MOLECULAR MEDICINE REPORTS 13: , 2016

Transcription

1 MOLECULAR MEDICINE REPORTS 13: , 2016 Evlution of the dynmic pttern of virl evolution in ptients with virologicl brekthrough during tretment with nucleoside/nucleotide nlogs by ultr deep pyrosequencing SHAOLONG CHEN 1*, JING WU 1*, ERLI GU 1,2*, YAOJIE SHEN 3, FEIFEI WANG 1,4 nd WENHONG ZHANG 1,3 1 Deprtment of Infectious Diseses, Hushn Hospitl; 2 Division of Gstroenterology nd Heptology, Jing'n District Centrl Hospitl, Jing'n Brnch of Hushn Hospitl, Fudn University, Shnghi ; 3 Institute of Biomedicl Sciences, Fudn University; 4 Key Lbortory of Medicl Moleculr Virology, Deprtment of Medicl Microbiology nd Prsitology, Shnghi Medicl College, Fudn University, Shnghi , P.R. Chin Received December 15, 2014; Accepted September 14, 2015 DOI: /mmr Abstrct. Virologicl brekthrough is clinicl mnifesttion in ptients infected with chronic heptitis B (CHB), who undergo tretment with nucleoside/nucleotide nlogs (NUCs). The current understnding of the underlying mechnism of virologicl brekthrough is limited. Ultr deep pyrosequencing (UDPS) is novel nd powerful tool used to investigte minor virl vrints nd virl evolution. The present study used UDPS to investigte the virl evolution pttern during virologicl brekthrough in ptients with CHB treted with NUCs. A totl of 12 ptients who experienced virologicl brekthrough were recruited in the present study. During the tretment with lmivudine, defovir ws dded s rescue therpy when virologicl brekthrough emerged, nd the therpy ws continued until week 96. Serum smples from ech ptient were collected t different time points for UDPS nlysis. Tretment with lmivudine resulted in n incresed rte of the virl muttions, rtm204v/i, rtl180m nd rtl80i. Virologicl brekthrough ws ccompnied by significnt rtm204i/v substitutions in eight of the ptients. A totl of three types of rt204 muttion, ssocited with virologicl brekthrough, were observed, including YIDD vrint dominted, YVDD vrint dominted nd YMDD wild type dominted virologicl brekthrough. YVDD vrints reverted to the wild type following the defovir dd on rescue therpy, lthough the YIDD vrints remined dominnt following the Correspondence to: Dr Wenhong Zhng, Deprtment of Infectious Diseses, Hushn Hospitl, Fudn University, 12 Wulumuqi Rod, Shnghi , P.R. Chin E mil: zhngwenhong@fudn.edu.cn * Contributed eqully Key words: heptitis B, ultr deep pyrosequencing, virologicl brekthrough, lmivudine, defovir combintion therpy. The mechnism underlying virologicl brekthrough ws reveled to be complex nd ssocited with the rpid repliction of mutted vrints. UDPS nlysis, therefore, provided useful tool to investigte the dynmic evolution pttern of heptitis B virus. Introduction Chronic heptitis B (CHB) is mjor globl helth problem, with ~350 million individuls ffected worldwide. Infection with the heptitis B virus (HBV) is mjor cuse of the development of cirrhosis, decompensted liver disese nd heptocellulr crcinom (1). Therefore, therpies which effectively inhibit HBV repliction nd prevent the progression of HBV ssocited liver diseses re urgently required (2,3). Nucleoside/nucleotide nlogs (NUCs) provide one of the currently vilble therpies for the mngement of CHB, including lmivudine (LAM), defovir (ADV), telbivudine, entecvir (ETV) nd tenofovir (TDF) (4). NUCs re widely used for treting CHB due to number of dvntges, including the ese of orl dministrtion, good tolernce nd rpid virl suppression; however, long term therpies with NUCs, prticulrly erly pproved NUCs, results in the emergence of virl muttions, which re responsible for virologicl, nd subsequently, biochemicl brekthrough, followed by worsening of the liver disese (5). Virologicl brekthrough is the first mnifesttion of the disese, predominntly cused by resistnce in ptients treted with NUCs (6). Therefore, developing further understnding of the underlying mechnism of virologicl brekthrough during tretment with NUCs my hold promise for the development of optiml strtegies for NUC therpies, nd the mngement of drug resistnce. Currently, techniques which re vilble to investigte muttions in HBV re limited. Among them, Snger sequencing is widely used for nlyzing DNA sequences, lthough its usefulness is limited by its low sensitivity nd the long durtion required, in ddition to n inbility to perform hplotype nlysis, which renders the method unsuited for investigting the mechnism tht underlies the evolution of HBV qusispecies during

