Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
|
|
- Susanna Fletcher
- 5 years ago
- Views:
Transcription
1 Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent means ± SEM (n 8 per group). P <.1, P,.1 vs. 6. P <., P <.1, P <.1 PW vs. WS. # P <., ## P <.1, P <.1 vs. 7 weeks of age. Supplemental Fig hour food intake and energy expenditure in PW and WS mice compared to 6 mice. (A) Average daily respiratory exchange ratios (RERs, respiratory quotients). RERs of 1. reflect oxidation of carbohydrate, whereas pure utilization of fat results in RERs of.7. RERs were significantly lower in all HF-fed mice compared to their corresponding chow-fed controls, P<.1 (n=8-14 per group). () Total daily energy expenditure (n=7-14 per group). () Total daily energy expenditure adjusted independently for lean and fat mass (n=7-14 per group). Statistics were performed by an analysis of co-variance (ANOVA) including lean and fat mass as covariates, and data are shown as the adjusted least square means SEM. () aily physical activity measured as total beam breaks in the x and y-axis (n=8-14 per group). (E) Ambulatory physical activity, defined by breaks of adjacent beams. ata are shown for the x-axis, which was very similar to that for the y-axis (n=8-14 per group). (F) Fine movement or fidgeting activity, defined by repetitive breaks of the same beam. ata are shown for the x-axis, which was very similar to that for the y-axis (n=8-14 per group). (G) Rearing activity, defined as total beam breaks in the z-axis (n=7-14 per group). Metabolic analyses were performed at 19-2 weeks of age. Numbers of mice for some groups are reduced due to a sensor failure for a particular measurement. ata represent means ± SEM. P <., P <.1 vs. 6. P <., P <.1 PW vs. WS. Supplemental Fig. 3. Insulin sensitivity in chow-fed PW and WS mice relative to 6 mice. Intraperitoneal insulin tolerance tests were performed on chow-fed mice at 6 (A and ), 1 ( and ), 16 (E and F), and 26 (G and H) weeks of age (n 8 per group). lood glucose was measured using a handheld glucometer. Reverse area under the curve (AU,,, F and H) represents the total glucose clearance between and 6 minutes. It is the area between the glucose curve and baseline glucose level
2 (fractional glucose =1). ata represent means ± SEM. P <., P <.1, P <.1 vs. 6. P <., P <.1, P <.1 PW vs. WS. Supplemental Fig. 4. Increased glucose tolerance in PW and WS mice compared to 6 mice. Intraperitoneal glucose tolerance tests were performed on 4-hour fasted mice at 1 weeks of age: HF group (A and ), chow-fed controls ( and ). n=8 to 13 animals per group. Plasma glucose was measured. AU represents the total glucose clearance between and 12 minutes. It is the area between the normalized (baseline subtracted) glucose curve and the x-axis. ata represent means ± SEM. P <., P <.1, P <.1 vs. 6. P <., P <.1 PW vs. WS. Supplemental Fig.. In vivo glucose-stimulated insulin secretion in PW and WS mice compared to 6 mice. Late phase insulin secretion was measured during the 2-hour IPGTT in 1-week-old HF mice (A, ) and chow-fed controls (, ). First phase insulin secretion was measured during the - minute IPGTT in a second cohort of HF mice (E, F) and chow-fed controls (G, H). and are AU representing total second phase insulin secretion between and 12 minutes post-glucose injection. F and H are AU representing total first phase insulin secretion between 3 and 1 minutes post-glucose injection. ata represent means ± SEM. n=-13 per group. P <., P <.1, P <.1 vs. 6. P <., P <.1 PW vs. WS.
