Antiviral Therapy 14:

Transcription

1 Antivirl Therpy 14: Originl rticle Vribility of reverse trnscriptse nd overlpping S gene in heptitis B virus isoltes from untreted nd lmivudine-resistnt chronic heptitis B ptients Teres Pollicino 1 *, Grziell Isgrò 1, Ros Di Stefno 2, Dontell Ferrro 2, Sergio Mimone 1, Snt Brnctelli 1, Giovnni Squdrito 1, Vito Di Mrco 3, Antonio Crxì 3 nd Giovnni Rimondo 1 1 Unit of Clinicl nd Moleculr Heptology, Deprtment of Internl Medicine, University of Messin, Messin, Itly 2 Deprtment of Hygiene nd Microbiology, University of Plermo, Plermo Itly 3 Unit of Gstroenterology nd Heptology, Diprtmento Biomedico di Medicin Intern e Specilistic, University of Plermo, Plermo, Itly *Corresponding uthor: e-mil: tpollicino@unime.it Bckground: The high degree of diversity of the heptitis B virus (HBV) qusispecies in chroniclly infected individuls rises the possibility tht HBV genetic vrints fvouring resistnce to nucleoside/nucleotide nlogues (NAs) might pre-exist to tretment. The im of this study ws to investigte the genetic vribility of the entire HBV reverse trnscriptse (RT) domin nd of the overlpping S gene in lrge series of untreted heptitis B surfce ntigen crriers nd in lmivudine (3TC)-resistnt ptients. Methods: Sequencing nlysis of the entire HBV RT domin of isoltes from 100 untreted (tretment- nive group) nd 59 3TC-resistnt (3TC-resistnt group) consecutive ptients with chronic heptitis B ws performed. Results: In the tretment-nive group, primry muttions known to cuse resistnce to NAs were not detected, but vribly combined secondry/compenstory muttions were found in 46 (46%) ptients. Moreover, four ptients crried muttions tht modified the S protein ntigenicity. In the 3TC-resistnt group, besides the primry 3TCresistnt muttions, vrious combintions of primry nd secondry muttions conferring resistnce to other NAs were detected in 41/59 (69.5%) ptients. Importntly, the RT muttions induced by 3TC provoked stop codons in the overlpping S gene in two ptients nd modified the S protein ntigenicity in nother nine. Conclusions: This study shows tht HBV mutnts ssocited with resistnce to NAs might lredy be present s the mjor infecting popultion in untreted ptients, nd tht vrints emerging under 3TC might lso crry muttions fvouring resistnce to other NAs nd/or potentilly ltering the S protein immunorectivity. Introduction The vilbility of nucleoside/nucleotide nlogues (NAs) ble to suppress heptitis B virus (HBV) repliction by inhibiting the virl reverse trnscriptse (RT) hs provided considerble improvement in the tretment of chronic heptitis B (CHB), supporting the hope tht the infection cn be controlled indefinitely thus preventing its most severe sequels, cirrhosis nd heptocellulr crcinom, in most ptients. At present, however, mjor limittion with NA-bsed therpies is the emergence nd selection under tretment of drug-resistnt vrints leding to the loss of efficcy of the ntivirl in use nd the incresed probbility tht the dministrtion of different NA might fil to chieve n ntivirl effect becuse of cross-resistnce phenomen [1 8]. Schemticlly, virl DNA muttions conferring (or contributing to) resistnce to NAs might be distinguished in primry nd secondry (or compenstory) muttions [1,2,5,8]. The primry muttions cuse mino cid substitutions in the virl RT tht re responsible for the ntivirl resistnce, s they significntly decrese the sensitivity of the virl strins to NAs. Secondry/compenstory muttions hve no direct role in drug resistnce, but they cuse mino cid substitutions, which compenste functionl defects of the HBV strins crrying primry muttions by restoring their replictive fitness. Altogether, the primry nd secondry/compenstory muttions ssocited with HBV drug resistnce constitute complex pnel of possible HBV genomic vrints crrying mino cid substitutions tht might 2009 Interntionl Medicl Press (print) (online) 649