2 652 CHEN et l: VIROLOGICAL BREAKTHROUGH AND ULTRA-DEEP PYROSEQUENCING tretment with NUCs (7). However, technologicl dvnces re improving the sitution, including the development of next genertion sequencing techniques, which re cpble of detecting minor nd longitudinl drug ssocited muttions (8). Ultr deep pyrosequencing (UDPS) is bsed on the 454 sequencing technology, nd it is useful for detecting thousnds of clonlly mplified sequences. UDPS hs previously been pplied to the investigtion of HIV (9,10) nd heptitis C virus (HCV) (11 13), nd noteworthy results were generted in these erly studies. However, the dt which hve been obtined from the ppliction of UDPS to HBV re limited, prticulrly regrding longitudinl studies of the dynmic pttern of virl evolution during ntivirl therpy. In the present study, the underlying mechnism of virologicl brekthrough in ptients with CHB receiving NUCs ws investigted using UDPS in the reverse trnscriptse (RT) region of HBV, nd the dynmic virl evolution pttern during virologicl brekthrough ws further investigted. Mterils nd methods Enrollment of the ptients nd the study design. Ptients with CHB, together with compensted cirrhosis, were selected from prospective study, bsed on tretment regimen over 96 week period, which comprised combintion therpy with LAM nd ADV (14). Briefly, the ptients were treted with LAM monotherpy for the first 24 weeks. At week 24, decision ws tken to switch to combintion therpy or to continue with the monotherpy, ccording to the response of the ptient to the tretment. Combintion therpy ws performed for ll ptients strting from week 48, nd the tretment ended t week 96. For ech ptient, mesurements of the DNA level of HBV were serilly recorded t weeks 0, 12, 24, 36, 48, 72 nd 96. Plsm smples were collected t weeks 0, 24, 36, 48 nd 96, nd were subsequently stored t 80 C prior to the UDPS nlysis. A prtil virologicl response ws defined s decrese in the level of HBV DNA of >1 log 10 IU/ml, but with detectble levels of HBV DNA remining following 6 months of therpy in complint ptients (15). Virologicl brekthrough ws defined s n increse of >1 log 10 IU/ml in the level of the HBV DNA from ndir during the tretment (15). To investigte the mechnism underlying the virologicl brekthrough, ptients were enrolled in the present study who experienced virl brekthrough nd were receiving ADV dd on s rescue therpy. The present study (ref. no ) ws pproved by the ethics committee of Jing'n District Centrl Hospitl (Shnghi, Chin). Polymerse chin rection (PCR) mplifiction nd 454 sequencing. The DNA from serum smples ws extrcted using Qigen DNesy Blood & Tissue kit (Qigen, Inc., Vlenci, CA, USA), ccording to previously published procedure (16). Briefly, the DNA ws isolted nd purified through spin column, ccording to the mnufcturer's instructions. The DNA ws initilly dsorbed onto the silic of the column, followed by severl wshes with wsh buffer, contining 70% ethnol. The DNA ws subsequently eluted from the column, prior to the PCR mplifiction of the RT region for the identifiction of muttions by 454 sequencing. The RT region sequence ws divided into three overlpping frgments for PCR mplifiction. The templte specific sequences of the primer pirs used in the present study re listed in Tble I. The full forwrd primers consisted of directionl GS FLX Titnium Primer A sequence (synthesized by Sngon Biotech Co., Ltd., Shnghi, Chin). A 10 bse pir brcode sequence upstrem of the templte specific forwrd sequence ws used for the identifiction of the smples. The reverse primers consisted of GS FLX Titnium Primer B sequence brcode, in ddition to the templte specific reverse sequence. The PCR cycling conditions were 94 C for 5 min, followed by 30 cycles of denturtion t 94 C for 30 sec, nneling t 63 C for 30 sec nd extension t 72 C for 40 sec, using the Ex Tq DNA polymerse (Tkr Bio, Inc., Dlin, Chin). The frgments were purified using MinElute gel extrction kit (Qigen, Inc.). The DNA concentrtion in the purified PCR products ws mesured using PicoGreen quntifiction ssy, ccording to the mnufcturer's instructions (Invitrogen