SUPPLEMENTARY INFORMATION
|
|
|
- Shauna Bradford
- 5 years ago
- Views:
Transcription
1 Supplementary Information included with Nature MS B by Colantonio et al., entitled The dynein regulatory complex is required for ciliary motility and otolith biogenesis in the inner ear. This document contains: 1. Legends for six (6) supplementary figures, labeled S1 S6. 2. Legends for fourteen (14) supplementary videos, labeled SupMov01 - SupMov11b. SUPPLEMENTAL FIGURE AND MOVIE LEGENDS Supplemental Figure S1. High magnification image of gas11 expression in the otic vesicle. In situ hybridization shows gas11 is expressed throughout the otic vesicle at 8 to 13-somite stages, then becomes concentrated at the poles of the otic vesicle (white arrows) at 15 to 18- somite stages. Beyond the 18-somite stage, the signal in the otic vesicle is not detectable above that in surrounding tissues (not shown). The dorsal/ventral and anterior/posterior axis are shown. Supplemental Figure S2. gas11 knockdown results in left-right axis defects. In situ hybridizations using southpaw riboprobe demonstrate laterality defects in gas11 morphants at the somite stage. The relative numbers of uninjected (n = 119) and gas11 morphant (n = 138) embryos having each staining pattern are shown. Supplemental Figure S3. gas11 is required for tether cilia motility. Brightfield images taken from high-speed videos of tether cilia in control (top) and gas11 morphant (bottom) embryos. Panels are consecutive frames extracted at 16 ms intervals from supplemental movies 5 (control), and 8 (gas11 morphant). Lines trace the cilium and are colorized (violet to red) in time 1
2 sequence. These are then aligned at the base of the cilium and overlayed in the right-most panel to generate the combined image. Supplemental Figure S4. Morpholino knockdown of lrrc50 and lrdr1 disrupts tether cilia motility and causes otolith defects. (a) Table summarizing the effect of lrrc50 and lrdr1 knock down. To confirm the specificity of the lrrc50 morpholino, a control morpholino (5 base pairs mismatch) was injected. Error bars show standard deviation. (b-f) phenotypic comparison between control (b) and morpholino injected embryos (c-f) at 27 hpf. Among multiple otolith defects the most common are: (c) fused otolith, (d) smaller otoliths, (e) mis-positioned otolith, (f) single otolith. Left otic vesicle, anterior to the right. Scale bar: 20 microns. Supplemental Figure S5. The lrrc50 splice morpholino interferes with lrrc50 splicing. (A) RT-PCR with two different primer sets confirms that the lrrc50 splicing morpholino interferes with lrrc50 splicing. mrna from control embryos (Ctrl2) or embryhos injected with 10 ng of splicing MO (Mo-2) were subjected to RT-PCR with the indicated primers for lrrc50, or GAPDH as a control. The positions of lrrc50 primers are shown relative to the intron/exon positions of the lrrc50 mrna (not to scale). (B) RT-PCR with lrrc50 primers (1) x (3) showing a decrease in the abundance of the product from the spliced transcript (147 bp, open arrow) and the appearance of a band corresponding to the size expected for the product from the unspliced transcript in the injected sample (1241 bp, black arrow). GAPDH mrna levels were unaffected. (C) RT-PCR with lrrc50 primers (1) x (2) shows the appearance of a band corresponding to the size predicted from the unspliced transcript in the injected sample (1147 bp, 2
