glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

Size: px
Start display at page:

Download "glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged"

Transcription

1 Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian, Maureen J. Charron & Tony K.T. Lam (* PIM & JTYY are co-first authors of this manuscript) glucagon receptor AgRP merged color map a b c d I corr 1 I corr =.7±. glucagon receptor DAPI merged e f g Supplementary Figure 1. Immunohistochemical representative images of rats slices (medial region of the arcuate nucleus, adjacent to the third ventricle (3V)) stained for a: glucagon receptor (GR), b: AgRP, and c: co-localization of GR and AgRP. d: Colour map used for immunohistochemical quantification using Colocalization Colormap ImageJ software. The Icorr value from to.5 represent no to partial co-localization whereas values from.5 to 1 represent partial to total co-localization (please see Image Analysis section of our Supplementary Methods for more details). The Icorr values were an average of n= images. Immunohistochemical representative images of rat liver e: glucagon receptor (GR), f: ',-diamidino-- phenylindole (DAPI)-stained nuclei, and g: merged images of GR and DAPI-stained nuclei. Nature Medicine doi:1.13/nm.3115

2 c-fos AgRP merged a b c saline d e f color map glucagon p-creb AgRP merged g h i I corr 1 I corr =.7±. corr saline color map j k l glucagon I corr 1 I corr =.±.5 Supplementary Figure. Immunohistochemical representative images of slices from -treated (a-c, g-i) and glucagon-treated (d-f, j-l) rats. Colour maps used for immunohistochemical quantification using Colocalization Colormap ImageJ software for the glucagon-treated rats. The Icorr value from to.5 represent no to partial co-localization whereas values from.5 to 1 represent partial to total co-localization (please see Image Analysis section of our Supplementary Methods for more details). The Icorr values were an average of n= images. Immunofluorescence staining for c-fos (a, d) or phosphorylated CREB (p-creb; g, j), AgRP (middle panels), or merged images (right panels). glucagon (d) stimulated c-fos immunofluorescence compared with (a). glucagon (j) stimulated p-creb immunofluorescence compared with (g), and p-creb was co-localized with AgRP-positive neurons of the arcuate nucleus (i, l). Nature Medicine doi:1.13/nm.3115

3 a mg kg -1 min -1 ) glucose uptake ( saline glucagon glucagon mab GR-antagonist Rp-cAMPS H-9 Sp-cAMPS b g -1 min -1 ) glucose uptake (mg k WT Gcgr / / saline glucagon c glucose uptake (mg kg -1 min -1 ) saline glucagon hepatic Vx shamvx d 1 ) se uptake (mg kg -1 min iv saline iv glucagon GR-antagonist iv glucagon e glucose uptake (mg kg -1 min -1 ) gluco saline glucagon Sp-cAMPS Supplementary Figure 3. During the pancreatic clamp, glucose uptake was comparable in all groups. a: Administration of (n=), glucagon (n=5), glucagon mab (n=5), glucagon glucagon mab (n=), GR-antagonist (n=5), glucagon GR-antagonist (n=), Rp-cAMPS (n=5), glucagon Rp-cAMPS (n=5), H-9 (n=5), glucagon H-9 (n=5), Sp-cAMPS (n=), and Sp-cAMPS Rp-cAMPS (n=5). b: Glucose uptake was not affected in wild-type (WT) mice treated with saline (n=9) or glucagon (n=), or in Gcgr / (n=5) and Gcgr -/- mice (n=) treated with glucagon. c: Glucose uptake was similar in glucagon-treated rats with hepatic vagotomy (hepatic Vx, n=) or sham vagotomy (sham Vx, n=5) and in -treated rats with hepatic Vx (n=5) or sham Vx (n=). d: Glucose uptake was similar in rats given iv saline (n=), iv glucagon (n=7), GR-antagonist iv glucagon (n=7). e: HFD-treated rats treated with saline (n=), glucagon (n=), and Sp-cAMPS (n=5). Values are means SEM. Nature Medicine doi:1.13/nm.3115