Life Technologies, Crlsbd, CA, USA). The brcoded smples were pooled with the identicl quntity of DNA from ech smple, nd the pooled PCR products were subjected to stndrd 454 DNA sequencing, ccording to the mnufcturer's instructions (GS FLX system; 454 Life Sciences, Brnford, CT, USA). Dt nd sttisticl nlysis. The 454 generted FASTA (.fn) nd qulity score (.qul) files were obtined s rw sequence dt. The multiplexed reds were split nd ssigned to smples on the bsis of their unique nucleotide brcode. The sequences were screened, trimmed nd filtered using progrms written by Encode Genomics (Suzhou, Chin), nd the qulified sequence frgments were subsequently used for Bsic Locl Alignment Serch Tool (BLAST) nlysis to identify the muttions, by compring with the sequence of the HBV RT region s the reference from the Ntionl Center for Biotechnology Informtion dtbse ( nih.gov). The perl script for formtting the dt for BLAST nlysis ws designed in house. Sequences which were too short (<50 bp) nd sequences with low qulity score were removed. After hving clculted tht the muttion rte for the clen dt ws <1, cut off of 1% ws used to differentite n uthentic vrint from possible rtificil error, therefore, only muttion rte >1 ws considered to indicte the rel existence of the muttion in the RT region (17). All dt were nlyzed using the SPSS 19.0 sttisticl softwre pckge (IBM SPSS, Chicgo, IL, USA), nd ll continuous vribles re expressed s the medin (rnge). All P vlues were two sided nd P<0.05 ws considered to indicte sttisticlly significnt difference. Results Bseline chrcteristics of the ptients. A totl of 12 ptients (ptients A L) with CHB were enrolled in the present study. The ptients were initilly treted with LAM monotherpy, nd ADV ws dded to the regimen s rescue therpy once the ptients experienced virologicl brekthrough (with the exception of ptient C, who received ADV prior to the virologicl brekthrough due to only prtil response to LAM). The combintion therpy lsted until week 96. The bseline chrcteristics of the ptients enrolled in this study re summrized in Tble II. A totl of 10/12 ptients were HBeAg positive prior to

3 MOLECULAR MEDICINE REPORTS 13: , Tble I. Oligonucleotide primers used for polymerse chin rection mplifiction nd deep sequencing of HBV reverse trnscriptse genes. Primer HBV F1 HBV R1 HBV F2 HBV R2 HBV F3 HBV R3 Sequence 5' CTGCTGGTGGCTCCAGTT 3' 5' GCAGGTCTTGCATGGTCCCGT 3' 5' ATGTTGCCCGTTTGTCCTC 3' 5' CCCAACTTCCAATTACATA 3' 5' TAATAAAACCAAACGTTGGGGC 3' 5' AGGAGTTCCGCAGTATGGAT 3' HBV, heptitis B virus; F, forwrd; R, reverse. the tretment. Among these ptients, only ptient K experienced HBeAg seroconversion during the tretment with LAM. The men ge of the 12 ptients ws 47±10.03 yers, nd the men bseline levels of lnine trnsminse nd sprtte trnsminse levels were 67.31±30.83 nd 49.87±16.79 IU/L respectively. Muttion of the HBV RT region detected by UDPS t different time points during the tretment. UDPS ws performed to investigte the emergence of ny drug resistnce ssocited muttions in the 12 ptients t weeks 0, 24, 36, 48 nd 96 during the therpy, representing totl of 54 seril smples (six of the serum smples were too low to perform UDPS ssy). A totl of ~345,025 sequences were generted, with 6,389±916 sequences per smple nd men length of 380±117 nucleotides, following the elimintion of unqulified nd excessively short sequences (<50 bp). The whole RT region ws evluted for ech ptient, nd the rtes of the muttion sites for the 12 ptients t the different time points re summrized in Tble III. Although ll 12 ptients experienced virl brekthrough during the tretment with LAM, low rtes of drug resistnce ssocited muttions were observed t week 0 prior to the tretment, with the exception of ptient D, who exhibited rte of for M204I, nd ptient G, who exhibited rte of for A181V. Upon the initition of the LAM monotherpy, which ws ccompnied by decrese in the DNA level of HBV, the HBV DNA evolved on n individul bsis, lthough severl common chrcteristics were observed. The muttion rtes of LAM resistnce ssocited sites, including rt204, rt180 nd rt80, slowly incresed following the initition of the LAM monotherpy, nd the combintion therpy resulted in n increse in the muttion rtes t ADV resistnce ssocited sites, including rt181 nd rt236 (Tble