3 Fat mass (g/mouse) 1 Fat mass (g/mouse) # 2 2 Lean mass (g/mouse) 2 1 Lean mass (g/mouse) 2 1 ##
4 eam breaks (counts) A RER (VO2/VO2) hr RER 24hr Total Activity P<. P=.6 24 hr Heat (kcal/h) eam breaks (counts) 24hr Total Energy Expenditure P<.1 P=.8 E F 24hr Amublatory Activity P<. 24 hr Heat (kcal/h) eam breaks (counts) 24hr Total Energy Expenditure Adjusted for LM and FM hr Fine Movement P=.6 1 P=.68 G eam breaks (counts) 24hr Rearing Activity how 6 HF PW how PW HF WS how WS HF
5 E G weeks old 6 PW WS weeks old weeks old weeks old F H -6 min (mmol/l X min) -6 min (mmol/l X min) -6 min (mmol/l X min) -6 min (mmol/l X min)
6 Glucose (mmol/l) HF 6 PW WS Glucose AU -12 min (mmol/l X min) how Glucose (mmol/l) Glucose AU -12 min (mmol/l X min) 2 1-1
7 Insulin (ng/ml) Insulin (ng/ml) E Insulin (ng/ml) G Insulin (ng/ml) 2. 6 PW WS HF how HF how F H -12 min (ng/ml x min) -12 min (ng/ml x min) 3-1 min (ng/ml X min) 3-1 min (ng/ml X min)
An introduction to the COCVD Metabolic Phenotyping Core
An introduction to the COCVD Metabolic Phenotyping Core Capabilities and procedures Manager: Wendy S. Katz, Ph.D. University of Kentucky Medical Center Department of Pharmacology 577 Charles T. Wethington
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationFigure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationTBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationTissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
More informationPart 3:Strategies for successful aging. Avoiding disease with physical activity
Part 3:Strategies for successful aging Avoiding disease with physical activity Causes of disability and disease with aging Causes of death for old individuals Atherosclerosis (CHD) CNS-vascular accidents
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationUniversity of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationInterleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationMethod of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice
Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER
More informationMice lacking the syndecan-3 gene are resistant to diet-induced obesity
Research article Mice lacking the syndecan-3 gene are resistant to diet-induced obesity April D. Strader, 1 Ofer Reizes, 2 Stephen C. Woods, 1 Stephen C. Benoit, 1 and Randy J. Seeley 1 1 Department of
More informationDoes PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model
Does PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model Susan M. Smith Nutrition Research Institute University of North Carolina at Chapel Hill C57Bl/6J Teklad 8626 Mouse Model of PAE Our
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationFood Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationTargeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationSupplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
More informationInhibition of 11β-hydroxysteroid dehydrogenase type 1 reduces food intake and weight gain but maintains energy expenditure in diet-induced obese mice
Diabetologia (2006) 49: 1333 1337 DOI 10.1007/s00125-006-0239-y SHORT COMMUNICATION S. J. Y. Wang. S. Birtles. J. de Schoolmeester. J. Swales. G. Moody. D. Hislop. J. O Dowd. D. M. Smith. A. V. Turnbull.
More information9/17/2009. HPER 3970 Dr. Ayers. (courtesy of Dr. Cheatham)
REVIEW: General Principles II What is the RDA? Level of intake for essential nutrients determined on the basis of scientific knowledge to be adequate to meet the known nutrient needs of practically all
More informationMetformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production
activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSUPPLEMENTARY DATA. Supplementary Table S1. Clinical characteristics of the study subjects.*
Supplementary Table S1. Clinical characteristics of the study subjects.* T2D ND n (F/M) 66 (21/45) 25 (7/18) Age (years) 61.8 ± 6.9 49.4 ± 7.3 # Body weight (kg) 95 ± 16 105 ± 13 # Body mass index (kg.
More informationModule 2: Metabolic Syndrome & Sarcopenia. Lori Kennedy Inc & Beyond
Module 2: Metabolic Syndrome & Sarcopenia 1 What You Will Learn Sarcopenia Metabolic Syndrome 2 Sarcopenia Term utilized to define the loss of muscle mass and strength that occurs with aging Progressive
More informationBody Composition. Lecture Overview. Measuring of Body Composition. Powers & Howely pp Methods of measuring body composition
Body Composition Powers & Howely pp 344-356 Lecture Overview Methods of measuring body composition Two-component system Body fatness for health & fitness Obesity and weight control Diet, exercise, and
More informationSupplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and
Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationSupplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationExercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders. Cary O. Harding, MD Molecular & Medical Gene5cs
Exercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders Cary O. Harding, MD Molecular & Medical Gene5cs Acknowledgements OHSU Melanie Gillingham, PhD, RD Annie Behrend, MS, RD Autumn Fletcher,
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationKazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA
Kazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA Division of Agriscience and Bioscience, Institute of Symbiotic Science and Technology, Tokyo University of Agriculture and Technology, Fuchu 183-8509 ABSTRACT
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More informationThe Role of LCPUFA in Obesity. M.Tom Clandinin. The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada
The Role of LCPUFA in Obesity by M.Tom Clandinin The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada How big is the Conceptual Problem? Some assumptions: 150lb
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationPXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes
PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes Sébastien Bolze 1 ; Sophie Hallakou-Bozec 1 ; Michael Roden 2, 3,4 ; Julien Roux
More informationHandling data from indirect calorimetry experiments performed on the TSE system
Handling data from indirect calorimetry experiments performed on the TSE system When presenting or publishing data that you obtained using technical expertise or equipment from the COBRE Pathology Core
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationM. A. Vithayathil 1, J. R. Gugusheff 1, Z. Y. Ong 1,3, S. C. Langley-Evans 4, R. A. Gibson 1,2 and B. S. Muhlhausler 1,2,3*
Vithayathil et al. Nutrition & Metabolism (2018) 15:17 https://doi.org/10.1186/s12986-018-0253-3 RESEARCH Open Access Exposure to maternal cafeteria diets during the suckling period has greater effects
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationPROCTOR VERSION. 2.9 B: Movement of Carbon, Nitrogen, Phosphorus and Water Quiz
1. A person s blood glucose level is affected by the sugars contained in food. Blood glucose levels are controlled by the hormone insulin via a homeostatic feedback mechanism. A person eats a meal containing
More informationAltered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control
Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Jan Trost Prof. Gudrun A. Brockmann Humboldt Universität zu Berlin Department of Crop and Animal Sciences Breeding Biology and Molecular
More informationObesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
More informationNovember 12, Diet, Exercise, and General Health Now that we know about food and how it gets broken down...how can we be healthy?!?
