glucose prior to treatment with basal 3 mm or stimulatory 17 mm glucose for 3.5 hours. Proinsulin and insulin concentrations were then measured in the islet lysates and incubation media by ELISA. (A) Islet insulin content normalized to islet protein content. (B) Islet proinsulin percentage of the total insulin+proinsulin content. (C) Secreted insulin normalized to islet insulin content. (D) Percentage of proinsulin of the total insulin+proinsulin secreted. Results are presented as mean ± SE (n 5), where * indicates a statistically significant difference of p 0.05 vs. respective (WT) controls.
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
F-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
Nature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
Supplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
Cell wall components:
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. The Cell Wall The primary cell wall is capable of rapid expansion during
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure.
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Animal cells have a lysosome (related to vacuole) and centrioles (function
[3]
![[3]](/thumbs/73/69261795.jpg "[3]")
1 (a) Describe the structure of a plasma (cell surface) membrane............................... [3] (b) A student investigated the movement of substances through the cell surface membrane of yeast cells
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
THE CELL Cells: Part 1
THE CELL Cells: Part 1 OBJECTIVES By the end of the lesson you should be able to: State the 2 types of cells Relate the structure to function for all the organelles TYPES OF CELLS There are two types of
ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo
Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Chapter 3: Cell Structure and Function Assignment
Chapter 3: Cell Structure and Function Assignment Provide full detail and be specific for full marks. 1. How do these organelles work together? 2 marks each = 10 marks a. lysosomes and vacuoles When material
label the basement membrane). Different fixation methods of EB-perfused P8 mice to optimize the combination
Supplementary Figure 1 Optimization of the tissue fixation protocol to combine EB perfusion and IB4 endothelial tip cell staining in the postnatal mouse brain. a-l Labeling of EB-perfused P8 mice with
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart.
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. Daniel Aston, Rebecca A. Capel, Kerrie L. Ford, Helen C. Christian,
Insulin mrna to Protein Kit
Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Student Handout www.3dmoleculardesigns.com Insulin mrna to Protein Kit Contents Becoming Familiar with the Data...
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
Prokaryotic and Eukaryotic Cells Look at the diagrams below. Label the prokaryotic cell and the
Prokaryotic and Eukaryotic Cells Look at the diagrams below. Label the prokaryotic cell and the eukaryotic cell. Cell membrane Cytoplasm Cytoplasm Nucleus Organelles Use the diagrams to answer the question.
Supplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
Supplemental Data Figure S1 Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells.
Supplemental Data Figure S1. Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells. (A) Specific lysis of IFN-γ-treated SKBR-3 cells in the absence
Cell Structure & Function. Source:
Cell Structure & Function Source: http://koning.ecsu.ctstateu.edu/cell/cell.html Definition of Cell A cell is the smallest unit that is capable of performing life functions. http://web.jjay.cuny.edu/~acarpi/nsc/images/cell.gif
Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
islets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
6. What surrounds the nucleus? How many membranes does it have?
Biology-R track Study Guide: 7.2 Cell Structure Cell Organization 1. What are the 2 major parts that you can divide the eukaryotic cell into? 2. What part is the fluid portion of the cell outside the nucleus?
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,
Pick1 and ica69 control insulin granule trafficking and their deficiencies lead to impaired glucose tolerance.
Title Pick1 and ica69 control insulin granule trafficking and their deficiencies lead to impaired glucose tolerance. Author(s) Cao, M; Mao, Z; Kam, C; Xiao, N; Cao, X; Shen, C; Cheng, KY; Xu, A; Lee, KM;
By Calypso Harmon Fall 2002
By Calypso Harmon Fall 2002 This is an extremely thin slice through a plant cell. Are there any structures you recognize? Chloroplasts collect the energy from the sun and change it into chemical energy
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
INTRODUCTION TO THE LIGHT MICROSCOPE
Name: INTRODUCTION TO THE LIGHT MICROSCOPE Introduction: If you missed the microscope lab we did in class, you will need to make it up by using a "virtual microscope" which can be accessed on the internet.