III). Notbly, the muttion rte of rtm204i/v ws mrkedly incresed t the time of virologicl brekthrough in eight ptients, nd this ws ccompnied by n incresed muttion rte of rtl180m nd/or rtl80i/v. In ddition, different HBV evolution profiles were observed during the ADV dd on therpy. Ptterns of virl evolution in the ptients with LAM induced virologicl brekthrough. Since the bove results suggested tht the mrked muttion rte observed t the rt204 site ws the predominnt cuse of the virologicl brekthrough, the 12 ptients were further divided into three groups on the bsis of the type of rt204 muttion. Notbly, common chrcteristics were observed in the three types of rt204 muttion ssocited virologicl brekthrough. YIDD motif vrint dominted virologicl brekthrough. Virologicl brekthrough in ptients A, B, C nd D ws dominted by the YIDD motif vrint, since their virologicl brekthrough ws cused by mrkedly incresed muttion rte of M204I during the LAM tretment. As shown in Fig. 1, the chrcteristics in common of these four ptients were tht the virl brekthrough ws cused by the high rte of M204I muttion during the tretment with LAM, nd tht the domintion of the M204I muttion continued following the ADV dd on therpy. Furthermore, the incresed muttion rte of rt180 or rt80 ws ccompnied by the occurrence of the high muttion rte of M204I during the virologicl brekthrough (Fig. 1 nd Tble III). YVDD motif vrint dominted virologicl brekthrough. This group included ptients E, F, G nd H, nd their virl brekthroughs were predominntly cused by the YVDD motif vrint. As shown in Fig. 2, the M204V muttion in ptients E nd F eventully disppered following the ADV dd on therpy, which lso occurred in the other two ptients. In ll four ptients, the M204V muttion ws ccompnied by the L180M muttion, nd n identicl trend ws observed in the two muttion sites (Tble III). YMDD wild type dominted virologicl brekthrough. YMDD wild type dominted virologicl brekthrough ws identified in ptients H, I, J nd K. This type of virologicl brekthrough ws observed in the ptients lcking ny muttion of the YMDD motif (Fig. 3). The level of HBV DNA in these four ptients declined following the ADV dd on therpy. The YMDD wild type motif persisted during the tretment with LAM monotherpy or the LAM + ADV combintion therpy. Discussion Virologicl brekthrough is clinicl mnifesttion in the tretment of CHB, which is defined s n increse of 1 log 10 IU/ml compred with ndir during tretment in ptients with good dherence (15). Virologicl brekthrough during the tretment of CHB ws predominntly cused by drug resistnce, lthough its underlying mechnism remins to be fully elucidted (18,19). The muttion rte identified for the recently pproved NUCs, including ETV nd TDF, is very low. ETV nd TDF ccounted for 1.5 nd 0 of the identified drug resistnce rte, respectively, in ptients who hd received 5 yers of tretment (15). However, the sitution is less optimistic s fr s the erly pproved NUCs is concerned, including LAM, which continues to be widely used in developing countries (20). It ws reported tht LAM, with low genetic brrier to resistnce, resulted in drug resistnt muttions in 70% of the ptients following 5 yers of tretment (15). The risk of drug resistnce is ssocited with high bseline levels of HBV DNA, the dministrtion of low genetic brrier drug nd grdul decrese in the level of HBV DNA during tretment, which cretes n environment

4 654 CHEN et l: VIROLOGICAL BREAKTHROUGH AND ULTRA-DEEP PYROSEQUENCING Tble II. Bseline chrcteristics of the 12 ptients enrolled in the present study. HBV HBV DNA level Ptient no. Age (yer) Gender e ntigen sttus (log 10 IU/ml) ALT (IU/L) HBsAg (IU/ml) A 48 M , B 36 M C 48 F , D 60 F E 55 M , F 43 M , G 43 M , H 59 M , I 30 M , J 61 F , K 39 M L 42 F HBV, heptitis B virus; ALT, lnine trnsminse; M, mle; F, femle. Figure 1. YIDD motif vrint dominted virl brekthrough in 4/12 ptients in the present study. The virologicl brekthrough ws observed in ptients A, B, C nd D, lthough this figure only illustrtes the dynmic evolution pttern of rt204 nd the HBV DNA level in ptients A nd B. The bsolute quntity of HBV DNA during the virologicl brekthrough ws dominted by the YIDD motif vrint, which remined stble following combintion therpy. ADV, defovir; LAM, lmivudine; HBV, heptitis B virus.