2 T Pollicino et l. Tble 1. Demogrphic nd virologicl chrcteristics of tretment-nive nd 3TC-resistnt ptients Chrcteristic Tretment-nive group, n=100 3TC-resistnt group, n=59 Men ge, yers (±sd) 45 (12) 55 (10) Mle sex, n Femle sex, n HBeAg-positive, n 7 0 Anti-HBe-positive, n Genotype A, n 9 0 B, n 1 0 D, n nti-hbe, ntibodies ginst heptitis B e ntigen (HBeAg); 3TC, lmivudine. occur in vrious domins of the RT gene. One must lso tke into ccount the fct tht the RT region completely overlps with the heptitis B surfce ntigen (HBsAg) open reding frme (ORF); hence, ech muttion occurring in the RT implies possible chnges in the envelope proteins nd vice vers [2,9 15]. Considering the extent of qusispecies diversity in HBV chronic infection, it is conceivble tht virl strins crrying muttions ssocited with drug resistnce might ntecede NA tretment. It is resonble to speculte tht virl strins emerging under NA tretment might crry behind the clssicl primry muttions conferring resistnce to ech individul NA dditionl RT or HBsAg mino cid chnges tht hve clinicl relevnce nd/or implictions for subsequent pproches with other NAs. On the bsis of these specultions, the im of this study ws to nlyse the genomic vribility of the RT domin nd the overlpping S region in HBV isoltes from lrge series of ptients nive to ntivirl therpy s well s lrge number of lmivudine (3TC)- experienced individuls. Methods Ptients We nlysed the complete RT genomic region of virl isoltes from 100 CHB-infected ptients (83 men nd 17 women; men ±sd ge 45 ±12 yers) rndomly chosen mong those ttending the Liver Units nd the Moleculr/Virology Lbortories of the University Hospitls of Messin nd Plermo (Itly) in the yers nd mtching the following selection criteri: vilbility of t lest 1 ml of serum stored t -80 C, nive for ny ntivirl tretment, HBV DNA levels >20,000 IU/ml, nd negtive for heptitis C virus (HCV), heptitis delt virus (HDV) nd HIV infections (tretment-nive group). In ddition, we exmined the sme genomic region in virl isoltes from 59 3TCresistnt ptients (48 men nd 11 women; men ±sd ge 55 ±10 yers; 3TC-resistnt group) who consecutively ttended the bovementioned lbortories for dignostic purposes (genotyping confirmtion of drug resistnce development fter virologicl brekthrough) in the yers These ltter individuls were selected on the bsis of dignosed development of primry muttions conferring 3TC resistnce, HBV DNA levels >2,000 IU/ml, negtive HCV, HDV nd HIV sttus, nd vilbility of 1 ml of -80 C stored plsm. Moreover, prt from 3TC, none of these individuls hd ever tken ny other ntivirl therpy t the time of exmintion. A totl of 7 of the tretment-nive group ptients were heptitis B e ntigen (HBeAg)-positive nd 93 were positive for ntibodies ginst HBeAg (nti-hbe), wheres ll individuls in the 3TC-resistnt group were nti-hbe-positive (Tble 1). Moleculr virologicl nlysis HBV DNA ws quntified by the use of the COBAS TqMn HBV test (Roche Moleculr Systems, Inc., Brnchburg, NJ, USA) or the Versnt HBV DNA 3.0 Assy (bdna; Siemens Medicl Solution Dignostics, Trrytown, NY, USA). Genotypes of HBV were identified by PCR mplifiction nd subsequent direct sequencing of the entire S gene s previously described [16]. HBV polymerse genotyping nd sequence nlysis HBV DNA ws extrcted from serum smples using the QIAmp UltrSens Virus Kit (QIAGEN S.p.A., Milno, Itly) ccording to the mnufcturer s instructions nd the HBV polymerse RT domin, encoding mino cids 1 344, ws mplified by PCR using the primer pir HBV18 (5 -CCTGCTGGTGGCTCCAGTTCA-3, nucleotide position 56 76) nd SEQ9 (5 -GGTTGCGTCA GCAAACACTTGG-3, nucleotide position ) nd the Expnd High Fidelity PCR System (Roche Dignostics GmbH, Mnnheim, Germny) ccording to the mnufcturer s instructions. PCR mplifiction consisted of 40 cycles of 94 C for 30 s, 60 C for 30 s nd 72 C for 1 min. Ech PCR product ws purified nd double Interntionl Medicl Press

