Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
|
|
- Frederick Norton
- 5 years ago
- Views:
Transcription
1 Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira Daljeet, Danna M. Breen, Beatrice M. Filippi & Tony K.T. Lam Supplementary Table 1. Diet content of the regular chow and the lard-oil enriched high fat diet.
2 Supplementary Table 2. Plasma insulin and glucose concentrations of the groups receiving duodenal and/or MBH infusions during the basal and clamp conditions. Chow + saline (N = 7) HFD + saline (N = 10) HFD + resveratrol (N = 6) HFD + SIRT1 shrna + resveratrol (N = 6) HFD + resveratrol + EX527 (N = 5) HFD + resveratrol + tetracaine (N = 5) HFD + MBH insulin + duodenal resveratrol (basal clamp) (N = 6) Basal Insulin (ng/ml) 0.9 ± ± ± ± ± ± ± 0.3 Glucose (mm) 6.7 ± ± ± ± ± ± ± 0.3 Clamp Insulin (ng/ml) 2.4 ± ± ± ± ± ± ± 0.2 Glucose (mm) 6.8 ± ± ± ± ± ± ± 0.4! Data are means ± SEM (Basal: min; Clamp: ). HFD, high fat diet; MBH, mediobasal hypothalamus.
3 Supplementary Table 3. Fat pad and relative fat pad mass in 28 d chow-fed and HFD-fed rats. Fat pad Chow HFD Epididymal (g) 5.3 ± ± 0.9 Retroperitoneal (g) 4.2 ± ± 1.2* Visceral (g) 3.1 ± ± 0.9* Total (g) 12.6 ± ± 2.8* Relative fat pad mass (%) * (*P < 0.05 vs. chow) Data are mean ± SEM
4 Supplementary Fig. 1 Supplementary Figure 1 Schematic diagram of the working hypothesis. Intraduodenal resveratrol activates a duodenal Ampk! Sirt1 pathway to trigger a vagal gut-brain neuronal axis to remotely reverse hypothalamic insulin resistance.
5 Supplementary Fig. 2 Supplementary Figure 2 Intraduodenal resveratrol infusion improves insulin sensitivity via duodenal Sirt1 without affecting the rate of glucose uptake, and Sirt1 knockdown is restricted to the duodenum. (a,b) HGP percent suppression from basal (a) and glucose uptake (b) during the hyperinsulinemic euglycemic clamp in normal chow-fed rats with intraduodenal saline (n = 7) or DMSO (n = 5), and HFD-fed rats with intraduodenal saline (n = 10) or resveratrol (n = 7), or i.v. resveratrol (n = 5) (c,d,e) Sirt1 protein expression normalized to β actin and representative western blots of two total western blots in the jejunum, ileum, and liver of 3 d duodenal LVmismatch (n = 6) or LV-Sirt1 shrna (n = 10) injected rats (determined by unpaired t-test). (f,g) HGP percent suppression from basal (f) and the rate of glucose uptake (g) during the hyperinsulinemic euglycemic clamp in HFD-fed injected with 3 d intraduodenal LVmismatch with intraduodenal saline (n = 5) or resveratrol (n = 6) or LV-Sirt1 shrna with intraduodenal saline (n = 5) or resveratrol (n = 6). (h,i,j) The glucose infusion rate (h), HGP percent suppression from basal (i) and the rate of glucose uptake (j) during the hyperinsulinemic euglycemic clamp in normal chow-fed rats injected with either intraduodenal LV-mismatch (n = 5) or LV-Sirt1 shrna (n = 5) for 14 d (h,i,j, *P < 0.05, **P < determined by unpaired t-test). Values are shown as mean ± s.e.m. Data analyzed by one-way ANOVA with Tukey s post hoc test unless otherwise noted. **P < 0.01
6 Supplementary Fig. 3 Supplementary Figure 3 Duodenal resveratrol activates duodenal Sirt1, Ampk, and Pka to improve insulin sensitivity independent of changes in glucose uptake. (a) Duodenal mucosal NADH levels in saline (n = 6) or resveratrol (n = 7) treated HFD-fed rats. (b,c,d) The glucose infusion rate (b) HGP percent suppression from basal (c) and the rate of glucose uptake (d) during the hyperinsulinemic euglycemic clamp in normal chow- and HFD-fed rats infused with intraduodenal saline (n = 7, 10) or with EX527 alone (n = 5, 5), and HFD-fed rats infused with resveratrol alone (n = 7) or EX527 and resveratrol (n = 5). (e) Left: Representative western blot of one total western blot and quantitative analysis of pampk protein expression normalized to Ampk in HEK293 cells treated with DMSO (n = 5) or 1 h resveratrol (n = 5) Right: Ampk activity in HEK293 cells treated with DMSO (n = 5) or 1 h resveratrol (n = 5) (*P < 0.05, **P < determined by unpaired t-test). (f,g,h) The glucose infusion rate (f) HGP percent suppression from basal (g) and glucose uptake (h) during the hyperinsulinemic euglycemic clamp in normal chow-fed rats infused with intraduodenal saline (n = 7) or compound C (n = 5) and in HFD-fed rats infused with intraduodenal saline (n = 10), compound C (n = 5), resveratrol (n = 7), resveratrol with compound C (n = 6), SRT1720 (n = 5), and SRT1720 with compound C (n = 7). (i,j) The glucose infusion rate (i) HGP percent suppression from basal (j, left) and glucose uptake (j, right) during the hyperinsulinemic euglycemic clamp in normal chow-fed rats with intraduodenal saline (n = 7) or with Rp-CAMPS alone (n = 5) and in HFD-fed rats with saline (n = 10) or with resveratrol (n = 7) or with Rp-CAMPS (n = 6) or with resveratrol + Rp-CAMPS (n = 5). Values are shown as mean ± s.e.m. Data analyzed by one-way ANOVA with Tukey s post hoc test unless otherwise noted. ** P < 0.01; *P < 0.05