3 red arrow). The same results were obtained with an independent set of mrna samples (not shown). Supplemental Figure S6. Particle displacement in control embryo. White arrows indicate particle direction, illustrating the attractive flow at the base of the cilium. These particle displacements correspond to the particle traces shown in figure 4G. Supplemental movies Supplemental movie 1. Three dimensional display of a control inner ear at stage 27 hpf after immunofluorescence labeling of cilia with acetylated tubulin antibody. Notice the two clusters of tether cilia on the lateral side of the inner ear. Side view, anterior on the right. (QuickTime: 1.27 MB) Supplemental movie 2. Three dimensional display of a gas11 morphant inner ear at stage 27 hpf after acetylated tubulin immunofluorescence labeling. The two clusters of tether cilia are properly located. Side view, anterior on the right. (QuickTime: 2.30 MB) Supplemental movie 3. Video shows tether cilia motility in control embryo. This video corresponds to snapshots shown in figure 3A, B. One cilium is attached to the otolith and beating of this cilium causes the otolith to move. A second motile cilium is also evident. Embryo is 20 hpf. Acquisition rate 322 frames/sec played at 20 frame/sec. (QuickTime: 1.30 MB) 3
4 Supplemental movie 4. Video shows tether cilia motility in control embryo. Embryo is 24 hpf. Acquisition rate 322 frames/sec played at 20 frame/sec. (QuickTime: 1.50 MB) Supplemental movie 5. Video shows tether cilia motility in control embryo. Cilium beating causes otolith to move. This video corresponds to snapshots shown in supplemental figure 2 (control). Embryo is hpf. Acquisition rate 322 frames/sec played at 20 frame/sec. (QuickTime: 2.95 MB) Supplemental movie 6. Video shows short cilia in control embryo are not motile. Embryo is hpf. Acquisition rate 322 frames/sec played at 20 frame/sec. (QuickTime: 5.9 MB) Supplemental movie 7. Video shows tether cilia in a gas11 morphant embryo are not motile. Embryo is 20 hpf. This video corresponds to snapshots shown in figure 3C,D. (QuickTime: 0.83 MB) Supplemental movie 8. Video shows tether cilia in a gas11 morphant embryo are not motile. Embryo movement during the video is due to normal embryonic activity. This video corresponds to snapshots shown in supplemental figure 2 (gas11 MO). Embryo is hpf. Acquisition rate 322 frames/sec played at 20 frame/sec. (QuickTime: 8.05 MB) 4
5 Supplemental movie 9a. High speed video microscopy of tether cilia in a control embryo at 24 hpf showing vortices in the vicinity of the tether cilia and particle propelling along the growing otolith. Acquisition rate: 322 frames/sec played at 50 frames/sec. (QuickTime: 2.94 MB) Supplemental movie 9b. Same as 9a with particle tracking. This video corresponds to figure 4A, B. Acquisition rate: 64 frames/sec played at 20 frames/sec. (QuickTime: MB) Supplemental movie 10a. High speed video microscopy of the inner ear in a control embryo at 23 hpf showing high displacement of otolith precursors in the vicinity of tether cilia and low displacement away from tether cilia. Acquisition rate: 322 frames/sec played at 20 frames/sec. (QuickTime: 3.11 MB) Supplemental movie 10b. Same as supplemental movie 10a with particle tracking. This video corresponds to figure 4G and supplemental Figure S3. Acquisition rate: 64 frames/sec played at 50 frames/sec. (Quicktime: 1.59 MB) Supplemental movie 11a. High speed video microscopy of tether cilia in a gas11 morphant at 25 hpf showing very low particle displacement in the vicinity of tether cilia. Acquisition rate: 322 frames/sec played at 20 frames/sec. (QuickTime: 1.36 MB) Supplemental movie 11b. Same as 11a with particle tracking. This video corresponds to figure 4D, E. Acquisition rate 64 frames/sec played at 50 frames/sec. (QuickTime: MB) 5