3 Vribility of HBV reverse trnscriptse nd S genomic regions Tble 2. Chrcteristics of oligonucleotides used s sequencing primers Primer Nucleotide sequence Position Sense primers HBV CCTGCTGGTGGCTCCAGTTCA SEQ 1 5 -GTCTAGACTCGTGGTGGACTT SEQ 6 5 -GGTATGTTGCCCGTTTGT SEQ 5 5 -GTGGTATTGGGGGCCAAG Antisense primers HBV TTGCGTCAGCAAACACTTGGC HBV CCCACAATTCGTTGACATACT HBV 2 5 -AATGGCACTAGTAAACTGAG HBV 4 5 -CCTTGATAGTCCAGAAGAAC Nucleotide positions of the primers re numbered from the unique EcoRI site nd the nomenclture is ccording to Glibert et l. [28]. strnded sequenced directly by the dideoxy chin termintion method with the primers shown in Tble 2, using BigDye Termintor version 3.1 Cycle Sequencing Kit nd n ABI PRISM 310 Genetic Anlyzer (Applied Biosystems, Foster City, CA, USA). HBV RT nucleotide nd mino cid sequences were ligned by using the CLUS- TAL W progrmme [17]. Results The vribility of the HBV RT nd the overlpping S gene ws evluted in virl isoltes from 100 tretment-nive group nd 59 3TC- resistnt group ptients with chronic liver disese. None of the isoltes from the 100 ptients from the tretment-nive group hd, t the level of the HBV RT, primry muttions ssocited with ntivirl resistnce, wheres 46 (46%) of them showed secondry/compenstory muttions. In prticulr, virl strins from 30 ptients crried only one secondry muttion (Tble 3), wheres between 2 nd 4 of these kinds of muttions were detected in 16 ptients (Tble 4). When the nucleotide sequences of the S gene ORF were evluted, no muttions known to be of clinicl or biologicl relevnce were detected outside the determinnt region of the HBsAg (dt not shown). By contrst, muttions cusing importnt mino cid chnges t the level of the determinnt were found in four ptients. Specificlly, HBV isoltes from three ptients showed the sp120t/s chnge, wheres isoltes from one ptient showed the sg145r chnge. Of note, nucleotide muttions producing sp120t/s nd sg145r mino cid chnges re lso responsible for the rtt128n/i nd rtw153q mino cid substitutions in the overlpping polymerse. Virl isoltes from ll 59 ptients in the 3TCresistnt group crried RT primry muttions known to confer 3TC resistnce (58 hd the rtm204i/v mino cid substitution nd 1 hd the rta181t substitution). In isoltes from 38 of the 58 (65.5%) ptients, Tble 3. Ptients from the tretment-nive group with single secondry/compenstory reverse trnscriptse muttion Amino cid substitution N94R 1 V173M 1 A181D 1 T207I 1 V214A/E 2 Q215S/H/P 9 R217L 1 S219A 3 F221Y 3 I233V b 3 P237T 2 N238H 4 Ptients, n Previously unreported mino cid substitution in position crucil for primry resistnce to lmivudine nd defovir. b Debted primry resistnce muttion to defovir. the rtm204i/v primry muttion ws ssocited with the following secondry/compenstory muttions: rtl180m in 19 ptients, rtl80v/i in 10 ptients, both rtl80v/i nd rtl180m in 8 ptients, nd rtv173l in 1 ptient. The isolte with the rta181t substitution hd no secondry chnge. Besides these muttions typiclly ssocited with 3TC resistnce, single or multiple primry nd secondry/compenstory muttions ssocited with resistnce to other NAs were detected in HBV isoltes from 41 of the 59 (69.5%) ptients in the 3TC-resistnt group. In prticulr, 22 ptients crried only one of these muttions (Tble 5), wheres 19 ptients hd between 2 nd 5 muttions (Tble 6). In isoltes from ptients in the 3TC-resistnt group, nlysis of the S gene nucleotide sequence reveled the presence of muttions inducing relevnt mino cid chnges in HBsAg (nd in the overlpping RT) in 11 of the 59 (18.6 %) ptients. In prticulr, the sp120t/s muttion (corresponding to rtt128n/i in Antivirl Therpy

