Nature Biotechnology: doi: /nbt Supplementary Figure 1. Folate stability in GA9.15

Transcription

1 Supplementary Figure 1 Folate stability in GA9.15 Total folate levels in GA9.15 until 7 months of storage at 28 C. Seeds of the sixth (T5) generation (upon harvest stored at -80 C) were used to confirm the results obtained in the pilot stability experiment (Fig. 1A). Values are means of two biological repeats (and four biological repeats for month 6 and 7); error bars indicate standard deviation. Dots represent the measured values.

2 Supplementary Figure 2 Folate content in GA lines over successive generations Total folate levels in GA9.15 and GA26.5 of successive generations. Values are means of two biological repeats; error bars indicate standard deviation. Dots represent the measured values.

3 Supplementary Figure 3 Rice T-DNA vectors T-DNA vectors used for rice transformation. Orange arrows represent the different promoters.; blue arrows, hygromycin resistance gene (HPTII). Blue bars indicate transcriptional terminators. Abbreviations: LB and RB, left and right T-DNA borders; T35S, 35S transcriptional terminator; Tnos, nopaline synthase transcriptional terminator; CaMV35S, core cauliflower mosaic virus 35S promoter; HPTII, hygromycin phosphotransferase II; GluB1, rice glutelin B1 promoter; GluB4, rice glutelin B4 promoter; Glob, rice globulin promoter; GTPCHI, Arabidopsis thaliana cdna encoding GTP cyclohydrolase I (green arrow); ADCS, Arabidopsis thaliana cdna encoding aminodeoxychorismate synthase (pale brown arrow); mtfpgs, Arabidopsis thaliana coding cdna encoding mitochondrial folylpolyglutamate synthetase (FPGS) (black arrows); ctfpgs, Arabidopsis thaliana cdna encoding cytosolic FPGS (red arrows); sfbp, soluble folate binding protein (FBP) (dark brown arrows); CAFBP, fusion between coding sequence of β- carbonic anhydrase 2 from Arabidopsis thaliana and sfbp (lilac arrows); GluB4FBP, fusion between rice glutelin B4 coding sequence and sfbp (yellow arrows).

4 Supplementary Figure 4 Rice polishing experiment Total folate levels in unpolished and polished seeds of GA9.15 (T4) and two lines engineered for a higher folate content and stability (T3). Upon harvest, seeds were stored at -80 C for 3 years. Values are means of four biological repeats; error bars indicate standard deviation. Dots represent the measured values. Abbreviations: A, aminodeoxychorismate synthase; CAFBP, fusion of β-carbonic anhydrase 2 from Arabidopsis thaliana with soluble synthetic folate binding protein (sfbp); ctf, cytosolic folylpolyglutamate synthetase (FPGS); G, GTP cyclohydrolase I; mtf, mitochondrial FPGS.

5 Supplementary Figure 5 Transgene expression Expression levels of GTPCHI, ADCS, FPGS and FBP transgenes in green rice seeds of all lines in the stability experiment (T3 and T4 generation) presented in Figure 2 (except line GA-mtF-CAFBP 2, due to loss of RNA during extraction). Expression analyses were performed by real-time quantitative PCR. Rice tumor protein homologue (LOC_Os11g ) and expressed protein (LOC_OS07g ) were used as reference genes for normalization. Values are means of a sample and two technical replicates; error bars indicate standard error. Abbreviations: A, aminodeoxychorismate synthase; CAFBP, fusion of β-carbonic anhydrase 2 from Arabidopsis thaliana with soluble synthetic folate binding protein (sfbp); ctf, cytosolic folylpolyglutamate synthetase (FPGS); G, GTP cyclohydrolase I; GluB4FBP, fusion of rice glutelin B4 with sfbp; mtf, mitochondrial FPGS. Line GA-ctF-CAFBP 1 had a high expression of FBP (panel e), in combination with a high GTPCHI (panel a) and ADCS transgene expression (panel b), contributing to a high and stable folate content (Figure 2).

6 Supplementary Figure 6 Folate mono/polyglutamate content Total folate levels in lines engineered for a higher folate content and stability (T3 and T4 generation), participating in the folate stability experiment (Fig. 2). Values are means of four biological repeats; error bars indicate standard deviation. Dots represent the measured values. The folate monoglutamate fraction is represented by green bars, the polyglutamate fraction by orange bars. Lines with an enhanced folate polyglutamylation (> 20%) and a high folate content (> 500 µg per 100 g FW) are indicated in bold. Abbreviations: A, aminodeoxychorismate synthase; CAFBP, fusion of β-carbonic anhydrase 2 from Arabidopsis thaliana with soluble synthetic folate binding protein (sfbp); ctf, cytosolic folylpolyglutamate synthetase (FPGS); G, GTP cyclohydrolase I; GluB4FBP, fusion of rice glutelin B4 with sfbp; mtf, mitochondrial FPGS; WT, wild type.