6 Supplemental Figure S1 6
7 LEFT spaw BILATERAL ABSENT RIGHT Gas11 MO Control spaw 89.1% 7.6% 2.5% 0.8% 25.4% 71.0% 2.2% 1.4% Supplemental Figure S2 7
8 combined control gas11 MO combined Supplemental Figure S3 8
9 a Effect of lrrc50 and lrdr1 knock down n=40 Percentage (%) n=41 n=30 n=35 n=30 n=43 n=31 n=20 n=30 n=25 n= ng 15ng 5ng 5ng 3 otolith no otolith 1 otolith fused smaller otolith cilia immotility lrrc50 mis MO 5ng 10ng 15ng 0 0 5ng 5ng lrrc50 MO ng 0.5ng 0.25ng 0.5ng ng 0.5ng lrdr1 MO b c d e f control lrrc50/lrdr1 MO Supplemental Figure S4 9
10 a (primers) lrrc50 mrna (1) (2) (3) b gapdh primers lrrc50 (1) x (3) primers c lrrc50 (1) x (2) primers 5 primer: 3 primer: Template: Ctrl2 Mo-2 Ctrl2 Mo Ctrl2 - - Mo-2 kb kb Supplemental Figure S5 10
11 Supplemental Figure S6 11
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Formation of the AA5x. a, Camera lucida drawing of embryo at 48 hours post fertilization (hpf, modified from Kimmel et al. Dev Dyn. 1995 203:253-310). b, Confocal microangiogram
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
Supplementary Information
Supplementary Information CEP41 is mutated in Joubert syndrome and is required for tubulin glutamylation at the cilium Ji Eun Lee, Jennifer L. Silhavy, Maha S. Zaki, Jana Schroth, Stephanie L. Bielas,
Fig. S1. RT-PCR analyses of the expression and distribution of Xdscr6 transcripts during early development.
Fig. S1. RT-PCR analyses of the expression and distribution of Xdscr6 transcripts during early development. (A) Temporal expression of Xdscr6 at various stages (numbers on the top) and its distribution
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation
The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation Anita Becker-Heck#, Irene Zohn#, Noriko Okabe#, Andrew Pollock#, Kari Baker Lenhart,
Supplemental Information. Ciliary Beating Compartmentalizes. Cerebrospinal Fluid Flow in the Brain. and Regulates Ventricular Development
Current Biology, Volume Supplemental Information Ciliary Beating Compartmentalizes Cerebrospinal Fluid Flow in the Brain and Regulates Ventricular Development Emilie W. Olstad, Christa Ringers, Jan N.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3200 Supplementary Figure 1 Expression analysis of stomach markers in gutlike structure. (a) Differentiation scheme of gut-like structure formation from embryonic stem cells. (b) RT-PCR
Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration
Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Alison A. Staton, Holger Knaut, and Antonio J. Giraldez Supplementary Note Materials and
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Influenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary table and figures
3D single molecule tracking with multifocal plane microscopy reveals rapid intercellular transferrin transport at epithelial cell barriers Sripad Ram, Dongyoung Kim, Raimund J. Ober and E. Sally Ward Supplementary
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Figures
Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in
Kupffer s vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut
First posted online on 16 February 2005 as 10.1242/dev.01663 Access the most recent epress version at online http://dev.biologists.org/lookup/doi/10.1242/dev.01663 publication date 16 February 2005 1247
Supplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
Supplementary material Legends to Supplementary Figures Figure S1. Figure S2. Figure S3.