4 T Pollicino et l. the polymerse protein) ws found in five ptients, the sm133l muttion (corresponding to rty141s) ws found in two ptients, the double sd144e/sg145r muttion (corresponding to rtg153e) ws found in one ptient, the se164d muttion (corresponding to rtv173l) ws found in one ptient, both sw172stop nd sw182stop muttions (corresponding to rta181t nd rtv191i, respectively) were found in one ptient, nd the sw196stop muttion (corresponding to rtm204i) ws found in one dditionl ptient. In this context, it should be remembered tht the rtm204v nd the rtm204i mino cid chnge imply the si195m nd sw196s/l mino cid substitution, respectively, in the envelope protein [2,9,10,13]. Genotyping performed through the S gene nlysis of isoltes from ll the ptients showed tht in the tretment-nive group, 89 individuls crried HBV genotype Tble 4. Muttion profiles of HBV crrying multiple secondry/ compenstory reverse trnscriptse muttions in isoltes from ptients in the tretment-nive group Amino cid substitutions Q215S/H/P + V173M 1 Q215S/H/P + F221Y 1 Q215S/H/P + P237T 2 Q215S/H/P + N238H 1 F221Y + L217R 3 F221Y + N238T 2 N238H + V214E 1 N238H + N94R 1 S219A + S185I 1 F221Y + I233V + N238D 1 Q215S + R217L + F221Y 1 S202T b +L217R + S219A + F221Y 1 Ptients, n Debted primry resistnce muttion to defovir. b Previously unreported mino cid substitution t position criticl for primry resistnce to entecvir. HBV, heptitis B virus. Tble 5. Ptients from the 3TC-resistnt group with single primry or secondry/compenstory reverse trnscriptse muttion Amino cid substitution S85F 1 A181V b 1 T184N/S c 2 A200V 2 V208A 1 Q215S/H/P/E 11 S219A 1 F221Y 1 N238T/H 2 Secondry/compenstory muttions. b Primry resistnce muttion to lmivudine (3TC) nd defovir. c Primry resistnce muttion to entecvir. Ptients, n D, 10 hd HBV genotype A nd 1 hd HBV genotype B, wheres ll the ptients of the 3TC- resistnt group crried HBV of genotype D (Tble 1). No correltion ws found between ny muttion pttern nd genotype s well s HBeAg or nti-hbe sttus in the tretmentnive group. Discussion The bidirectionl direct sequencing technique is the ccepted stndrd for the genotypic chrcteriztions of the mjor circulting HBV virl popultions [5,8]. By mens of this method, we investigted the occurrence of ll RT primry nd secondry/compenstory muttions reported to be ssocited with ntivirl resistnce, s well s the genetic vribility of the overlpping S gene in HBV isoltes, from lrge series of both untreted nd 3TC-resistnt ptients. Of note, HBV isoltes from lmost hlf of the individuls in the tretment-nive group showed single or multiple mino cid chnges ssocited with ntivirl resistnce. In this context, it should be considered tht dditionl, importnt virl mutnts might be present s minor popultions, which cn be detected by sequencing technologies tht re not commonly vilble but re more sensitive thn the one we used. None of the isoltes from the 100 tretment- nive individuls displyed ny of the previously reported primry muttions conferring resistnce to the vilble NAs. However, it is of interest tht HBV strins Tble 6. Muttion profiles of HBV crrying multiple primry or secondry/compenstory reverse trnscriptse muttions in isoltes from ptients in the 3TC-resistnt group Amino cid substitutions Q215S/P + T184A b 1 Q215S/P + N238H 2 Q215S/P + P237T 1 V208A + F221Y 1 V214A + P237H 1 L217R + S219A 1 L217R + F221Y 1 N238D/H/S/T + T184S b 1 N238D/H/S/T + A181V c 1 N238D/H/S/T + V214E 1 N238D/H/S/T + M250L b 1 I233V d + N238H + M250L b 1 I169T b + T184A b + V214A 1 A200V + F221Y + N238T 1 L217R + S219A + F221Y 2 T184A b + V214T + Q215S + N238H 1 V84M + Q215P + L217R + F221Y + N238D 1 Ptients, n Secondry/compenstory muttions. b Primry resistnce muttions to entecvir. c Primry resistnce muttion to lmivudine (3TC) nd defovir. d Debted primry resistnce muttion to defovir. HBV, heptitis B virus Interntionl Medicl Press

