IMGT Collier de Perles: the New Look for IgSF and MhcSF in IMGT
|
|
- Felix Griffin
- 5 years ago
- Views:
Transcription
1 IMGT Collier de Perles: the New Look for IgSF and MhcSF in IMGT Quentin Kaas and Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire Université Montpellier, UPR CNRS 1142, IGH Institut Universitaire de France 2nd Basic and Clinical Immunogenomics and 3rd Immunoinformatics (Immunomics) Conferences BCII 06, October 8-12, 2006, Budapest, Hungary The international ImMunoGeneTics information system Coordinator: M.-P. Lefranc, Montpellier, France
2
3 IMGT : the adaptive immune response Vertebrate s Immunoglobulin (IG) T lymphocyte B lymphocyte peptide T cell receptor (TR) MHC Trimolecular complex Based on the IMGT-ONTOLOGY concepts (Lefranc M.-P. Immunome Res. 1, 3, 2005)
4 IMGT unique numbering V-DOMAIN (IG,TR) AND C-DOMAIN (IG,TR) AND V-LIKE-DOMAIN C-LIKE-DOMAIN (other than IG,TR) (other than IG,TR) Immunoglobulin superfamily (IgSF) G-DOMAIN (MHC) AND G-LIKE-DOMAIN (other than MHC) MHC superfamily (MhcSF)
5 V-DOMAIN and C-DOMAIN IgG1 The Immunoglobulin FactsBook, 2001
6 Immunoglobulin (IG) T cell receptor (TR) Contribution of the V-DOMAIN V-J-REGION Light chain 2 V-DOMAINs to the antigen binding site Alpha Gamma V-DOMAIN - Beta Delta V-D-J-REGION Heavy chain V-DJ-REGION V-J-REGION Membrane IgM T cell receptor The Immunoglobulin FactsBook, 2001
7 Immunoglobulin IgG IMGT Repertoire,
8 Immunoglobulin (IG) synthesis genomic DNA (IGH Locus 14q32) V D J C 3' 5 rearranged DNA 5 mrna 3' 2 x 1012 different IG per individual IMGT Repertoire,
9 Junctions of the V-DOMAINs VH V-KAPPA V-D-J junction V-J junction Side view Mouse(Mus musculus) E5.2Fv VH V-KAPPA View from above CDR3-IMGT= Complementarity determining region ( ) V-J junction ( ) V-D-J junction ( )
10 Generation of the JUNCTION diversity 3 V-REGION tgtgcgaaa ga N-REGION D-REGION tacc agcatattgtg gtggtgactgctat tcc N-REGION gatt JUNCTION C A P Y R G D T Y D Y S Wtgttgtgcgcca gcg cca tac cgg ggggtgactactat ggt gac act tat gat tac tcc tgg 5 J-REGION acaactggttcg actcctgg
11 Lefranc M.-P. et al. Dev. Comp. Immunol., 27, (2003)
12 IMGT contacts 41V - TRP (W) chain : 1u8k_B Tot NCo Pol HB NPol Cov SS Total number of atomic pair contacts Number of non covalent atomic Number of polar atomic pair contacts Number of hydrogen bonds Number of non polar atomic pair contacts Number of covalent links (other than chain covalent links) Number of disulfide bridges Kaas Q. et al. NAR 32, D208-D210 (2004)
13 V-DOMAIN The 3D structure of a V-DOMAIN (IG or TR) 9 antiparallel beta strands: A, B, C, C, C, D, E, F and G linked by beta turns: AB, CC, C D, DE and EF and loops: BC or CDR1-IMGT C C or CDR2-IMGT and FG or CDR3-IMGT forming a sandwich of two sheets [ABED][GFCC C ].
14 IMGT Collier de Perles on two layers Kaas Q. et al. NAR 32, D208-D210 (2004)
15 IMGT Web resources: pages HTML IMGT Collier de Perles IMGT Protein Display IMGT Alignment of alleles
16 IMGT tools for V-DOMAIN sequences: 1. IMGT/V-QUEST V-GENE JUNCTION J-GENE Giudicelli et al. Nucleic Acids Res. 32, W435-W440 (2004)
17 Giudicelli et al. Nucleic Acids Res. 32, W435-W440 (2004)
18 IMGT tools for V-DOMAIN sequences: 2. IMGT/JunctionAnalysis Addition Addition Mutation Délétion Délétion Délétion
19 The eleven IMGT amino acid classes according to the physico-chemical properties Pommié et al. J. Mol Recognit. 17, 17-32, 2004
20 r Pommié et al. J. Mol Recognit. 17, 17-32, 2004
21 Camelidae (camel, llama) antibodies gdna mrna Antibody IgG1 IgG2
22 IMGT Collier de Perles Camelus dromedarius (Camel) VH Single-Domain Antibody (1jto_A) CDR-IMGT lengths [8.8.26] 42: F, Y 49: E, Q 50: R, C 52: G, F, L, W
23 V-LIKE-DOMAIN Homo sapiens Myelin oligodendrocyte glycoprotein (MOG) CDR-IMGT lengths [9.6.9] N-glycosylated site N30 (BC loop) is conserved in Rattus norvegicus MOG which has been crystallized (1pkq). Duprat, E. et al., Recent Res. Develop. Human Genet., 2, (2004)
24 C-DOMAIN and C-LIKE-DOMAIN The 3D structure of a C-LIKE-DOMAIN (IgSF other than IG or TR) is similar to that of a C-DOMAIN (IG or TR) BC 7 antiparallel beta strands: A, B, C, D, E, F and G CD linked by beta turns: AB, DE and EF transversal strand: CD or loops: BC or CDR1-IMGT and FG or CDR3-IMGT FG forming a sandwich of two sheets [ABED][GFC] or [ABE][GFCD]