5 MOLECULAR MEDICINE REPORTS 13: , Tble III. Muttion rtes detected using ultr deep pyrosequencing nlysis in the 12 ptients t different time points during the tretment. Muttion rtes (%) t vrious weeks post therpy Ptient Muttion site Ptient A L180M * * * * * A181T * * M204I 2.52 * M204V * * * * * N236T * * * * * M250I * * * * 1.54 L80I * * Ptient B L180M * A181S * * * * A181T A181V * * * * M204I M204V * N236T * * * * M250I * * M250L * * * * L80I * * L80V * * * * Ptient C L180M * 9.26 * 1.31 A181S * 1.23 * * A181T * 2.77 * 5.97 A181V * * * * M204I * M204V * * * * N236T * 5.41 * * M250I * * * 2.04 M250L * * * * L80I * * L80V * * * * Ptient D L180M A181T M204I M204V * * * * * N236T * * * * * M250I L80I * L80V * Ptient E L180M * * A181T * A181V 6.19 * * * *

6 656 CHEN et l: VIROLOGICAL BREAKTHROUGH AND ULTRA-DEEP PYROSEQUENCING Tble III. Continued. Muttion rtes (%) t vrious weeks post therpy Ptient Muttion site M204I * * 5.70 M204V * * * N236T * * 8.76 M250I * * * 4.73 * L80I * * * * * Ptient F L180M * * A181T * * * M204I 1.71 * M204V * * * 1.16 N236T * * * 4.47 * M250I * * * * * L80I * * L80V * * 8.15 * * Ptient G L180M * A181T * * * * 7.63 A181V M204I * * * * * M204V * N236T * * * * 7.57 M250I * * * * * L80I * * * * * Ptient H L180M * A181T * * * * * M204I 2.55 * M204V * N236T * * * * * M250I * * * * * M250L * * * * 1.46 L80I * * L80V * * Ptient I L180M * * * * * A181S * * * * 2.01 A181T * 8.93 A181V * M204I * 1.56 M204V * * 1.04 * * N236T M250I * * *

7 MOLECULAR MEDICINE REPORTS 13: , Tble III. Continued. Muttion rtes (%) t vrious weeks post therpy Ptient Muttion site L80I * * * * * Ptient J L180M * * * * * A181S * 2.10 * * * A181T * 1.87 * * * M204I * * * * * M204V * * * * * N236T * * * * * M250I * * * * * L80I * * * * * Ptient K L180M * * * A181S * * * A181T * * * A181V * * * M204I * * * M204V * * * N236T * * * M250I * * * M250L * * * L80I * * * L80V * * * Ptient L L180M * * * * * A181T * * * M204I * 1.33 * M204V * 1.30 * * * N236T * * * M250I * * * * * L80I * * * * 3.35 * The muttion ws not detected, or the muttion rte ws below the threshold of 1. The serum smple ws not vilble t the indicted time point. Ptient informtion regrding the point t which virl brekthrough ws first identified nd when ADV ws dministered ws s follows: A, Virl brekthrough ws identified t week 36 nd ADV ws dded t week 48; B, virl brekthrough ws identified t week 36 nd ADV ws dded t week 36; C, virl brekthrough ws identified t week 36 nd ADV ws dded t week 24 due to only prtil response; D, virl brekthrough ws identified t week 36 nd ADV ws dded t week 36; E, virl brekthrough ws identified t week 36 nd ADV ws dded t week 36; F, virl brekthrough ws identified t week 36 nd ADV ws dded t week 36; G, virl brekthrough ws identified t week 24 nd ADV ws dded t week 24; H, virl brekthrough ws identified t week 36 nd AVD ws dded t week 48; I, virl brekthrough ws identified t week 48 nd ADV ws dded t week 48; J, virl brekthrough ws identified t week 36 nd ADV ws dded t week 36; K, virl brekthrough ws identified t week 48 nd ADV ws dded t week 48; L, virl brekthrough ws identified t week 24 nd ADV ws dded t week 48. ADV, defovir. in which virl evolution my occur (21). However, the extent of muttion which is required to give rise to virologicl brekthrough nd the predominnt dynmic pttern of virl evolution during virologicl brekthrough remin to be fully elucidted, lrgely s consequence of the limittions of the current technology for detecting drug resistnce.

