Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration

Transcription

1 Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Alison A. Staton, Holger Knaut, and Antonio J. Giraldez Supplementary Note Materials and Methods Fish lines Fish lines used were wild type, MZdicer hu896/hu896, and MZdrosha q142/q142. Heterozygous mutants in chemokine signaling were obtained by crossing cxcr7b sa16/sa16 or sdf1a at30516/at30516 to wild type. All animal care and procedures were performed in accordance with Yale IACUC ethical standards and protocols. When examining such a sensitive phenotype, it is possible that minor differences in zebrafish strain or husbandry could influence the ability to detect perturbations to the system. Wild type embryos were produced by crossing fish from mixed wild type strains (AB:TL crossed to TU:TLF) to reduce the possibility of strain-specific differences influencing results. Dicer and Drosha mutant fish were identified from a screen performed in TL fish, but the stocks have been maintained by outcrossing with our wild type fish. It should be noted that the sdf1a mutant was not used in our original paper; we were limited to injecting a low dose of sdf1a morpholino. The morpholino+tp condition showed mislocalization greater than that of sdf1a+/- +TP (60% vs. 41%), indicating that the low dose of morpholino did not perfectly replicate the mutant phenotype. However, the mislocalization of PGCs in this heterozygous mutant still showed a dramatic increase upon removal of mir-430 regulation of sdf1a and cxcr7b. Injection experiments Embryos were dechorionated at the one-cell stage and injected with 1 nl. Target Protector morpholinos were ordered from Genelink and were injected at 0.2 mm each TP. The Tiny LNAs were ordered from Exiqon and injection concentration was 10 µm, unless otherwise specified. Reporter experiments were conducted with 100 ng/ul RNA. Reporter constructs were published

2 in Staton, et al., Embryos were incubated 24 hours at 28 degrees Celsius. Embryos for in situ were fixed in 4% paraformaldehyde in PBS. In situ hybridization was carried out as published in Staton, et al., 2011 using a DIG-labelled probe for nanos mrna. Injections in heterozygous mutant backgrounds were conducted in a blinded manner, with the researcher who injected the embryos only revealing the genotype and treatment of the embryos after another researcher had performed the in situ and quantified mislocalized cells. Sequences: sdf1a-tp 5 - GCATATTTGGCAGGTTAAGTGCTGG -3 cxcr7b-tp 5 - CAAGTGCTTCTCATCTATATCCGAC -3 mir-430 Tiny LNA 5 - TAGCACTT -3 mir-1 Tiny LNA 5 - ACATTCCA -3 Phenotype Quantification Embryos with PGCs labelled by nanos in situ were examined. Any germ cells that were not adjacent to the top third of the pronephros were characterized as mislocalized. Common locations of mislocalization includes the head, the lower tail (in the somites), and the posterior pronephros. Quantification was carried out in two or three sets of embryos, with at least 25 embryos in a group. Wild type embryos consisted of combined clutches of 4 or more mating pairs. For injection into wild type, embryos from 4 or more mating pairs were collected and mixed before being randomly separated into different injection or control groups. For mutant embryos, at least two different clutches of embryos, from different mating pairs, were collected and quantified separately. The average percentages of both embryos with 1 or more and 3 or more mislocalized PGCs are presented. Error bars show standard deviation of samples. P- values for Figure 1 were calculated using a t-test. A Chi Squared test was used to calculate the statistical significance of groups in Figure 2. These percentages were compared to those found in Staton, et al., 2011 to look for any conditions that were not consistent with published data.

3 Supplementary Figure 1.

4 Supplementary Figure 1. Location of PGCs in wild type and MZdicer embryos. A) Nanos in situ in wild type embryos at 24 hpf shows typical localization of PGCs. The correct location of PGCs is shown with the bracket. Mislocalized PGCs are indicated with the black arrow. B) Panel of MZdicer embryos with PGCs labeled by nanos in situ. Arrows indicate mislocalized PGCs.

5 Supplementary Figure 2. A B

6 Supplementary Figure 2. MZdrosha and mir-430 Tiny LNA-injected embryos show an increase in the the percentage of embryos with mislocalized PGCs. Nanos in situ was used to label PGCs in 24 hpf MZdrosha (A) or wild type injected with the mir-430 Tiny LNA (B). The bracket shows correct localization of PGCs and arrows indicate mislocalized cells.

7 Supplementary Figure 3. A wild type Tiny LNA AAAA ON AAAA mirna-loaded RISC Tiny LNA B wild type mir-430 Tiny LNA T T C A C G A T dre-mir-430a -U A A G U G C U A U U U - G U U G G G G U A G - mir-1 Tiny LNA A C C T T A C A dre-mir-1 -U G G A A U G U A A A G A A G U A U G U A U mir-430 Tiny LNA 2 um 5 um 10 um E Embryos with Mislocalized PGCs (%) wild type mir-430 Tiny LNA mir-1 Tiny LNA C mir-430 Tiny LNA Uninjected 5 um 10 um MZdicer 1 or more 3 or more D wild type wild type + mir-430 LNA GFP-sdf1a 3 UTR wild type + mir-1 LNA MZdicer MZdicer + mir-430 LNA MZdicer + mir-1 LNA

8 Supplementary Figure 3. mir-430 Tiny LNA can be used to specifically interfere with mir-430-mediated regulation. A) Model for the activity of Tiny LNAs. mirnas bound to the RISC complex typically target mrnas based on complementarity to the seed region of the mirna. The Tiny LNA binds strongly to the -bound mirna, preventing it from binding and downregulating its targets. The sequences and pairing of the Tiny LNAs for mir-430 and mir-1, which was used as a control here, are shown. B) mir-430 Tiny LNA was injected at increasing concentrations in wild type embryos. As the concentration increases to 10 M, the phenotype of embryos resembles that of MZdicer, which lack mir-430. Brightfield images of 28 hpf embryos are shown. C) mir-430 Tiny LNA does not change the phenotype of MZdicer embryos. Brightfield images of 24 hpf MZdicer embryos show that the Tiny LNA has no phenotypic effect on embryos lack mir-430. D) The mir-430 Tiny LNA relieves repression of a mir-430 target. GFP mrna with the 3 UTR to sdf1a was injected into wild type and MZdicer embryos. dsred RNA was coinjected as a control. Injection of the Tiny LNA for mir-430, but not mir-1, allowed increased expression of GFP, comparable to that seen in MZdicer. Additionally, injecting Tiny LNA in MZdicer did not increase the GFP expression of the reporter, suggesting that the increase is due solely to the loss of mir-430 activity. Fluorescent images of embryos at approximately 28 hpf are shown. E) mir-1 Tiny LNA does not increase mislocalization of PGCs. Embryos were injected with 10 M of mir-1 or mir- 430 Tiny LNA. Embryos were fixed at 24 hpf and stained for nanos. Mislocalization was quantified as described.