Diet, Exercise, and General Health Now that we know about food and how it gets broken down...how can we be healthy?!? What is nutrition? http://www.brainpop.com/health/nutrition/nutrition/ Eating the proper
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationBPK 312 Nutrition for Fitness & Sport. Lecture 4 - Part 2. Measurement of Energy in Food & During Physical Activity
BPK 312 Nutrition for Fitness & Sport Lecture 4 - Part 2 Measurement of Energy in Food & During Physical Activity 1. Heat of Combustion & Energy Value of Foods 2. Measurement of Human Energy Expenditure
More informationBMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
More informationCOMPARISON OF THE METABOLIC RESPONSES OF TRAINED ARABIAN AND THOROUGHBRED HORSES DURING HIGH AND LOW INTENSITY EXERCISE
COMPARISON OF THE METABOLIC RESPONSES OF TRAINED ARABIAN AND THOROUGHBRED HORSES DURING HIGH AND LOW INTENSITY EXERCISE A. Prince, R. Geor, P. Harris, K. Hoekstra, S. Gardner, C. Hudson, J. Pagan, Kentucky
More informationNutritional Assessment of the Critically Ill Patient Terry L. Forrette, M.H.S., RRT
Nutritional Assessment of the Critically Ill Patient Sponsored by GE Healthcare Metabolic Rate How Much Fuel Does the Patient Need? Resting Energy Expenditure Basal Energy Expenditure REE or EE BEE Metabolic
More information20 CHS226: Principles of Nutrition First Midterm Exam (Students Model) Time allowed: (60 minutes) Date: /1438
King Saud University College of Applied Medical Sciences Department of Community Health Sciences 20 CHS226: Principles of Nutrition First Midterm Exam (Students Model) Time allowed: (60 minutes) Date:
More informationResveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
More informationCALORIMETRY. The science that quantifies the heat release from metabolism is termed calorimetry. Dr. Robert Robergs Fall, 2010.
Indirect Calorimetry CALORIMETRY The science that quantifies the heat release from metabolism is termed calorimetry. CALORIMETRY Direct Indirect Closed Circuit Calorimeter Respiration Chamber Open Circuit
More informationTable 5: Metabolism after Prolonged High-Intensity Intermittent or Sprint Interval Training
Table 5: Metabolism after Prolonged High-Intensity Intermittent or Sprint Interval Training 54 8 adults (sex n.r.), type 2 diabetes, 63±8 years, BMI 32±6, VO2peak n.r. HIIT: 10 x 1 min intervals at ~90%
More informationWeight Loss and Resistance Training
Weight Loss and Resistance Training Weight loss is a factor of caloric balance, or more easily stated, energy-in, versus energyout. The seemingly simplistic equation suggests that if a person consumes
More informationLESSON 3.2 WORKBOOK. What is fast and slow metabolism?
LESSON 3.2 WORKBOOK What is fast and slow metabolism? In the last lesson we saw data showing that the extent of obesity in the United States has risen dramatically, and we evaluated how obesity is measure
More informationPhysiology 12. Overview. The Gastrointestinal Tract. Germann Ch 19
Physiology 12 The Gastrointestinal Tract Germann Ch 19 Overview 1 Basic functions of the GI tract Digestion Secretion Absorption Motility Basic functions of the GI tract Digestion: : Dissolving and breaking
More informationAEROBIC METABOLISM DURING EXERCISE SYNOPSIS
SYNOPSIS This chapter begins with a description of the measurement of aerobic metabolism by direct calorimetry and spirometry and proceeds with a discussion of oxygen drift as it occurs in submaximal exercise
More informationEnergy Balance and Body Composition
Energy Balance and Body Composition THE ECONOMICS OF FEASTING THE ECONOMICS OF FEASTING Everyone knows that when people consume more energy than they expend, much of the excess is stored as body fat. Fat
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationHanifa J. Abu-Toamih Atamni 1, Richard Mott 2, Morris Soller 3 and Fuad A. Iraqi 1*
Atamni et al. BMC Genetics (2016) 17:10 DOI 10.1186/s12863-015-0321-x RESEARCH ARTICLE Open Access High-fat-diet induced development of increased fasting glucose levels and impaired response to intraperitoneal
More informationIndex. Page references in bold refer to figures and page references in italic refer to tables.