4 a infusion saline Sp-cAMPS Sp-cAMPS Rp-cAMPS b glucagon glucagon GR-antagonist phosphorylated/ nonp phosphorylated A1 peptide trary intensity) (arbi P-A1 A1 1 * liver mrna levels fold-increase vs. saline) (f 1.5 GPase PEPCK saline glucagon Sp-cAMPS c ity (μcig -1 ) specific activ i.v. saline i.v. glucagon GR-antagonist i.v. glucagon d plasma glucose (mmoll -1 ) 1 i.v. saline i.v. glucagon GR-antagonist i.v. glucagon e plasma insulin n (ngml -1 ) i.v. glucagon * * i.v. glucagon injection GR-antagonist i.v. glucagon injection HFD i.v. glucagon injection Supplementary Figure. a: PKA activity. Rats were pre-treated with Rp-cAMPS or saline from t = -9 min followed by co-infusion with Sp-cAMPS from t= 9-1 min. Another group received only from t=-1 min. Relative level of phosphorylated:nonphosphorylated peptide substrate (index of PKA activity) was increased (*P <.5 vs. other groups) following Sp-cAMPS (n=5) versus Sp-cAMPS Rp-cAMPS (n=5) or (n=). tissue was obtained immediately after the clamps. b: Hepatic mrna expressions of glucose--phosphatase (GPase) and phosphoenolpyruvate carboxykinase (PEPCK) in rats that received, glucagon, or glucagon g GR-antagonist infusions were unchanged following clamp experiments (n= per group). c: Specific activity y( (μcig -1 ) and d: plasma glucose levels (mmoll -1 ) during clamp conditions (t=15-1 min) in rats that received iv glucagon or saline infusion. Specific activity and plasma glucose levels remained constant in rats that received saline iv saline infusions (n=), iv glucagon infusions (n=7), and GR-antagonist iv glucagon infusions (n=7). e: Plasma insulin levels (ngml -1 ) in rats that underwent intravenous (iv) glucagon injections at t=min. Rats which were fed with a high-fat diet (HFD, n=) had -fold elevated basal plasma insulin levels compared with regular chow-fed rats (*P <.1 vs. other groups) and a greater peak insulin response to iv glucagon injection at t=1 min than both regular chow-fed groups (*P <.5 vs. iv glucagon injec on, n=7; P <.5 vs. GR-antagonist iv glucagon injection, n=). Values are means SEM. Nature Medicine doi:1.13/nm.3115

5 Supplementary Table 1. Basal plasma glucose (mmol/l), insulin (ng/ml), and glucagon (pg/ml) levels for treatment groups during basal and clamp conditions. Basal glucose (mmol/l) insulin (ng/ml) glucagon (pg/ml). ±.3 (n=37). ±.1 (n=37).5 ± 3.9 (n=37) Clamp Saline mab GRantagonist Rp-cAMPS H-9 Sp-cAMPS Sp-cAMPS Rp-cAMPS (n= 9) (n=) (n=) (n=) (n=5) (n=5) (n=5) (n=5) glucose (mmol/l) 7.7 ±.1.5 ±. 7. ±.. ± ±. 7. ±.3 7. ± 1.3. ±.1 insulin (ng/ml).7 ±.9. ±.3.7 ±.1. ±.9. ±.1.7 ±.9.7 ±.1. ±.1 glucagon (pg/ml) 5.5 ±.9.1 ± ± ± ±. 1.3 ±.. ± ±. Nature Medicine doi:1.13/nm.3115

6 Supplementary Table. Basal plasma glucose (mmol/l), insulin (ng/ml), and glucagon (pg/ml) levels for iv glucagon infusion clamp experiments. Glucose (mmol/l) Insulin (ng/ml) (pg/ml) iv saline (n=1) (n=) GR-antagonist (n=7) 7.7 ±.. ± ±.5 7. ±.1. ± ± ±.1. ± ± 3.5 Nature Medicine doi:1.13/nm.3115

7 Supplementary Table 3. Glucose production (mg kg -1 min -1 ) and specific activity (μci/g) during basal period (-9 min) for iv glucagon infusion clamp experiments. time (min) 7 9 Glucose production iv saline (n=1) (n=) GR-antagonist (n=7) 9.9 ±. 9.5 ±. 9.5 ±. 9. ±.5 1. ± ±. 9. ±.5 9. ±.5 1. ±. 1.5 ±.5 1. ±. 1.3 ±.5 Specific activity iv saline (n=1) (n=) GR-antagonist (n=7) 5. ± ± ± ±.3 7. ±.5.7 ± ± ±.9 9. ± ± ± ± 3.7 Nature Medicine doi:1.13/nm.3115

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary

More information

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2. Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for

More information

islets scored 1 week month months

islets scored 1 week month months Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,

More information

Lipid metabolism within the duodenum increases. Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production

Lipid metabolism within the duodenum increases. Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production BRIEF REPORT Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production Danna M. Breen, 1,2 Jessica T.Y. Yue, 1,2 Brittany A. Rasmussen, 1,3 Andrea Kokorovic, 1,3 Grace W.C. Cheung,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with

More information

perk/erk STAT5B

perk/erk STAT5B pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first? 7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs. Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used

More information

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol ell Metabolism, Volume 7 Supplemental Information The Hormone Stimulates Water Drinking in Response to Ketogenic Diet and lcohol Parkyong Song, hristoph Zechner, Genaro Hernandez, José ánovas, Yang Xie,

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion

Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

PANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia

PANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia FEBS Letters 585 (2011) 1345 1349 journal homepage: www.febsletters.org PANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia Claudia E. Robert-Cooperman

More information

BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.

BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and

Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and plasma insulin levels (C) during the 48 h infusion period before the two-step hyperglycemic clamp in diabetes-prone

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

The reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability

The reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability Veterinary Physiology The reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability Rupert M. Bruckmaier 1 & Björn Kuhla 2 1 Veterinary

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia

More information

Figure S1A. Blood glucose levels in mice after glucose injection

Figure S1A. Blood glucose levels in mice after glucose injection ## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Supplemental Table I

Supplemental Table I Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin

More information

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal

More information

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis

More information

Supplementary legends

Supplementary legends Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Ghrelin mediates stressinduced. behavior in mice. Chuang et al 2011 L3: Love, Lust, Labor

Ghrelin mediates stressinduced. behavior in mice. Chuang et al 2011 L3: Love, Lust, Labor Ghrelin mediates stressinduced food-reward behavior in mice Chuang et al 2011 L3: Love, Lust, Labor Agenda Introduction What is Ghrelin? Previous Models New model Methods Results Discussion Conclusion

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Sustained hyperglycemia per se disrupts glucose

Sustained hyperglycemia per se disrupts glucose BRIEF REPORT Glucose Transporter-1 in the Hypothalamic Glial Cells Mediates Glucose Sensing to Regulate Glucose Production In Vivo Madhu Chari, 1,2 Clair S. Yang, 1,2 Carol K.L. Lam, 1,2 Katie Lee, 1,2

More information

Deficits in amygdaloid camp-responsive element binding protein signaling play a role in genetic predisposition to anxiety and alcoholism

Deficits in amygdaloid camp-responsive element binding protein signaling play a role in genetic predisposition to anxiety and alcoholism Research article Related Commentary, page 2697 Deficits in amygdaloid camp-responsive element binding protein signaling play a role in genetic predisposition to anxiety and alcoholism Subhash C. Pandey,

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Interactions between bone and the central nervous system Florent Elefteriou, PhD

Interactions between bone and the central nervous system Florent Elefteriou, PhD Interactions between bone and the central nervous system Florent Elefteriou, PhD Department of Medicine Center for Bone Biology VANDERBILT UNIVERSITY Nashville, USA BONE REMODELING Bone marrow cells Estrogen

More information

Nature Medicine: doi: /nm.3891

Nature Medicine: doi: /nm.3891 Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

c-abl PDGFRα PDGFRβ VEGFR-1 VEGFR-2 FLT-3 c-fms c-kit Ref. 2 (ND) 9.4 (ND) Supplementary Table 2. Chemical structure of the RTKIs used in this study.

c-abl PDGFRα PDGFRβ VEGFR-1 VEGFR-2 FLT-3 c-fms c-kit Ref. 2 (ND) 9.4 (ND) Supplementary Table 2. Chemical structure of the RTKIs used in this study. SUPPLEMETARY DATA Supplementary Table 1. Upper and lower entries in each cell represent IC50 (nm) values determined by a biochemical kinase assay or cellular tyrosine kinase phosphorylation, respectively.

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice. Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4 Binding Protein neurons in the regulation of whole body energy and glucose metabolism in mice. Eulalia Coutinho Department of Physiological

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Ophthalmology, Radiation Oncology,

Ophthalmology, Radiation Oncology, Supporting Online Material Journal: Nature Neuroscience Article Title: Corresponding Author: All Authors: Affiliations: Tanycytes of the Hypothalamic Median Eminence Form a Diet- Responsive Neurogenic

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior

More information

INTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK

INTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK INTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK by Grace Wing Chee Cheung A thesis submitted in conformity with the requirements for the degree of MASTER OF SCIENCE DEPARTMENT

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is

More information

Inhibition of DYRK1A stimulates human beta-cell proliferation

Inhibition of DYRK1A stimulates human beta-cell proliferation Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns

More information

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,

More information

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

The Regulation of Liver Glucose Production and Uptake

The Regulation of Liver Glucose Production and Uptake The Regulation of Liver Glucose Production and Uptake Vanderbilt University Medical Center Nashville, TN USA Dale Edgerton, PhD An Organ Systems Approach to Experimental Targeting of the Metabolic Syndrome

More information

a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *

a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * * Supplemental Figure 1 Metabolic flux with [U- C]Lactate - [ 12 C]Glutamine in primary hepatocytes a b c d e [ C 3 ]Pyruvate [ C 3 ]Malate [ C 3 ]Aspartate [ C 3 ]Citrate [ C 2 ] -Ketoglutarate f g h [

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following

More information

FGF21 Maintains Glucose Homeostasis by Mediating the Cross Talk Between Liver and Brain During Prolonged Fasting

FGF21 Maintains Glucose Homeostasis by Mediating the Cross Talk Between Liver and Brain During Prolonged Fasting 4064 Diabetes Volume 63, December 2014 Qingning Liang, 1,2 Ling Zhong, 1,2 Jialiang Zhang, 1,2 Yu Wang, 1,3 Stefan R. Bornstein, 4 Chris R. Triggle, 5 Hong Ding, 5 Karen S.L. Lam, 1,2 and Aimin Xu 1,2,3

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Diagram of BBB and brain chips.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Diagram of BBB and brain chips. Supplementary Figure 1 Diagram of BBB and brain chips. (a) Schematic of the BBB Chip demonstrates the 3 parts of the chip, Top PDMS channel, membrane and Bottom PDMS channel; (b) Image of 2 BBB Chips,

More information