8 658 CHEN et l: VIROLOGICAL BREAKTHROUGH AND ULTRA-DEEP PYROSEQUENCING Figure 2. YVDD motif vrint dominted virl brekthrough in 4/12 ptients in the present study. Ptients E, F, G nd H exhibited this type of virl brekthrough, lthough this figure only illustrtes the dt for ptients E nd F. The virologicl brekthrough ws predominntly cused by the YVDD motif vrint, which reverted to the wild type following combintion therpy. ADV, defovir; LAM, lmivudine; HBV, heptitis B virus. Previous studies focused on using UDPS to revel the underlying mechnisms ssocited with HCV nd HIV. An incresing number of studies re recruiting UDPS to detect minor muttions in HBV, nd these studies hve demonstrted tht UDPS is more sensitive s technique for detecting minor muttions compred with previous technologies (22,23). Notbly, longitudinl studies focused on the dynmic evolution of the HBV DNA during tretment re limited, which my offer further insights into the mechnism underlying drug ssocited resistnce. UDPS ws used previously to investigte the dynmic evolution pttern of HBV vrints in ptients with CHB who developed resistnce to ADV, nd the virl lods were identified to consist of different types of HBV vrints; furthermore, the bsolute levels of these vrints vried during the tretment with ADV (24). In the present study, it ws demonstrted tht the YMDD wild type motif of HBV ws lmost entirely replced by the LAM resistnt vrints in eight ptients following virl brekthrough, indicting tht virologicl brekthrough ws cused by the rpid repliction of novel resistnt vrints. The present study lso reveled tht the NUC ssocited muttions existed in tretment nive ptients, for exmple, ptient D, who exhibited high muttion rte of M204I t the bseline. In the present study, the LAM induced virologicl brekthrough ws further subdivided into three types, ccording to which vrint dominted during virl brekthrough, nd common chrcteristics were identified mong the three types. The findings of the present study provided novel insights into the mechnism underlying the drug resistnce nd the virologicl brekthrough, however, this study lso gives rise to further questions. Firstly, it ws identified tht the implementtion of ADV dd on therpy resulted in n eventul reversion of the YVDD vrint into wild type YMDD, lthough the YIDD vrint remined dominnt. It is n open question whether ptients who experienced YVDD vrint dominted virl brekthrough benefitted more from ADV dd on therpy compred with those who experienced the YIDD vrint dominted virl brekthrough. Secondly, previous study reveled tht ~40% of the virologicl

9 MOLECULAR MEDICINE REPORTS 13: , Figure 3. YMDD wild type dominted virl brekthrough in 4/12 ptients fetured in the present study. Virologicl brekthrough ws cused by the YMDD wild type motif in ptients I, J, K nd L, lthough only ptients I nd J re illustrted in the figure. ADV, defovir; LAM, lmivudine; HBV, heptitis B virus. brekthroughs in ptients receiving NUCs were not ssocited with drug resistnce during clinicl prctice, which the uthors of the study suggested ws cused by mediction dherence (25). However, the dherence profile of the ptients in the present study ws exmined during the tretment, nd virologicl brekthrough ws reveled to be cused by YMDD wild type dominted vrints. Therefore, LAM resistnce ssocited muttion sites remin to be identified, nd the mechnism underlying the phenomenon remins to be elucidted. Thirdly, it ws reveled tht the muttion sites, rt80 nd rt180, were ble to compenste for rt204 in ptients who developed LAM resistnce (26), result which ws further confirmed in the present study. Additionlly, the present study reveled tht YVDD vrint dominted virologicl brekthrough ws closely ssocited with the L180M muttion, nd n identicl trend in the chnges of the M204V nd L180M muttions ws observed, which rised the question of the specific mechnism of rt204 nd its supplementry sites. Tken together, the present study provided novel insights into the mechnism underlying virologicl brekthrough nd the evolution pttern of HBV DNA during ntivirl therpy. However, the present study ws limited by the smll number of enrolled ptients, nd therefore lrger cohort study in the future will be useful to substntite these results. In 2007, the rodmp concept ws recommended for the tretment of ptients with CHB, which entiled using erly virologicl responses to optimize long term outcomes for ptients with CHB (27). Previous studies demonstrted tht ptients my benefit more from tretment strtegies with NUCs which re guided by the rodmp concept (28 30). Notbly, the present study reveled tht virologicl brekthrough my be cused by the rpid repliction of the drug resistnt vrints selected by the tretment with NUCs, including YIDD nd YVDD vrint dominted virl brekthroughs. Therefore, more frequent nd erlier monitoring of the level of the HBV DNA level nd the virl muttion rte re urgently required in ptients who experience suboptiml tretment responses during the tretment with NUCs. Tken together, the results from the present study my ssist in improving current understnding of HBV evolution during NUC tretment nd contribute to the development of novel tretment strtegies.