Page references in bold refer to figures and page references in italic refer to tables. Adrenaline, high-fat response in post-obese 142 Alcohol absorption 11-12 balance equation 17 and obesity 10-11 thermogenesis
More informationESPEN Congress Florence 2008
ESPEN Congress Florence 2008 PN Guidelines presentation PN Guidelines in pancreas diseases L. Gianotti (Italy) ESPEN Guidelines on Parenteral Nutrition: Pancreas L.Gianotti, R.Meier, D.N.Lobo, C.Bassi,
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationLeptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
More informationChristine Pelkman, PhD
Christine Pelkman, PhD Dr. Pelkman is a graduate faculty member in Nutrition, and Director of the Nutrition and Health Research Laboratory at the University of Buffalo. She completed her doctoral and postdoctoral
More informationESPEN Congress Madrid 2018
ESPEN Congress Madrid 2018 Dysglycaemia In Acute Patients With Nutritional Therapy Mechanisms And Consequences Of Dysglycaemia In Patients Receiving Nutritional Therapy M. León- Sanz (ES) Mechanisms and
More informationUsing the Bolus Wizard Calculator
9501179-011 Using the Bolus Wizard Calculator Objective Describe the features and benefits of the Bolus Wizard Calculator Key Points The Bolus Wizard: Estimates high blood glucose corrections using the
More informationTable S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group
Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,
More informationMfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis
Article Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Kiana Mahdaviani 1,2, Ilan Y Benador 1,2, Shi Su 1, Raffi A Gharakhanian 1, Linsey Stiles 1,2, Kyle
More informationNutritional Assessment of Patients with Respiratory Disease C H A P T E R 1 7
Nutritional Assessment of Patients with Respiratory Disease C H A P T E R 1 7 Nutritional Status Major factor influencing acute and long term outcomes Quantity and quality of food affects the efficiency
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationEnergy Balance: The tight rope between too little and too much. Melanie Gillingham PhD, RD
Energy Balance: The tight rope between too little and too much Melanie Gillingham PhD, RD Too Little Energy: Symptoms of Fatty Acid Oxidation Disorders occur during negative energy balance Hypoketotic,
More informationGrade of steatosis. group Case No. Supplementary Figure 1:
a Supplementary Figure 1: b group Case No Grade of steatosis 15m AL 2746 NN 1 15m AL 2746 BN 1 15m AL 2638 2LN 3 15m AL 2638 2RN 3 12m AL 2640 RN 0 12m AL 2640 BN 1 12m AL 2640 LN 2 12m AL 2635 NN 2 12m
More informationTable 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1
Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2
More informationWhat s their meal. Narudee Kashemsant, DVM, PhD. Fac. Vet. Med. Kasetsart University
What s their meal Narudee Kashemsant, DVM, PhD. Fac. Vet. Med. Kasetsart University Back to basis before moving on.. Digestion and absorption time Why it has to be complex carbohydrate Why it has to be
More informationEnergy, Heat, Work and Power of the Body
Energy, Heat, Work and Power of the Body Energy Energy is a property of objects which can be transferred to other objects or converted into different forms, but cannot be created or destroyed. All activities
More informationSupplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,
More informationMango Modulates Body Fat and Plasma Glucose and Lipids in Mice Fed High Fat Diet
Title of Study: Principal Investigator: Co-Investigators: Mango Modulates Body Fat and Plasma Glucose and Lipids in Mice Fed High Fat Diet Dr. Edralin A. Lucas Nutritional Sciences Department Oklahoma
More informationThe Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C
More informationThe acute effects of time-of-day-dependent high fat feeding on whole body metabolic flexibility in mice
International Journal of Obesity (16) 4, 1444 1451 16 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 37-565/16 www.nature.com/ijo OPEN ORIGINAL ARTICLE The acute effects of
More informationSUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)
SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of
More informationOrientation With Dr. Ritamarie Loscalzo. Dr. Ritamarie Loscalzo, MS, DC, CCN, DACBN, Institute of Nutritional Endocrinology (INE)
Orientation With Dr. Ritamarie Loscalzo Medical Disclaimer: The information in this presentation is not intended to replace a one-on-one relationship with a qualified health care professional and is not
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More information