Structure of a Generalized Cell
A Quick Tour Through A Cell BIO130 Lab 2 Exercise 4 The Cell: Anatomy Structure of a Generalized Cell -plasma membrane -cytoplasm: cytosol organelles -nucleus Play TourOfAnimalCell.mpg Plasma membrane
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
Afferent lymph-derived T cells and dendritic cells use different CCR7-dependent routes for lymph node entry and intranodal migration
Braun et al. Supplementary Information 1 Supplementary Information Afferent lymph-derived T cells and dendritic cells use different CCR7-dependent routes for lymph node entry and intranodal migration Asolina
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Objectives. By the end of the lesson you should be able to: State the 2 types of cells Relate the structure to function for all the organelles
Biology 11 THE Cell Objectives By the end of the lesson you should be able to: State the 2 types of cells Relate the structure to function for all the organelles Types of Cells There are two types of cells:
Parts (organelles) of the Cell
Lesson 07 Cell Organelles.notebook Parts (organelles) of the Cell Parts that provide structure and support Cell Membrane 1) Is a barrier for the cell. It controls what goes in and out of the cell. 2) It
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
MPB333:Molecular Endocrinology of Obesity and Diabetes
MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Nature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Representative images of an in vitro comparison of several AAV serotypes regarding egfp expression in cochlear explants of CBA/CaJ mice. (A-F): Results after incubation at equal
Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Beck et al., http://www.jcb.org/cgi/content/full/jcb.201011027/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Membrane binding of His-tagged proteins to Ni-liposomes.
1 (a) State the maximum magnification that can be achieved by a light microscope and a transmission electron microscope.
1 (a) State the maximum magnification that can be achieved by a light microscope and a transmission electron microscope. Select your answers from the list below. 10x 40x 100x light microscope... x transmission
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent
Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy
Organelles Found in a Generalized Animal Cell
Organelles Found in a Generalized Animal Cell 1. Cell Membrane 2. Cytoplasm 3. Nucleus 4. Nuclear Membrane 5. Nucleoplasm 6. Nucleolus 7. Chromosomes 8. Vacuole 9. Ribosomes 10. Rough Endoplasmic Reticulum
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Cellular compartments
Cellular compartments 1. Cellular compartments and their function 2. Evolution of cellular compartments 3. How to make a 3D model of cellular compartment 4. Cell organelles in the fluorescent microscope
Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
Ahtiainen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Ahtiainen et al., http ://www.jcb.org /cgi /content /full /jcb.201512074 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Distinct distribution of different cell cycle phases in the
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Title Modified Western blotting for insulin and other diabetes-associated peptide hormones
Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao
Adiponectin/T-cadherin system enhances exosome biogenesis and decreases cellular
Supplemental Data Adiponectin/herin system enhances exosome biogenesis and decreases cellular ceramides by exosomal release 5 Yoshinari Obata, Shunbun Kita, *,, Yoshihisa Koyama, Shiro Fukuda, Hiroaki
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy
SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material
Endomembrane system, *Chloroplasts, *Mitochondria. *Learn these from text/connect1. Fertilization of a human cell
Key Concepts: - Cells are the Basic Unit of Life Cell Theory, Surface to Volume - 2 Cell Types Prokaryotic, Eukaryotic - Cell Membrane Membrane Structure - Cell Organelles Endomembrane system, *Chloroplasts,
c-abl PDGFRα PDGFRβ VEGFR-1 VEGFR-2 FLT-3 c-fms c-kit Ref. 2 (ND) 9.4 (ND) Supplementary Table 2. Chemical structure of the RTKIs used in this study.
SUPPLEMETARY DATA Supplementary Table 1. Upper and lower entries in each cell represent IC50 (nm) values determined by a biochemical kinase assay or cellular tyrosine kinase phosphorylation, respectively.
Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of
Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of phosphatidylserine and phosphatidylcholine. The instrinsic
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
Supplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,