glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
|
|
- Jewel Sherman
- 6 years ago
- Views:
Transcription
1 Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian, Maureen J. Charron & Tony K.T. Lam (* PIM & JTYY are co-first authors of this manuscript) glucagon receptor AgRP merged color map a b c d I corr 1 I corr =.7±. glucagon receptor DAPI merged e f g Supplementary Figure 1. Immunohistochemical representative images of rats slices (medial region of the arcuate nucleus, adjacent to the third ventricle (3V)) stained for a: glucagon receptor (GR), b: AgRP, and c: co-localization of GR and AgRP. d: Colour map used for immunohistochemical quantification using Colocalization Colormap ImageJ software. The Icorr value from to.5 represent no to partial co-localization whereas values from.5 to 1 represent partial to total co-localization (please see Image Analysis section of our Supplementary Methods for more details). The Icorr values were an average of n= images. Immunohistochemical representative images of rat liver e: glucagon receptor (GR), f: ',-diamidino-- phenylindole (DAPI)-stained nuclei, and g: merged images of GR and DAPI-stained nuclei. Nature Medicine doi:1.13/nm.3115
2 c-fos AgRP merged a b c saline d e f color map glucagon p-creb AgRP merged g h i I corr 1 I corr =.7±. corr saline color map j k l glucagon I corr 1 I corr =.±.5 Supplementary Figure. Immunohistochemical representative images of slices from -treated (a-c, g-i) and glucagon-treated (d-f, j-l) rats. Colour maps used for immunohistochemical quantification using Colocalization Colormap ImageJ software for the glucagon-treated rats. The Icorr value from to.5 represent no to partial co-localization whereas values from.5 to 1 represent partial to total co-localization (please see Image Analysis section of our Supplementary Methods for more details). The Icorr values were an average of n= images. Immunofluorescence staining for c-fos (a, d) or phosphorylated CREB (p-creb; g, j), AgRP (middle panels), or merged images (right panels). glucagon (d) stimulated c-fos immunofluorescence compared with (a). glucagon (j) stimulated p-creb immunofluorescence compared with (g), and p-creb was co-localized with AgRP-positive neurons of the arcuate nucleus (i, l). Nature Medicine doi:1.13/nm.3115
3 a mg kg -1 min -1 ) glucose uptake ( saline glucagon glucagon mab GR-antagonist Rp-cAMPS H-9 Sp-cAMPS b g -1 min -1 ) glucose uptake (mg k WT Gcgr / / saline glucagon c glucose uptake (mg kg -1 min -1 ) saline glucagon hepatic Vx shamvx d 1 ) se uptake (mg kg -1 min iv saline iv glucagon GR-antagonist iv glucagon e glucose uptake (mg kg -1 min -1 ) gluco saline glucagon Sp-cAMPS Supplementary Figure 3. During the pancreatic clamp, glucose uptake was comparable in all groups. a: Administration of (n=), glucagon (n=5), glucagon mab (n=5), glucagon glucagon mab (n=), GR-antagonist (n=5), glucagon GR-antagonist (n=), Rp-cAMPS (n=5), glucagon Rp-cAMPS (n=5), H-9 (n=5), glucagon H-9 (n=5), Sp-cAMPS (n=), and Sp-cAMPS Rp-cAMPS (n=5). b: Glucose uptake was not affected in wild-type (WT) mice treated with saline (n=9) or glucagon (n=), or in Gcgr / (n=5) and Gcgr -/- mice (n=) treated with glucagon. c: Glucose uptake was similar in glucagon-treated rats with hepatic vagotomy (hepatic Vx, n=) or sham vagotomy (sham Vx, n=5) and in -treated rats with hepatic Vx (n=5) or sham Vx (n=). d: Glucose uptake was similar in rats given iv saline (n=), iv glucagon (n=7), GR-antagonist iv glucagon (n=7). e: HFD-treated rats treated with saline (n=), glucagon (n=), and Sp-cAMPS (n=5). Values are means SEM. Nature Medicine doi:1.13/nm.3115