Supplementary material Legends to Supplementary Figures. Figure S1. Expression of BICD-N-MTS fusion does not affect the distribution of the Golgi and endosomes. HeLa cells were transfected with GFP-BICD-N-MTS
Cytosolic Carboxypeptidase 5 and Cilia Development in Zebrafish
Andrews University Digital Commons @ Andrews University Honors Theses Undergraduate Research 2014 Cytosolic Carboxypeptidase 5 and Cilia Development in Zebrafish Philip E. Giddings IV This research is
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3443 In the format provided by the authors and unedited. Supplementary Figure 1 TC and SC behaviour during ISV sprouting. (a) Predicted outcome of TC division and competitive Dll4-Notch-mediated
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
Polaris and Polycystin-2 in dorsal forerunner cells and Kupffer s vesicle are required for specification of the zebrafish left right axis
Developmental Biology 287 (2005) 274 288 www.elsevier.com/locate/ydbio Polaris and Polycystin-2 in dorsal forerunner cells and Kupffer s vesicle are required for specification of the zebrafish left right
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
Supplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
Supplementary Figure 1
Supplementary Figure 1 Global TeNT expression effectively impairs synaptic transmission. Injection of 100 pg tent mrna leads to a reduction of vesicle mediated synaptic transmission in the spinal cord
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B
A study of cilia density in sea urchin embryos during gastrulation
A study of cilia density in sea urchin embryos during gastrulation Steve Das Independent Research Project Report Bio 254 Developmental Biology May 3, 2012 Introduction Embryo growth and development is
p.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure
a Missense ATG p.arg119gly p.arg119his p.ala179thr p.ala189val p.gly206trp p.gly206arg p.arg251his p.ala257thr TGA 5 UTR 1 2 3 4 5 6 7 3 UTR Splice Site, Frameshift b Mutation p.gly206trp p.gly4fsx50 c.138+1g>a
Supplementary Information. Preferential associations between co-regulated genes reveal a. transcriptional interactome in erythroid cells
Supplementary Information Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells Stefan Schoenfelder, * Tom Sexton, * Lyubomira Chakalova, * Nathan
ASSET Student Laboratory
ASSET Student Laboratory The Effect of Cigarette Smoke and Alcohol on Tetrahymena Background Information While the general effects of smoking and alcohol use on humans are well documented, it is useful
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Yasunaga et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Yasunaga et al., http ://www.jcb.org /cgi /content /full /jcb.201502043 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Spatial and temporal expression of nphp4, and localization
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Experimental strategy to generate sensory hair cells in the mammalian cochlea and evaluate their morphological, molecular, and biophysical properties. A) Expression plasmid encoding
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
doi: /nature10632
SUPPLEMENTARY INFORMATION doi:10.1038/nature10632 Supplementary Figure 1 Lyn mediates neutrophil wound responses as a redox sensor. a, A schematic model. Wounded epithelial cells release H 2 O 2 by an
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
DIAGNOSIS OF PRIMARY CILIARY DYSKINESIA
DIAGNOSIS OF PRIMARY CILIARY DYSKINESIA Kris De Boeck, MD PHD Pediatric Pulmonology, University of Leuven, Belgium Introduction Cause Congenital dysfunction of motile cilia Absence/dysfunction of one of
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Brooks and Wallingford, http://www.jcb.org/cgi/content/full/jcb.201204072/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Quantification of ciliary compartments in control
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K.
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
Supplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Non-canonical Notch signaling represents an ancestral mechanism to regulate neural differentiation
Layden and Martindale EvoDevo 2014, 5:30 RESEARCH Non-canonical Notch signaling represents an ancestral mechanism to regulate neural differentiation Michael J Layden 1 and Mark Q Martindale 2* Open Access
klp-18 (RNAi) Control. supplementary information. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach
![klp-18 (RNAi) Control. supplementary information. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach](/thumbs/91/104639484.jpg "klp-18 (RNAi) Control. supplementary information. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach")
