Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production
|
|
|
- Ambrose Perry
- 5 years ago
- Views:
Transcription
1 activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary Table 1 Diet content of the regular chow and the lard-oil enriched high fat diet. Calories provided Chow diet High fat diet Carbohydrates (%) 9 Protein (%) 33 Fat (%) 1 3 Saturated. 1.3 Monounsaturated Polyunsaturated 3.7. Total metabolizable energy provided (kcal/g) Nature Medicine: doi:1.13/nm.377
2 Supplementary Table Plasma insulin and glucose concentrations of the groups receiving duodenal infusion during the basal and clamp conditions. (N = 7) (N = ) Portal (N = 5) Basal Insulin (ng/ml) 1.1 ± ± ±. Glucose (mm) 7.9 ±..1 ± ±. Clamp Insulin (ng/ml) 1. ±.1 1. ±. 1.1 ±.1 Glucose (mm) 7.9 ±.5 7. ±. 7. ±.3 Data are mean ± SEM (Basal: -9 min; Clamp: 1- min) Nature Medicine: doi:1.13/nm.377
3 Glucose Production (mg kg-1 min-1) Glucose infusion rate Glucose infusion rate Glucose Supplementary Figure 1 a b c Portal metformin Basal Clamp A79 A79 d e f A Basal clamp A79 g h i Supplementary Figure 1 Preabsorptive metformin activates duodenal Ampk to lower HGP, independent of changes in glucose uptake. (a) HGP percent suppression from basal following duodenal or portal metformin infusion during the pancreatic clamp studies. (b,c,d,e) The glucose infusion rate (b), rate of HGP (c), HGP percent suppression from basal (d) and glucose uptake (e) during the pancreatic (basal insulin) euglycemic clamp in HFD-fed rats following 5 min intraduodenal infusion of either saline, low dose of metformin (5 mg kg -1 ), or Ampk activator A79 (3 mg kg -1 ; n =,5,5). (f,g,h,i) The glucose infusion rate (f), rate of HGP (g), HGP percent suppression from basal (h) and glucose uptake (i) during the pancreatic (basal insulin) euglycemic clamp in HFD-fed rats with intraduodenal compound C administration alone (n = 5) or in combination with metformin (n = ). Values are shown as mean ± s.e.m. P <.1, versus all other groups as calculated by ANOVA with Tukey s post hoc test. Nature Medicine: doi:1.13/nm.377
4 % Suppression of glucose pacc : tacc Duodenal mucosal Ampk activity (pmol/min) Supplementary Figure a b c d pacc * tacc e MK Exendin Rp-CAMPS f MK Exendin Rp-CAMPS Supplementary Figure A duodenal Ampk Glp1r Pka axis is necessary for metformin to lower HGP independent of changes in glucose uptake. (a) Quantitative anaylsis and representative western blot of pacc protein expression normalized to tacc in HEK 93 cells infected with either Ad- or and treated with saline or metformin for hours (P <.1, between saline within viral group; P <.1, between viral group within treatment; as calculated by one-way ANOVA with Tukey s post hoc test; n = per treatment). (b,c) HGP percent suppression from basal (b) and glucose uptake (c) for duodenal viral injected (Ad- or Ad-dn-Ampk) rats receiving duodenal infusion of saline or metformin during the clamp. (d) Ampk activity in duodenal mucosal tissue of HFD-fed duodenal viral injected (Ad- or Ad-dn-Ampk) rats following 5 minute intraduodenal infusion of metformin (*P <.5, calculated by unpaired t-test; n = 5,5). (e,f) HGP percent suppression (e) and glucose uptake (f) during the pancreatic (basal insulin) euglycemic clamp in HFD-fed rats with intraduodenal MK-39, exendin-9, and Rp-CAMPS administration alone or in combination with metformin. Values are shown as mean ± s.e.m. n = 5 rats per group. P <.1, versus saline as calculated by ANOVA with Tukey s post hoc test. Nature Medicine: doi:1.13/nm.377
5 Supplementary Figure 3 a b c Tetracaine Tetracaine Gut Gut NTS NTS MK d e f 1 sham sham HVAG Gut saline Gut metformin NTS saline NTS MK sham sham HVAG Supplementary Figure 3 A gut-brain-liver neuronal axis is required for the HGP lowering effect of metformin, independent of changes in glucose uptake. (a,b) HGP percent suppression (a) and glucose uptake (b) in HFD-fed rats infused with intraduodenal tetracaine alone or in combination with metformin. (c,d) HGP percent suppression (c) and glucose uptake (d) in HFD-fed rats with intraduodenal saline or metformin and NTS saline or MK-1. (e,f) The glucose infusion rate (e) and rate of HGP (f) in HFD-fed rats with intraduodenal metformin with either a sham surgery or hepatic vagotomy. Values are shown as mean ± s.e.m. n = 5- rats per group. P <.1, versus saline, as calculated by one-way ANOVA with Tukey s post hoc test. Nature Medicine: doi:1.13/nm.377