7 Supplementary Figure 7 GGH and FPGS expression Expression levels of endogenous rice gamma-glutamyl hydrolase (GGH) (panel A and B), mitochondrial (mtfpgs) (panel C) and cytosolic (ctfpgs) (panel D) FPGS transgenes in seeds of the sixth (T5) generation of lines engineered for a higher folate stability through polyglutamylation. Expression analyses were performed by real-time quantitative PCR. Rice tumor protein homologue (LOC_Os11g ) and expressed protein (LOC_OS07g ) were used as reference genes for normalization. Values are means of a sample and two technical replicates; error bars indicate standard error. Abbreviations: A, aminodeoxychorismate synthase; CAFBP, fusion of β-carbonic anhydrase 2 from Arabidopsis thaliana with soluble synthetic folate binding protein (sfbp); ctf, cytosolic folylpolyglutamate synthetase (FPGS); G, GTP cyclohydrolase I; GluB4FBP, fusion of rice glutelin B4 with sfbp; mtf, mitochondrial FPGS; WT,wild type.

8 Supplementary note Folate bioavailability in the second generation of folate biofortified rice Bioavailability and biological effectiveness were proven for the first generation prototypes of folate biofortified rice in a long-term study in rats 1. Since bioavailability of folate monoglutamates is higher than that of polyglutamates which need to be deconjugated in the gut mucosa, the folate glutamylation level should be balanced (as in the wild type) or in favor of monoglutamates 2, which is the case in second generation folate biofortified rice. Two major factors will influence folate bioavailability in second generation FBP-prototypes: the matrix effect and the effect of binding with FBP. The majority of folates accumulating in engineered rice is 5-methylTHF ( 2 and this study), which is the predominant folate form naturally occurring in food. FBP-folate binding studies in a dynamic in vitro gastrointestinal model performed on fortified whey suspensions showed that after gastric passage (acidic ph), only 5% of 5-methylTHF remained bound to FBP, and that 5-methylTHF mainly occurred as free folate in the duodenal lumen 3, which is the major site of dietary folate uptake in the digestive tract. Upon higher ph conditions in the lower parts of the intestine (jejunum and ileum), folates reformed a complex with FBP, which was suggested to lower folate bioavailability. However, another study demonstrated that after gastro-intestinal passage barely 1% of FBP in 5-methylTHF fortified milk was retained, indicating that the 5-methylTHF-FBP complex is largely unstable in the intestine 4. Interestingly, UHT sterilization destroys FBP and most folates occur as free folates in UHT milk, as opposed to pasteurized milk, where FBP is only partly destroyed 4. Therefore, it can be assumed that boiling of rice will release most of the folates from FBP. Future bioavailability studies will address this hypothesis and take into account the effect of the different FBP fusions on folate binding capacities. In addition, it will be interesting to compare bioavailability of different FPGS lines, whether or not in a ggh loss-of-function mutant background. Folate biofortification versus folic acid fortification of crop products Food fortification with synthetic folic acid is currently used to combat folate deficiency. However, there is a growing concern about this practice (for a detailed review, see 5 ). Fortification with 5-methylTHF has been suggested, since it has no tolerable upper level of intake and it would not mask vitamin B12 deficiency 6. An industrial co-fortification of folate and vitamin B12 has been proposed, since both vitamins are necessary in the conversion of homocysteine to methionine 7. However, only Archaea and bacteria are capable of synthesizing vitamin B12 de novo; hence, a transgenic approach to enhance vitamin B12 content in plants would imply a complete pathway engineering. Nonetheless, fortification interventions require specialized infrastructure, which is difficult to implement in poor rural areas. Therefore, the second generation folate rice is more suitable for implementation in the battle against folate deficiency, as a complementary strategy to diet diversification.

9 References 1. Kiekens, F. et al. Mol. Nutr. Food Res. 59, (2015). 2. Storozhenko, S. et al. Nat. Biotechnol. 25, (2007). 3. Verwei, M. et al. J.Nutr. 134, (2004). 4. Verwei, M. et al. J. Nutr. 133, (2003). 5. Blancquaert, D. et al. J. Exp. Bot. 65, (2014). 6. Obeid, R. et al. J. Perinat. Med. 41, (2013). 7. Selhub, J. & Paul, L. Biofactors 37, (2011).