DOI: 10.1038/ncb1891 A. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach embryos let hatch overnight transfer to RNAi plates; incubate 5 days at 15 C RNAi food L1 worms adult worms
Developmental Biology
Developmental Biology 336 (2009) 183 191 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology A gap junction connexin is required in the
Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
A A B B. 6ss. Cont MO. ZFoxJ1 MO. n=296. n=247
A A C E 6ss B B D Cont MO ZFoxJ1 MO Supplementary Figure 1: ZFoxJ1 RNA expression and function in ciliated cells of Zebrafish embryos. (A-B) At the 6ss stage (A,A ), ZFoxJ1 RNA is expressed prominently
High prevalence of Primary Ciliary Dyskinesia in a British Asian population
High prevalence of Primary Ciliary Dyskinesia in a British Asian population Chris O Callaghan 1, Phil Chetcuti 2, Eduardo Moya 3 1. University of Leicester, Leicester, United Kingdom 2. Leeds General Infirmary,
Cellular components of CNS
Cellular components of CNS Cellular components of CNS Neurons Glial cells: Astrocytes (including radial glia), oligodendrocytes, microglia, ependymal cells Epithelial cells of choroid plexus Endothelial
Modulation of Host Learning in Aedes aegypti Mosquitoes
Current Biology, Volume 28 Supplemental Information Modulation of Host Learning in Aedes aegypti Mosquitoes Clément Vinauger, Chloé Lahondère, Gabriella H. Wolff, Lauren T. Locke, Jessica E. Liaw, Jay
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
DEVELOPMENT RESEARCH ARTICLE
RESEARCH ARTICLE 1621 Development 136, 1621-1631 (2009) doi:10.1242/dev.020735 Mutations in zebrafish leucine-rich repeat-containing six-like affect cilia motility and result in pronephric cysts, but have
Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery. Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito
Supplementary Information for: Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito Supplementary Methods Supplementary
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for LacZ activity, which reflects Egr1 expression. (A)
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,
Cilia-driven fluid flow in the zebrafish pronephros, brain and Kupffer s vesicle is required for normal organogenesis
Research article 1907 Cilia-driven fluid flow in the zebrafish pronephros, brain and Kupffer s vesicle is required for normal organogenesis Albrecht G. Kramer-Zucker 1, Felix Olale 2, Courtney J. Haycraft
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Available online at
Available online at www.sciencedirect.com Developmental Biology 314 (2008) 261 275 www.elsevier.com/developmentalbiology Zebrafish mutations affecting cilia motility share similar cystic phenotypes and
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Jesica Raingo, Mikhail Khvotchev, Pei Liu, Frederic Darios, Ying C. Li, Denise
N-Cadherin Locks Left-Right Asymmetry by Ending the Leftward Movement of Hensen s Node Cells
Developmental Cell, Volume 30 Supplemental Information N-Cadherin ocks eft-ight Asymmetry by Ending the eftward Movement of Hensen s Node Cells aquel V. Mendes, Gabriel G. Martins, Ana M. Cristovão, and
SUPPLEMENTAL INFORMATION FOR. PAX7 expression defines germline stem cells in the adult testis
SUPPLEMENTAL INFORMATION FOR PAX7 expression defines germline stem cells in the adult testis Gina M. Aloisio, Yuji Nakada, Hatice D. Saatcioglu, Christopher G. Peña, Michael D. Baker, Edward D. Tarnawa,
SUPPLEMENTARY INFORMATION
Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Supplemental Information. Proprioceptive Opsin Functions. in Drosophila Larval Locomotion
Neuron, Volume 98 Supplemental Information Proprioceptive Opsin Functions in Drosophila Larval Locomotion Damiano Zanini, Diego Giraldo, Ben Warren, Radoslaw Katana, Marta Andrés, Suneel Reddy, Stephanie
ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo
Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina
EMBO REPORT SUPPLEMENTARY SECTION. Quantitation of mitotic cells after perturbation of Notch signalling.
EMBO REPORT SUPPLEMENTARY SECTION Quantitation of mitotic cells after perturbation of Notch signalling. Notch activation suppresses the cell cycle indistinguishably both within and outside the neural plate
SUPPLEMENTARY INFORMATION
sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing
SUPPLEMENTARY INFORMATION
DOI: 0.038/ncb33 a b c 0 min 6 min 7 min (fixed) DIC -GFP, CenpF 3 µm Nocodazole Single optical plane -GFP, CenpF Max. intensity projection d µm -GFP, CenpF, -GFP CenpF 3-D rendering e f 0 min 4 min 0
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
RECONSTITUTION OF METACHRONAL WAVES IN CILIATED CORTICAL SHEETS OF PARAMECIUM
J. exp. Biol. 192, 73 81 (1994) Printed in Great Britain The Company of Biologists Limited 1994 73 RECONSTITUTION OF METACHRONAL WAVES IN CILIATED CORTICAL SHEETS OF PARAMECIUM II. ASYMMETRY OF THE CILIARY