6 Plasma glucose (mg dl -1 ) Glucose Supplementary Figure a b 1 d d c d 15 a b c 15 a b c Chow HFD NA-STZ/HFD Chow HFD NA-STZ/HFD Supplementary Figure The effect of duodenal metformin in d HFD-induced obese and insulin resistant model and the establishment of the NA-STZ/HFD type diabetic model. (a,b) HGP percent suppression (a) and glucose uptake of HGP (b) during the pancreatic (basal insulin) euglycemic clamp in day HFD-fed rats with intraduodenal saline or metformin infusion (P <.1, versus saline as compared by unpaired t-test). (c,d) Basal plasma glucose levels (c) and basal HGP (d) in NA-STZ/HFD induced hyperglycemic rats (differing letters denotes differences of P <.5 between groups as calculated by ANOVA with Tukey s post hoc test) Values are shown as mean ± s.e.m. n = - rats per group. Nature Medicine: doi:1.13/nm.377
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
Therapy: Metformin takes a new route to clinical
Therapy: Metformin takes a new route to clinical efficacy. Marc Foretz, Benoit Viollet To cite this version: Marc Foretz, Benoit Viollet. Therapy: Metformin takes a new route to clinical efficacy.. Nature
Lactobacillus gasseri in the Upper Small Intestine Impacts an ACSL3-Dependent Fatty Acid-Sensing Pathway Regulating Whole-Body Glucose Homeostasis
Article Lactobacillus gasseri in the Upper Small Intestine Impacts an ACSL3-Dependent Fatty Acid-Sensing Pathway Regulating Whole-Body Glucose Homeostasis Graphical Abstract Authors Paige V. Bauer, Frank
Lipid metabolism within the duodenum increases. Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production
BRIEF REPORT Duodenal PKC-d and Cholecystokinin Signaling Axis Regulates Glucose Production Danna M. Breen, 1,2 Jessica T.Y. Yue, 1,2 Brittany A. Rasmussen, 1,3 Andrea Kokorovic, 1,3 Grace W.C. Cheung,
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
Intestinal cholecystokinin and leptin signaling and the regulation of glucose production
Intestinal cholecystokinin and leptin signaling and the regulation of glucose production By Brittany Anne Rasmussen A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
Nature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
INTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK
INTESTINAL CHOLECYSTOKININ CONTROLS GLUCOSE PRODUCTION THROUGH A NEURONAL NETWORK by Grace Wing Chee Cheung A thesis submitted in conformity with the requirements for the degree of MASTER OF SCIENCE DEPARTMENT
*corresponding author; Tel: 1 (403)
Supplementary Information for Manuscript: Diet-induced changes in maternal gut microbiota and metabolomic profiles influence programming of offspring obesity risk in rats Authors: Heather A. Paul, Marc
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
Diabetic silkworms for evaluation of therapeutically effective drugs
Supplementary information Diabetic silkworms for evaluation of therapeutically effective drugs against type II diabetes. Yasuhiko Matsumoto, Masaki Ishii, Yohei Hayashi, Shinya Miyazaki, Takuya Sugita,
Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and
Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and plasma insulin levels (C) during the 48 h infusion period before the two-step hyperglycemic clamp in diabetes-prone
Antisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes
Antisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes Digenio A, et al. Table of Contents Detailed Methods for Clinical
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
Successful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose
3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
Gut ghrelin regulates hepatic glucose production and insulin signaling via a gutbrain-liver
Lin et al. Cell Communication and Signaling (2019) 17:8 https://doi.org/10.1186/s12964-019-0321-y RESEARCH Open Access Gut ghrelin regulates hepatic glucose production and insulin signaling via a gutbrain-liver
Intestinal Cholecystokinin Controls Glucose Production through a Neuronal Network
Article Intestinal Cholecystokinin Controls Glucose Production through a Neuronal Network Grace W.C. Cheung, 1,2 Andrea Kokorovic, 1,2 Carol K.L. Lam, 1,2 Madhu Chari, 1,2 and Tony K.T. Lam 1,2,3, * 1
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Citation for published version (APA): Diepenbroek, C. (2017). Glucose metabolism, diet composition, and the brain
UvA-DARE (Digital Academic Repository) Glucose metabolism, diet composition, and the brain Diepenbroek, C. Link to publication Citation for published version (APA): Diepenbroek, C. (2017). Glucose metabolism,
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?