10 Supplementary Table Primer Sequence Primer specifications STOSER 121 ATCGGCGTCTACAGCGCAGGCATCATA Cloning of rice glutelin B4 gene STOSER 122 TGGCGTGGCCAAAAGGTTCGGATCT Cloning of rice glutelin B4 gene STOSER 123 GATCAACCAGCCCAAGTTTCCAATAA Cloning of rice glutelin B4 cdna STOSER 124 CAGAACCGCCACAAAGTTTCACATACT Cloning of rice glutelin B4 cdna STOSER 125 GCGGCCGCCAATTATTTTGGACATTATGGAGAGAACA Cloning of rice glutelin B4 gene, removal of KpnI and addition of NotI restriction sites STOSER 126 GCGGCCGCATCTAGGAATTATGTGTTGAAAGGACTT Cloning of rice glutelin B4 gene, addition of NotI restriction site STOSER 127 TTTAGTCCCGGGTGCAACGGTTTAGATGAGAACTTCT Cloning of rice glutelin B4 CDS, addition of SmaI restriction site STOSER 128 TTTAATCCCGGGGTTGTTACCCGCCAATAAGAACTCC Cloning of rice glutelin B4 CDS, addition of SmaI restriction site STOSER 129 AGTCCCGGGTGATGTACTAATGAAATAGTATAGG Removal of rice glutelin B4 CDS, addition of SmaI restriction site STOSER 130 AATCCCGGGAGCTATTTGAGGATGTTATTGGAAA Removal of rice glutelin B4 CDS, addition of SmaI restriction site STOSER 131 GATATCATGGGAAACGAATCATATGAAGACGCCAT Cloning of Arabidopsis thaliana β- carbonic anhydrase 2 CDS, addition of EcoRV restriction site STOSER 132 GATATCTCATATAGAATGAACGGGGGAAATT Cloning of Arabidopsis thaliana β- carbonic anhydrase 2 CDS, addition of EcoRV restriction site CA beta 2 1 forward CCTGCTTCAGCCACTTCAAACTTGA Cloning of Arabidopsis thaliana β- carbonic anhydrase 2 cdna CA beta 2 1 reversed GGTAGCGATGGTGATGGTGATGTGT Cloning of Arabidopsis thaliana β- carbonic anhydrase 2 cdna mtfpgs forward gateway AAAAAGCAGGCTCCCTGATGCTCGTTTGTGGGAAAG Cloning of Arabidopsis thaliana mtfpgs CDS, addition of partial attb sites mtfpgs reversed gateway AGAAAGCTGGGTTCATCTCTTTAGCAACCTGA Cloning of Arabidopsis thaliana mtfpgs CDS, addition of partial attb sites ctfpgs forward gateway AAAAAGCAGGCTATCCTATGGCAACTGAAGACGATGGTGAA Cloning of Arabidopsis thaliana ctfpgs CDS, addition of partial attb sites ctfpgs reversed gateway AGAAAGCTGGGTTCATTTCTTGATAAATCTCA Cloning of Arabidopsis thaliana ctfpgs CDS, addition of partial attb sites attb1 GGGGACAAGTTTGTACAAAAAAGCAGGCT attb1 site for GATEWAY cloning attb2 GGGGACCACTTTGTACAAGAAAGCTGGGT attb2 site for GATEWAY cloning STOSER 154 ATTATCACCTGAAGTTGAC expression analysis GTPCHI STOSER 155 GTGTAGCAATGAGTTCTT expression analysis GTPCHI STOSER 156 TGATTGTTGACCTTCTAA expression analysis ADCS STOSER 157 ACTGTTGTGTATGATTCT expression analysis ADCS STOSER 162 TACATCAAGAACCTCTCC expression analysis rice tumor protein homologue (LOC_Os11g ), reference gene STOSER 163 ACCAACAAAGAACTGAAG expression analysis rice tumor protein homologue (LOC_Os11g ), reference gene STOSER 164 GAACATGGAGAAGAACAA expression analysis expressed protein (LOC_Os07g ), reference gene STOSER 165 CATATCTTGCACTGGATG expression analysis expressed protein (LOC_Os07g ), reference gene STOSER 180 AATGAAATCTGGTCTCACTCT expression analysis FBP STOSER 181 CGAACCACATCTGAATGC expression analysis FBP mtfpgs 3 F GGTCACTTCCAGTGCCGTAA expression analysis mtfpgs mtfpgs 3 R AGCAACCTGAGCACATCTCC expression analysis mtfpgs ctfpgs 2 F ACATTTGCGGAGTCTATTCTTCGTTG expression analysis ctfpgs ctfpgs 2 R TCAACAGCCACAGGAAGTGACGAGAA expression analysis ctfpgs GGH F CAGGGATTCCATTTCCACTTT expression analysis GGH (LOC_Os05g ) GGH R GTGGCACTGAATGACTCCAAGATA expression analysis GGH (LOC_Os05g ) Supplementary Table 1: List of primers used for cloning and for expression analysis by real-time quantitative PCR.