7 Supplementary Fig. 4 Supplementary Figure 4 Intraduodenal resveratrol requires a vagal gut-brain neuronal axis to remotely improve hypothalamic insulin sensitivity to lower GP, independent of changes in glucose uptake. (a,b) HGP percent suppression from basal (a) and glucose uptake (b) during the hyperinsulinemic euglycemic clamp in normal chow-fed rats with intraduodenal infusion of either saline (n = 7) or tetracaine alone (n = 5) and in HFD-fed rats with intraduodenal infusion of saline (n = 10), resveratrol (n = 7) or tetracaine (n = 5) or resveratrol + tetracaine (n = 5) or resveratrol + NTS infusion of either saline (n = 5) or MK801 (n = 5), or resveratrol after Sham (n = 5) or HVAG (n = 6) (c,d) HGP percent suppression from basal (c) and the glucose uptake (d) during the pancreatic (basal insulin) euglycemic clamp with MBH insulin and duodenal saline in normal chow-fed rats (n = 7), and MBH insulin and duodenal saline (n = 5), MBH saline and duodenal resveratrol (n = 5), MBH insulin and duodenal resveratrol (n = 6), MBH S961 (n = 5) or insulin + S961 (n = 6) and duodenal resveratrol in HFD-fed rats. Values are shown as mean ± s.e.m. Data analyzed by one-way ANOVA with Tukey s post hoc test. ** P < 0.01
8 Supplementary Fig. 5 Supplementary Figure 5 Intraduodenal resveratrol improves insulin sensitivity in 28 d HFD-fed obese insulin resistant rats. (a,b) Body weight gain (a) and percent body weight gain (b) of 28 day chow-fed (n = 5) and HFD-fed (n = 6) rats (*P < 0.05 determined by unpaired t test at each time point). (c,d) HGP percent suppression from basal (c) and the rate of glucose uptake (d) during the hyperinsulinemic euglycemic clamp in 28 d normal chow-fed rats with intraduodenal saline (n = 5) and 28 d HFD-fed rats with intraduodenal saline (n = 8) or resveratrol (n = 6). Values are shown as mean ± s.e.m. Unless noted, data analyzed by one-way ANOVA with Tukey s post hoc test. **P < 0.01
Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production
activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationLipid metabolism within the duodenum increases. Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production
BRIEF REPORT Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production Danna M. Breen, 1,2 Jessica T.Y. Yue, 1,2 Brittany A. Rasmussen, 1,3 Andrea Kokorovic, 1,3 Grace W.C. Cheung,
More informationIntestinal cholecystokinin and leptin signaling and the regulation of glucose production
Intestinal cholecystokinin and leptin signaling and the regulation of glucose production By Brittany Anne Rasmussen A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
More informationLactobacillus gasseri in the Upper Small Intestine Impacts an ACSL3-Dependent Fatty Acid-Sensing Pathway Regulating Whole-Body Glucose Homeostasis
Article Lactobacillus gasseri in the Upper Small Intestine Impacts an ACSL3-Dependent Fatty Acid-Sensing Pathway Regulating Whole-Body Glucose Homeostasis Graphical Abstract Authors Paige V. Bauer, Frank
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationSupplementary legends
Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationINTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK
INTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK by Grace Wing Chee Cheung A thesis submitted in conformity with the requirements for the degree of MASTER OF SCIENCE DEPARTMENT
More informationActivation of short and long chain fatty acid sensing machinery in the ileum lowers glucose production in vivo
JBC Papers in Press. Published on February 19, 1 as Manuscript M11.71 The latest version is at http://www.jbc.org/cgi/doi/1.17/jbc.m11.71 Ileal fatty acid sensing and glucose regulation Activation of short