7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity
Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1
Principles of nutrition Lesson A
Principles of nutrition Lesson A Sam - ID 38359016 Unit: Applying the principles of nutrition to a physical activity programme Learning outcomes & assessment criteria Learning outcome: The learner will:
Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
Supplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
Roux-en-Y gastric bypass surgery but not vertical sleeve gastrectomy decreases bone mass in male rats
SUPPLEMENTAL DATA Roux-en-Y gastric bypass surgery but not vertical sleeve gastrectomy decreases bone mass in male rats 1 Kerstin Stemmer, 2 Maximilian Bielohuby, 3 Bernadette E. Grayson, 3 Denovan P.
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
PANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia
FEBS Letters 585 (2011) 1345 1349 journal homepage: www.febsletters.org PANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia Claudia E. Robert-Cooperman
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
Interplay between FGF21 and insulin action in the liver regulates metabolism
Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Activation of short and long chain fatty acid sensing machinery in the ileum lowers glucose production in vivo
JBC Papers in Press. Published on February 19, 1 as Manuscript M11.71 The latest version is at http://www.jbc.org/cgi/doi/1.17/jbc.m11.71 Ileal fatty acid sensing and glucose regulation Activation of short
Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
Optimizing the Exercise Drug to Oppose Glucose Intolerance/T2D
University of Massachusetts Medical School escholarship@umms UMass Center for Clinical and Translational Science Research Retreat 2014 UMass Center for Clinical and Translational Science Research Retreat
Corporate Medical Policy
Corporate Medical Policy Insulin Therapy, Chronic Intermittent Intravenous (CIIIT) File Name: Origination: Last CAP Review: Next CAP Review: Last Review: insulin_therapy_chronic_intermittent_intravenous
NUTRITIONAL QUALITY OF EGGS FROM HENS FED WITH DDGS
NUTRITIONAL QUALITY OF EGGS FROM HENS FED WITH Yan Zhang National Corn to Ethanol Research Center Southern Illinois University Edwardsville and Jill K. Winkler-Moser National Center for Agricultural Utilization
IMPAIRED REGULATION OF HEPATIC GLUCOSE DISPOSITION BY HIGH DIETARY FAT AND FRUCTOSE. Kathryn Eileen Colbert Coate. Dissertation
IMPAIRED REGULATION OF HEPATIC GLUCOSE DISPOSITION BY HIGH DIETARY FAT AND FRUCTOSE By Kathryn Eileen Colbert Coate Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates
Regulation of Metabolism
Regulation of Metabolism Pratt and Cornely Chapter 19 Regulation by Compartmentalization Form of reciprocal regulation Degradation vs biosynthesis Requires transporters 1 Specialization of organs Fuel
PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes
PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes Sébastien Bolze 1 ; Sophie Hallakou-Bozec 1 ; Michael Roden 2, 3,4 ; Julien Roux
Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
University of California, San Diego La Jolla CA 92093
AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University
Metabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *
![a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *](/thumbs/92/110334219.jpg "a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *")
Supplemental Figure 1 Metabolic flux with [U- C]Lactate - [ 12 C]Glutamine in primary hepatocytes a b c d e [ C 3 ]Pyruvate [ C 3 ]Malate [ C 3 ]Aspartate [ C 3 ]Citrate [ C 2 ] -Ketoglutarate f g h [
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through
Motility Conference Ghrelin
Motility Conference Ghrelin Emori Bizer, M.D. Division of Gastroenterology/Hepatology November 21, 2007 Ghrelin: Basics Hormone produced by the A-like A endocrine cells in the oxyntic mucosa (stomach body
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
28 Regulation of Fasting and Post-
28 Regulation of Fasting and Post- Prandial Glucose Metabolism Keywords: Type 2 Diabetes, endogenous glucose production, splanchnic glucose uptake, gluconeo-genesis, glycogenolysis, glucose effectiveness.