5 Vribility of HBV reverse trnscriptse nd S genomic regions from two of these ptients showed n lnine to sprtic cid substitution t position 181 (rta181d) nd serine to threonine substitution t position 202 (rts202t), respectively. Although these chnges do not correspond to the typicl primry resistnce muttions tht re usully detected t these positions (specificlly, the rta181v/t nd the rts202g/c/i) nd implied in resistnce, respectively, to 3TC/defovir nd entecvir, their possible involvement in ntivirl resistnce cnnot be excluded. Phenotypic chrcteriztion of these virl strins should be performed to verify this possibility. Moreover, HBV popultions from four dditionl ptients in the tretment-nive group hd the rti233v mino cid chnge, which ws previously suggested to be ssocited with primry non-response to defovir [18], lthough this ssocition ws not confirmed by more recent studies [19 21]. Mny of the muttions found in ptients in the tretment-nive group might be nturl polymorphic chnges without ny biologicl nd clinicl relevnce per se. However, when they occur in virl strins with primry muttions they might contribute to ntivirl resistnce. In prticulr, we observed tht isoltes from 35 ptients hd t lest one of the mino cid chnges described s defovir secondry resistnce muttions (rtv214a/e, rtq215s/h/p, rtl217r, rts219a, rtf221y, rtp237t nd rtn238t/h/d) [1,2]. Furthermore, we found tht isoltes from seven ptients showed substitutions t HBV polymerse positions rt128, rt173, rt153 nd rt207, ll known to be secondry/compenstory muttions tht increse the virl fitness when they occur in 3TC-resistnt strins [1,12,22,23]. Of note, when the nucleotide sequence ws evluted with regrds to the S ORF, we found tht 4 out of the 100 tretment-nive individuls hd either sp120a or sg145r muttions tht deeply modify S protein ntigenicity nd re commonly considered vccine or immunoglobulin escpe muttions [15,24,25]. The nlyses of 3TC-resistnt isoltes reveled tht the vst mjority of them (70% of ptients exmined) hd dditionl primry nd/or secondry/compenstory muttions tht could negtively ffect the efficcy of subsequent therpy with different NAs. Of prticulr relevnce, nine ptients hd chnges reducing the virus susceptibility to entecvir (rti169t, T184A/S/N nd M250V/L), wheres three ptients hd the rta181t/v muttion known to confer resistnce to defovir. In this context, severl dditionl ptients hd vribly combined muttions strongly suspected to be involved in defovir resistnce (tht is, rtv84m, rts85f, rtp237h/t nd rtn238h/t/d/s) [1,2]. Finlly, the nlysis of the S gene sequence of ptients in the 3TC-resistnt group suggests tht 3TC tretment fvours the selection of strins with deep modifiction in the S protein. Indeed, behind the nine ptients crrying mino cid chnges tht modify the ntigenicity of the HBsAg, we detected two more isoltes with stop codons truncting the C-terminl portion of the surfce protein, which might ffect the virion secretion nd provoke intrcellulr ccumultion of modified S proteins tht might directly contribute to heptocellulr dmge [26,27]. In summry, our study confirms the high frequency of nturlly occurring HBV vrints tht might influence the effectiveness of the ntivirl tretment in individul ptients. Furthermore, it clerly demonstrtes the importnce of performing genetic chrcteriztion of HBV isoltes from ptients who hve developed resistnce to 3TC, s well s to ny other specific ntivirl. This chrcteriztion ppers to be helpful for tiloring the most proper rescue therpy in ptients where previous tretment hs filed nd for reveling the possible development of S gene vrints, n event tht might hve relevnt virologicl nd clinicl implictions. Acknowledgements This study ws supported in prt by grnt from the Itlin Ministero dell Slute (Progetto Finlizzto). Disclosure sttement The uthors declre no competing interests. References 1. Brtholomeusz A, Locrnini S. Antivirl drug resistnce: clinicl consequences nd moleculr spects. Semin Liver Dis 2006; 26: Brtholomeusz A, Locrnini S. Heptitis B virus muttions ssocited with ntivirl therpy. J Med Virol 2006; 78:S52 S Shw T, Brtholomeusz A, Locrnini S. HBV drug resistnce: mechnisms, detection nd interprettion. J Heptol 2006; 44: Zoulim F, Buti M, Lok AS. Antivirl-resistnt heptitis B virus: cn we prevent this monster from growing? J Virl Hept 2007; 14 Suppl 1: Lok AS, Zoulim F, Locrnini S, et l. Antivirl drugresistnt HBV: stndrdiztion of nomenclture nd ssys nd recommendtions for mngement. Heptology 2007; 46: Hoofngle JH, Doo E, Ling TJ, Fleischer R, Lok AS. Mngement of heptitis B: summry of clinicl reserch workshop. Heptology 2007; 45: Ghny M, Ling TJ. Drug trgets nd moleculr mechnisms of drug resistnce in chronic heptitis B. Gstroenterology 2007; 132: Pwlotsky JM, Dusheiko G, Htzkis A, et l. Virologic monitoring of heptitis B virus therpy in clinicl trils nd prctice: recommendtions for stndrdized pproch. Gstroenterology 2008; 134: Delney WE, Locrnini S, Shw T. Resistnce of heptitis B virus to ntivirl drugs: current spects nd directions for future investigtion. Antivir Chem Chemother 2001; 12: Brtholomeusz A, Tehn BG, Chlmers DK. Comprisons of the HBV nd HIV polymerse, nd ntivirl resistnce muttions. Antivir Ther 2004; 9: Antivirl Therpy

6 T Pollicino et l. 11. Bock CT, Tillmnn HL, Torresi J, et l. Selection of heptitis B virus polymerse mutnts with enhnced repliction by lmivudine tretment fter liver trnsplnttion. Gstroenterology 2002; 122: Sheldon J, Rodès B, Zoulim F, Brtholomeusz A, Sorino V. Muttions ffecting the repliction cpcity of the heptitis B virus. J Virl Hept 2006; 13: Torresi J. The virologicl nd clinicl significnce of muttions in the overlpping envelope nd polymerse genes of heptitis B virus. J Clin Virol 2002; 25: Slon RD, Ijz S, Moore PL, Hrrison TJ, Teo CG, Tedder RS. Antivirl resistnce muttions potentite heptitis B virus immune evsion through disruption of its surfce ntigen determinnt. Antivir Ther 2008; 13: Torresi J, Ernest-Silveir L, Deliynnis G, et l. Reduced ntigenicity of the heptitis B virus HBsAg protein rising s consequence of sequence chnges in the overlpping polymerse gene tht re selected by lmivudine therpy. Virology 2002; 293: Pollicino T, Rff G, Costntino L, et l. Moleculr nd functionl nlysis of occult heptitis B virus isoltes from ptients with heptocellulr crcinom. Heptology 2007; 45: Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence lignment through sequence weighting, position-specific gp penlties nd weight mtrix choice. Nucleic Acids Res 1994; 22: Schildgen O, Sirm H, Funk A, et l. Vrint of heptitis B virus with primry resistnce to defovir. N Engl J Med 2006; 354: Borroto-Esod K, Miller MD, Arterburn S. Pooled nlysis of mino cid chnges in the HBV polymerse in ptients from four mjor defovir dipivoxil clinicl trils. J Heptol 2007; 47: Curtis M, Zhu Y, Borroto-Esod K. Heptitis B virus contining the I233V muttion in the polymerse reversetrnscriptse domin remins sensitive to inhibition by defovir. J Infect Dis 2007; 196: Tn J, Degertekin B, Wong SN, Husin M, Oberhelmn K, Lok AS. Tenofovir monotherpy is effective in heptitis B ptients with ntivirl tretment filure to defovir in the bsence of defovir-resistnce muttions. J Heptol 2008; 48: Locrnini S, Mson WS. Cellulr nd virologicl mechnisms of HBV drug resistnce. J Heptol 2006; 44: Pwlotsky J-M. The concept of heptitis B virus mutnt escpe. J Clin Virol 2005; 34 Suppl 1:S125 S Crmn WF. The clinicl significnce of surfce ntigen vrints of heptitis B virus. J Virl Hept 1997; 4 Suppl 1: Torresi J, Ernest-Silveir L, Civitico G, et l. Restortion of repliction phenotype of lmivudine-resistnt heptitis B virus mutnts by compenstory chnges in the fingers subdomin of the virl polymerse selected s consequence of muttions in the overlpping S gene. Virology 2002; 299: Ando K, Moriym T, Guidotti LG, et l. Mechnisms of clss I restricted immunopthology. A trnsgenic mouse model of fulminnt heptitis. J Exp Med 1993; 178: Bock CT, Tillmnn HL, Mschek HJ, Mnns MP, Trutwein C. A pres muttion isolted from ptient with chronic heptitis B infection leds to virus retention nd misssembly. Gstroenterology 1997; 113: Glibert F, Mndrt E, Fitoussi F, Tiollis P, Chrny P. Nucleotide sequence of the heptitis B virus genome (subtype yw) cloned in E. Coli. Nture 1979; 281: Accepted for publiction 27 Jnury Interntionl Medicl Press