4 a infusion saline Sp-cAMPS Sp-cAMPS Rp-cAMPS b glucagon glucagon GR-antagonist phosphorylated/ nonp phosphorylated A1 peptide trary intensity) (arbi P-A1 A1 1 * liver mrna levels fold-increase vs. saline) (f 1.5 GPase PEPCK saline glucagon Sp-cAMPS c ity (μcig -1 ) specific activ i.v. saline i.v. glucagon GR-antagonist i.v. glucagon d plasma glucose (mmoll -1 ) 1 i.v. saline i.v. glucagon GR-antagonist i.v. glucagon e plasma insulin n (ngml -1 ) i.v. glucagon * * i.v. glucagon injection GR-antagonist i.v. glucagon injection HFD i.v. glucagon injection Supplementary Figure. a: PKA activity. Rats were pre-treated with Rp-cAMPS or saline from t = -9 min followed by co-infusion with Sp-cAMPS from t= 9-1 min. Another group received only from t=-1 min. Relative level of phosphorylated:nonphosphorylated peptide substrate (index of PKA activity) was increased (*P <.5 vs. other groups) following Sp-cAMPS (n=5) versus Sp-cAMPS Rp-cAMPS (n=5) or (n=). tissue was obtained immediately after the clamps. b: Hepatic mrna expressions of glucose--phosphatase (GPase) and phosphoenolpyruvate carboxykinase (PEPCK) in rats that received, glucagon, or glucagon g GR-antagonist infusions were unchanged following clamp experiments (n= per group). c: Specific activity y( (μcig -1 ) and d: plasma glucose levels (mmoll -1 ) during clamp conditions (t=15-1 min) in rats that received iv glucagon or saline infusion. Specific activity and plasma glucose levels remained constant in rats that received saline iv saline infusions (n=), iv glucagon infusions (n=7), and GR-antagonist iv glucagon infusions (n=7). e: Plasma insulin levels (ngml -1 ) in rats that underwent intravenous (iv) glucagon injections at t=min. Rats which were fed with a high-fat diet (HFD, n=) had -fold elevated basal plasma insulin levels compared with regular chow-fed rats (*P <.1 vs. other groups) and a greater peak insulin response to iv glucagon injection at t=1 min than both regular chow-fed groups (*P <.5 vs. iv glucagon injec on, n=7; P <.5 vs. GR-antagonist iv glucagon injection, n=). Values are means SEM. Nature Medicine doi:1.13/nm.3115
5 Supplementary Table 1. Basal plasma glucose (mmol/l), insulin (ng/ml), and glucagon (pg/ml) levels for treatment groups during basal and clamp conditions. Basal glucose (mmol/l) insulin (ng/ml) glucagon (pg/ml). ±.3 (n=37). ±.1 (n=37).5 ± 3.9 (n=37) Clamp Saline mab GRantagonist Rp-cAMPS H-9 Sp-cAMPS Sp-cAMPS Rp-cAMPS (n= 9) (n=) (n=) (n=) (n=5) (n=5) (n=5) (n=5) glucose (mmol/l) 7.7 ±.1.5 ±. 7. ±.. ± ±. 7. ±.3 7. ± 1.3. ±.1 insulin (ng/ml).7 ±.9. ±.3.7 ±.1. ±.9. ±.1.7 ±.9.7 ±.1. ±.1 glucagon (pg/ml) 5.5 ±.9.1 ± ± ± ±. 1.3 ±.. ± ±. Nature Medicine doi:1.13/nm.3115
6 Supplementary Table. Basal plasma glucose (mmol/l), insulin (ng/ml), and glucagon (pg/ml) levels for iv glucagon infusion clamp experiments. Glucose (mmol/l) Insulin (ng/ml) (pg/ml) iv saline (n=1) (n=) GR-antagonist (n=7) 7.7 ±.. ± ±.5 7. ±.1. ± ± ±.1. ± ± 3.5 Nature Medicine doi:1.13/nm.3115
7 Supplementary Table 3. Glucose production (mg kg -1 min -1 ) and specific activity (μci/g) during basal period (-9 min) for iv glucagon infusion clamp experiments. time (min) 7 9 Glucose production iv saline (n=1) (n=) GR-antagonist (n=7) 9.9 ±. 9.5 ±. 9.5 ±. 9. ±.5 1. ± ±. 9. ±.5 9. ±.5 1. ±. 1.5 ±.5 1. ±. 1.3 ±.5 Specific activity iv saline (n=1) (n=) GR-antagonist (n=7) 5. ± ± ± ±.3 7. ±.5.7 ± ± ±.9 9. ± ± ± ± 3.7 Nature Medicine doi:1.13/nm.3115
Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production
activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary
More informationResveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSupplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationLipid metabolism within the duodenum increases. Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production
BRIEF REPORT Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production Danna M. Breen, 1,2 Jessica T.Y. Yue, 1,2 Brittany A. Rasmussen, 1,3 Andrea Kokorovic, 1,3 Grace W.C. Cheung,
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More information7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?