More information(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationInflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationTherapy: Metformin takes a new route to clinical
Therapy: Metformin takes a new route to clinical efficacy. Marc Foretz, Benoit Viollet To cite this version: Marc Foretz, Benoit Viollet. Therapy: Metformin takes a new route to clinical efficacy.. Nature
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationTable 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1
Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationSupplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationGut ghrelin regulates hepatic glucose production and insulin signaling via a gutbrain-liver
Lin et al. Cell Communication and Signaling (2019) 17:8 https://doi.org/10.1186/s12964-019-0321-y RESEARCH Open Access Gut ghrelin regulates hepatic glucose production and insulin signaling via a gutbrain-liver
More informationSupplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
More informationSupplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and
Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and plasma insulin levels (C) during the 48 h infusion period before the two-step hyperglycemic clamp in diabetes-prone
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationEpigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity
Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More informationDiabetic silkworms for evaluation of therapeutically effective drugs
Supplementary information Diabetic silkworms for evaluation of therapeutically effective drugs against type II diabetes. Yasuhiko Matsumoto, Masaki Ishii, Yohei Hayashi, Shinya Miyazaki, Takuya Sugita,
More informationSupplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationAntisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes
Antisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes Digenio A, et al. Table of Contents Detailed Methods for Clinical
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationFood Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationIntestinal Cholecystokinin Controls Glucose Production through a Neuronal Network
Article Intestinal Cholecystokinin Controls Glucose Production through a Neuronal Network Grace W.C. Cheung, 1,2 Andrea Kokorovic, 1,2 Carol K.L. Lam, 1,2 Madhu Chari, 1,2 and Tony K.T. Lam 1,2,3, * 1
More informationJejunal Leptin-PI3K Signaling Lowers Glucose Production
Short Article Jejunal Leptin-PI3K Signaling Lowers Glucose Production Brittany A. Rasmussen, 1,2,5 Danna M. Breen, 1,3,5,6 Frank A. Duca, 1,3 Clémence D. Côté, 1,2 Melika Zadeh-Tahmasebi, 1,2 Beatrice
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationControl of Glucose Metabolism
Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream
More informationSupplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
More informationInsulin Activates Erk1/2 Signaling in the Dorsal Vagal Complex to Inhibit Glucose Production
Article Insulin Activates Erk1/2 Signaling in the Dorsal Vagal Complex to Inhibit Glucose Production Beatrice M. Filippi, 1,2 Clair S. Yang, 1,3 Christine Tang, 1 and Tony K.T. Lam 1,2,3,4, * 1 Toronto
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationTBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationUniversity of California, San Diego La Jolla CA 92093
AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationSupplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationBMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationCitation for published version (APA): Diepenbroek, C. (2017). Glucose metabolism, diet composition, and the brain
UvA-DARE (Digital Academic Repository) Glucose metabolism, diet composition, and the brain Diepenbroek, C. Link to publication Citation for published version (APA): Diepenbroek, C. (2017). Glucose metabolism,
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationOral insulin improves metabolic parameters in high fat diet fed rats
Anais da Academia Brasileira de Ciências (2017) 89(3): 1699-1705 (Annals of the Brazilian Academy of Sciences) Printed version ISSN 0001-3765 / Online version ISSN 1678-2690 http://dx.doi.org/10.1590/0001-3765201720170040
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationRole of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.
Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4 Binding Protein neurons in the regulation of whole body energy and glucose metabolism in mice. Eulalia Coutinho Department of Physiological
More informationDETAIL EXPERIMENTAL PROCEDURES
DETAIL EXPERIMENTAL PROCEDURES Generation of knockout animals and genotyping Heterozygous PIKE -/- C57BL/6 mice with a targeted deletion of exon 3 to 6 of CENTG1 were generated under contract by Ozgene
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationExploring the link between gut microbiota and metabolic health
Food Matters Live, Nov 21-23 rd, London Exploring the link between gut microbiota and metabolic health Ellen Blaak Professor in Physiology of fat metabolism, Department of Human Biology NUTRIM School of
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationAnalysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationMethod of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice
Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER
More informationTitle: Obesity in mice with adipocyte-specific deletion of clock component Bmal1
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationInterleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella
More informationHigh-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen
More informationCopyright 2017 The Guilford Press
This is a chapter excerpt from Guilford Publications. Eating Disorders and Obesity: A Comprehensive Handbook, Third Edition. Edited by Kelly D. Brownell and B. Timothy Walsh. Copyright 2017. Purchase this
More informationThe enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose
More informationSupporting Information
Supporting Information Estall et al. 10.1073/pnas.0912533106 SI Text Generation of Liver-Specific Heterozygous PGC-1 Mice. Liverspecific heterozygous mice were generated by mating female mice with one
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationPyruvate Alanine 0.15 *** ** ***
SUPPLEMENTARY FIGURES Glucose ΔµM from fresh media / mg protein -1-2 -3 - -.1 -.3 -.5 Lactate Alanine Formate ΔµM from fresh media / mg protein 5 3 2 1.15.1.5.6..2.. NS-3 WT-NS G93A-NS Supplementary Figure
More informationInterplay between FGF21 and insulin action in the liver regulates metabolism
Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan
More informationCan physical exercise and exercise mimetics improve metabolic health in humans?
Can physical exercise and exercise mimetics improve metabolic health in humans? Patrick Schrauwen, PhD NUTRIM school for Nutrition and Translational Research in Metabolism Department of Human Biology,
More informationMetabolic responses to leptin in obese db/db mice are strain dependent
Am J Physiol Regulatory Integrative Comp Physiol 281: R115 R132, 2001. Metabolic responses to leptin in obese db/db mice are strain dependent RUTH B. S. HARRIS, TIFFANY D. MITCHELL, XIAOLANG YAN, JACOB
More informationMetabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
More informationSupplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationSustained hyperglycemia per se disrupts glucose
BRIEF REPORT Glucose Transporter-1 in the Hypothalamic Glial Cells Mediates Glucose Sensing to Regulate Glucose Production In Vivo Madhu Chari, 1,2 Clair S. Yang, 1,2 Carol K.L. Lam, 1,2 Katie Lee, 1,2
More informationOptimizing the Exercise Drug to Oppose Glucose Intolerance/T2D
University of Massachusetts Medical School escholarship@umms UMass Center for Clinical and Translational Science Research Retreat 2014 UMass Center for Clinical and Translational Science Research Retreat
More informationThe clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More information