10 660 CHEN et l: VIROLOGICAL BREAKTHROUGH AND ULTRA-DEEP PYROSEQUENCING Acknowledgements The present study ws prtly supported by the Key Medicl Specilties Found of Shnghi Municipl Helth Bureu (no. 05II ). The uthors would like to thnk Dr Kegung Chen (Deprtment of Otorhinolryngology Hed nd Neck Surgery, Eye nd ENT Hospitl, Fudn University (Shnghi, Chin) for editing the figures in this pper. References 1. Lvnchy D: Heptitis B virus epidemiology, disese burden, tretment nd current nd emerging prevention nd control mesures. J Virl Hept 11: , Trépo C, Chn HL nd Lok A: Heptitis B virus infection. Lncet 384: , Tujios SR nd Lee WM: Updte in the mngement of chronic heptitis B. Curr Opin Gstroenterol 29: , M H nd Ji J: Why do I tret HBeAg positive chronic heptitis B ptients with nucleoside nlogue. Liver Int 33 (Suppl 1): S133 S136, Fung J, Li CL, Seto WK nd Yuen MF: Nucleoside/nucleotide nlogues in the tretment of chronic heptitis B. J Antimicrob Chemother 66: , Chotiyputt W nd Lok AS: Heptitis B virus vrints. Nt Rev Gstroenterol Heptol 6: , Rodriguez Fris F, Buti M, Tbernero D nd Homs M: Qusispecies structure, cornerstone of heptitis B virus infection: Mss sequencing pproch. World J Gstroenterol 19: , Cpobinchi MR, Giombini E nd Rozer G: Next genertion sequencing technology in clinicl virology. Clin Microbiol Infect 19: 15 22, Abbte I, Rozer G, Tommsi C, Bruselles A, Brtolini B, Chillemi G, Nicstri E, Nrciso P, Ippolito G nd Cpobinchi MR: Anlysis of co receptor usge of circulting virl nd provirl HIV genome qusispecies by ultr deep pyrosequencing in ptients who re cndidtes for CCR5 ntgonist tretment. Clin Microbiol Infect 17: , Armeni D, Vndenbroucke I, Fbeni L, Vn Mrck H, Cento V, D'Arrigo R, Vn Wesenbeeck L, Scopelliti F, Micheli V, Bruzzone B, et l: Study of genotypic nd phenotypic HIV 1 dynmics of integrse muttions during rltegrvir tretment: A refined nlysis by ultr deep 454 pyrosequencing. J Infect Dis 205: , Trimoulet P, Pinson P, Ppuchon J, Foucher J, Vergniol J, Chermk F, Wittkop L, Csting N, Merrouche W, Reigds S, et l: Dynmic nd rpid chnges in virl qusispecies by UDPS in chronic heptitis C ptients receiving telprevir bsed therpy. Antivir Ther 18: , Applegte TL, Gudieri S, Pluzolles A, Chopr A, Grebely J, Lucs M, Hellrd M, Lucini F, Dore GJ nd Mtthews GV: Nturlly occurring dominnt drug resistnce muttions occur infrequently in the setting of recently cquired heptitis C. Antivir Ther 20: , Cortes KC, Zgordi O, Perlejewski K, Lskus T, Mroszek K, Bukowsk Ośko I, Pwełczyk A, Płoski R, Berk H, Horbn A nd Rdkowski M: Deep sequencing of heptitis C virus hypervrible region 1 revels no correltion between genetic heterogeneity nd ntivirl tretment outcome. BMC Infect Dis 14: 389, Wng H, Ji YY, Yo GB, M XY, Xie Q, Png HY, Wu SM, Li J, Chen CW, Xu XW nd Gu EL: Two yers efficiency of lmivudine nd defovir dipivoxil combined therpy in chronic heptitis B ptients. Eur Rev Med Phrmcol Sci 17: , Europen Assocition For The