7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland
More informationTissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
More informationSUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
More informationSupplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol
ell Metabolism, Volume 7 Supplemental Information The Hormone Stimulates Water Drinking in Response to Ketogenic Diet and lcohol Parkyong Song, hristoph Zechner, Genaro Hernandez, José ánovas, Yang Xie,
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
More informationMetformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state
Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationInterleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationPANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia
FEBS Letters 585 (2011) 1345 1349 journal homepage: www.febsletters.org PANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia Claudia E. Robert-Cooperman
More informationBMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationSupplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and
Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and plasma insulin levels (C) during the 48 h infusion period before the two-step hyperglycemic clamp in diabetes-prone
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationThe reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability
Veterinary Physiology The reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability Rupert M. Bruckmaier 1 & Björn Kuhla 2 1 Veterinary
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationDiabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationInflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis
More informationSupplementary legends
Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationGhrelin mediates stressinduced. behavior in mice. Chuang et al 2011 L3: Love, Lust, Labor
Ghrelin mediates stressinduced food-reward behavior in mice Chuang et al 2011 L3: Love, Lust, Labor Agenda Introduction What is Ghrelin? Previous Models New model Methods Results Discussion Conclusion
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSustained hyperglycemia per se disrupts glucose
BRIEF REPORT Glucose Transporter-1 in the Hypothalamic Glial Cells Mediates Glucose Sensing to Regulate Glucose Production In Vivo Madhu Chari, 1,2 Clair S. Yang, 1,2 Carol K.L. Lam, 1,2 Katie Lee, 1,2
More informationDeficits in amygdaloid camp-responsive element binding protein signaling play a role in genetic predisposition to anxiety and alcoholism
Research article Related Commentary, page 2697 Deficits in amygdaloid camp-responsive element binding protein signaling play a role in genetic predisposition to anxiety and alcoholism Subhash C. Pandey,
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationInteractions between bone and the central nervous system Florent Elefteriou, PhD
Interactions between bone and the central nervous system Florent Elefteriou, PhD Department of Medicine Center for Bone Biology VANDERBILT UNIVERSITY Nashville, USA BONE REMODELING Bone marrow cells Estrogen
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationc-abl PDGFRα PDGFRβ VEGFR-1 VEGFR-2 FLT-3 c-fms c-kit Ref. 2 (ND) 9.4 (ND) Supplementary Table 2. Chemical structure of the RTKIs used in this study.
SUPPLEMETARY DATA Supplementary Table 1. Upper and lower entries in each cell represent IC50 (nm) values determined by a biochemical kinase assay or cellular tyrosine kinase phosphorylation, respectively.
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationRole of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.
Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4 Binding Protein neurons in the regulation of whole body energy and glucose metabolism in mice. Eulalia Coutinho Department of Physiological
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationOphthalmology, Radiation Oncology,
Supporting Online Material Journal: Nature Neuroscience Article Title: Corresponding Author: All Authors: Affiliations: Tanycytes of the Hypothalamic Median Eminence Form a Diet- Responsive Neurogenic
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationSupplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior
More informationINTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK
INTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK by Grace Wing Chee Cheung A thesis submitted in conformity with the requirements for the degree of MASTER OF SCIENCE DEPARTMENT
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationa b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationAnalysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
More informationInhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on
More informationThe antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
More informationMCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity
Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,
More informationSupplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationThe Regulation of Liver Glucose Production and Uptake
The Regulation of Liver Glucose Production and Uptake Vanderbilt University Medical Center Nashville, TN USA Dale Edgerton, PhD An Organ Systems Approach to Experimental Targeting of the Metabolic Syndrome
More informationa b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *
Supplemental Figure 1 Metabolic flux with [U- C]Lactate - [ 12 C]Glutamine in primary hepatocytes a b c d e [ C 3 ]Pyruvate [ C 3 ]Malate [ C 3 ]Aspartate [ C 3 ]Citrate [ C 2 ] -Ketoglutarate f g h [
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationFGF21 Maintains Glucose Homeostasis by Mediating the Cross Talk Between Liver and Brain During Prolonged Fasting
4064 Diabetes Volume 63, December 2014 Qingning Liang, 1,2 Ling Zhong, 1,2 Jialiang Zhang, 1,2 Yu Wang, 1,3 Stefan R. Bornstein, 4 Chris R. Triggle, 5 Hong Ding, 5 Karen S.L. Lam, 1,2 and Aimin Xu 1,2,3
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Diagram of BBB and brain chips.
Supplementary Figure 1 Diagram of BBB and brain chips. (a) Schematic of the BBB Chip demonstrates the 3 parts of the chip, Top PDMS channel, membrane and Bottom PDMS channel; (b) Image of 2 BBB Chips,
More information