Effect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
A M Metabolics. inventing the future of healthcare
A M Metabolics inventing the future of healthcare Metabolic Disease Control Flavonoid-Based Amelioration of Carbohydrate Dysfunctional Metabolism December 2013 Daryl L. Thompson and M. Joseph Ahrens 2002
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids
Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Stephen B. Smith and Seong Ho Choi Texas A&M University Bradley J. Johnson Texas Tech University, Lubbock RMC 2012 June 18, 2012 Researchers
Do pigs benefit from omega-3 fatty acids?
Do pigs benefit from omega-3 fatty acids? Denise Beaulieu Assistant Professor Animal & Poultry Science Introduction What are omega-3 fatty acids? Outline Why would we consider augmenting the diet of growing
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella
Palmitic acid mediates hypothalamic insulin resistance by altering PKC-θ subcellular localization in rodents
Research article Palmitic acid mediates hypothalamic insulin resistance by altering PKC-θ subcellular localization in rodents Stephen C. Benoit, 1 Christopher J. Kemp, 1 Carol F. Elias, 2 William Abplanalp,
12/09/2013. Andy E Durham. a collection of risk factors which indicate an increased risk of coronary artery disease
Andy E Durham a collection of risk factors which indicate an increased risk of coronary artery disease 1 a collection of risk factors which indicate an increased risk of laminitis Laminitis = the equine
The Mediterranean Diet: HOW and WHY It Works So Well for T2DM
The Mediterranean Diet: HOW and WHY It Works So Well for T2DM Susan L. Barlow, RD, CDE. Objectives 1. Discuss the effects of meal size on GLP-1 concentrations. 2. Compare and contrast the specific effects
Industrialized Food Components and Obesity Risk. Kylie Kavanagh, VMS MS MPH Department of Pathology
Industrialized Food Components and Obesity Risk Kylie Kavanagh, VMS MS MPH Department of Pathology Overview Role of science in policy development Components versus calories Past lessons (trans fat) Present
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
Chapter 1, Part A: Biological background of obesity, insulin resistance and dyslipidemia
General introduction The introduction to this thesis consists of two parts. The first part gives an overview of the current concepts and developments regarding obesity and insulin resistance, as well as
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
A new obesity-prone, glucose intolerant rat strain (F.DIO)
A new obesity-prone, glucose intolerant rat strain (F.DIO) Barry E. Levin 1,2, Ambrose A. Dunn-Meynell 1,2, Julie E. McMinn 3, Michael Alperovich 3, Amy Cunningham-Bussel 3, Streamson C. Chua, Jr. 3 Neurology
Tissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
Latest Nutritional Guidelines: What s new for practice? Paul Pipe-Thomas Specialist Dietitian
+ Latest Nutritional Guidelines: What s new for practice? Paul Pipe-Thomas Specialist Dietitian + Evidence Based Guidelines Last nutritional guidelines published in 2003. New guidelines published in May
NAFLD AND TYPE 2 DIABETES
NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
Supplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
GLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK
GLP-1 agonists Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK What do GLP-1 agonists do? Physiology of postprandial glucose regulation Meal ❶ ❷ Insulin Rising plasma
Social transmission and buffering of synaptic changes after stress
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0044-6 In the format provided by the authors and unedited. Social transmission and buffering of synaptic changes after stress Toni-Lee
Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p Supplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,