Study Of The Liver: EASL clinicl prctice guidelines: Mngement of chronic heptitis B virus infection. J Heptol 57: , Wu J, Liu W, He L, Hung F, Chen J, Cui P, Shen Y, Zho J, Wng W, Zhng Y, et l: Sputum microbiot ssocited with new, recurrent nd tretment filure tuberculosis. PLoS One 8: e83445, Hmdy M nd Knight R: Microbil community profiling for humn microbiome projects: Tools, techniques, nd chllenges. Genome Res 19: , Zoulim F nd Locrnini S: Heptitis B virus resistnce to nucleos(t)ide nlogues. Gstroenterology 137: e1 e2, Rhee SY, Mrgeridon Thermet S, Nguyen MH, Liu TF, Kgn RM, Beggel B, Verheyen J, Kiser R nd Shfer RW: Heptitis B virus reverse trnscriptse sequence vrint dtbse for sequence nlysis nd muttion discovery. Antivirl Res 88: , Chn HL nd Ji J: Chronic heptitis B in Asi new insights from the pst decde. J Gstroenterol Heptol 26 (Suppl 1): , Wrgo AR nd Kurth G: Virl fitness: Definitions, mesurement, nd current insights. Curr Opin Virol 2: , Gong L, Hn Y, Chen L, Liu F, Ho P, Sheng J, Li XH, Yu DM, Gong QM, Tin F, et l: Comprison of next genertion sequencing nd clone bsed sequencing in nlysis of heptitis B virus reverse trnscriptse qusispecies heterogeneity. J Clin Microbiol 51: , Rmírez C, Gregori J, Buti M, Tbernero D, Cmós S, Csills R, Quer J, Estebn R, Homs M nd Rodriguez Frís F: A comprtive study of ultr deep pyrosequencing nd cloning to quntittively nlyze the virl qusispecies using heptitis B virus infection s model. Antivirl Res 98: , Rodriguez C, Chevliez S, Bensdoun P nd Pwlotsky JM: Chrcteriztion of the dynmics of heptitis B virus resistnce to defovir by ultr deep pyrosequencing. Heptology 58: , Hongthnkorn C, Chotiyputt W, Oberhelmn K, Fontn RJ, Mrrero JA, Licri T nd Lok AS: Virologicl brekthrough nd resistnce in ptients with chronic heptitis B receiving nucleos(t)ide nlogues in clinicl prctice. Heptology 53: , Menendez Aris L, Alvrez M nd Pcheco B: Nucleoside/nucleotide nlog inhibitors of heptitis B virus polymerse: mechnism of ction nd resistnce. Curr Opin Virol 8: 1 9, Keeffe EB, Zeuzem S, Koff RS, Dieterich DT, Estebn Mur R, Gne EJ, Jcobson IM, Lim SG, Noumov N, Mrcellin P, et l: Report of n interntionl workshop: Rodmp for mngement of ptients receiving orl therpy for chronic heptitis B. Clin Gstroenterol Heptol 5: , Lo AO, Wong VW, Wong GL, Chn HY, Cheung CM nd Chn HL: Efficcy of entecvir switch therpy in chronic heptitis B ptients with incomplete virologicl response to telbivudine. Antivir Ther 18: , Pirtvisuth T, Komolmit P, Tnwndee T, Sukeepisrnjroen W, Chn HL, Pessô MG, Fssio E, Ono SK, Bessone F, Druich J, et l: 52 week efficcy nd sfety of telbivudine with conditionl tenofovir intensifiction t week 24 in HBeAg positive chronic heptitis B. PLoS One 8: e54279, Sun J, Xie Q, Tn D, Ning Q, Niu J, Bi X, Fn R, Chen S, Cheng J, Yu Y, et l: The 104 week efficcy nd sfety of telbivudine bsed optimiztion strtegy in chronic heptitis B ptients: A rndomized, controlled study. Heptology 59: , 2014.