25 C-LIKE-DOMAIN FCGR3B The distinction between C1 and C2 becomes unnecessary as discussed in Dev. Comp. Immunol. 29, (2005). Bertrand G. et al., Tissue Antigens, 64, (2004)
26 MHCI MHC class I and MHC class II The groove is made by two G-DOMAINs that belong both to the same chain I-ALPHA in MHC class I each one to a different chain II-ALPHA and II-BETA in MHC class II
27 IMGT Colliers de Perles for G-DOMAIN IMGT pmhc contact sites: MHC class I (1ao7) Disulfide bridge C11-C74 61A and 72A Can be compared with the IMGT reference pmhc contact sites for pmhc-i with 9-aa peptides: 74 structures
28 1ao7
29 IMGT Colliers de Perles for G-DOMAIN IMGT pmhc contact sites: MHC class II (1j8h) Disulfide bridge C11-C74 61A, 61B and 72A (except for H2-AB) Can be compared with the IMGT reference pmhc contact sites for pmhc-ii and the 9 aa in the groove: 44 structures
30 1j8h
31 G-DOMAIN and G-LIKE-DOMAIN The 3D structure of a G-LIKE-DOMAIN (MhcSF other than MHC) is similar to that of a G-DOMAIN (MHC) AB CD D C B BC A BC A B C D AB CD 4 antiparallel beta strands: A, B, C, D linked by beta turns: AB, BC and CD («floor» of the groove or platform) one long helix («wall» of the groove)
32 G-LIKE-DOMAIN MICA G-ALPHA1LIKE [D1] G-ALPHA2LIKE [D2] [D3] Position 54A is characteristics of the G-ALPHA1-LIKE of MHC I-like Frigoul, A. et al., Recent Res. Develop. Human Genet., 3, (2005)
33 Interactions between domains (1e4k) IGHG1 (FC-GAMMA1) CH2 C-DOMAIN FCGR3 B [D2 ] C-LIKEDOMAIN [D1] C-LIKE-DOMAIN
34 IMGT-ONTOLOGY concepts: IMGT Scientific chart rules ImmunoGrid Partners CINECA, Bologna, Italy University of Queensland, Australia CNR, Italy CNRS, France Technical University of Denmark Birbeck College, UK University of Bologna, Italy University of Catania, Italy
35 The IMGT team at Montpellier
36
37 IMGT pmhc contact sites H2-K1*01 8 residue peptide (code 1jtr) Lefranc et al. Dev. Comp. Immunol. 29, (2005)
38 IMGT pmhc contact sites H2-K1*01 (code 1jtr) 8 residue peptide Kaas and Lefranc In Silico Biology 2005
The Human T Cell Receptor Alpha Variable (TRAV) Genes
IMGT Locus in Focus Exp Clin Immunogenet 2000;17:83 96 Received: September 23, 1999 The Human T Cell Receptor Alpha Variable (TRAV) Genes Dominique Scaviner Marie-Paule Lefranc Laboratoire d ImmunoGénétique
More informationThe Human Immunoglobulin Kappa Variable (IGKV) Genes and Joining (IGKJ) Segments
IMGT Locus on Focus Exp Clin Immunogenet 1998;15:171 183 Received: June 13, 1998 Valérie Barbié Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire, CNRS, Université Montpellier II, Montpellier,
More informationThe Human Immunoglobulin Heavy Variable Genes
IMGT Locus on Focus Exp Clin Immunogenet 1999;16:36 60 Received: September 25, 1998 The Human Immunoglobulin Heavy Variable Genes Nathalie Pallarès a Sophie Lefebvre a Valérie Contet a Fumihiko Matsuda
More informationThe Human T cell Receptor Beta Variable (TRBV) Genes
IMGT Locus in Focus Exp Clin Immunogenet 2000;17:42 54 Received: July 3, 1999 The Human T cell Receptor Beta Variable (TRBV) Genes Géraldine Folch Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire,
More informationThe Human T Cell Receptor Alpha Joining (TRAJ) Genes
IMGT Locus in Focus Exp Clin Immunogenet 2000;17:97 106 Received: October 15, 1999 The Human T Cell Receptor Alpha Joining (TRAJ) Genes Dominique Scaviner Marie-Paule Lefranc Laboratoire d ImmunoGénétique
More informationThe Human T Cell Receptor Beta Diversity (TRBD) and Beta Joining (TRBJ) Genes
IMGT Locus in Focus Exp Clin Immunogenet 2000;17:107 114 Received: October 15, 1999 The Human T Cell Receptor Beta Diversity (TRBD) and Beta Joining (TRBJ) Genes Géraldine Folch Marie-Paule Lefranc Laboratoire
More informationAntigen Receptor Structures October 14, Ram Savan
Antigen Receptor Structures October 14, 2016 Ram Savan savanram@uw.edu 441 Lecture #8 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Today): Structural features of the BCR and TCR Janeway Chapter
More informationThe Teleostei Immunoglobulin Heavy IGH Genes
IMGT Locus in Focus Exp Clin Immunogenet 2000;17:148 161 Received: November 19, 1999 The Teleostei Immunoglobulin Heavy IGH Genes Sylvaine Artéro Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire,
More informationBIRKBECK COLLEGE (University of London)
BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology
More informationImmunology - Lecture 2 Adaptive Immune System 1
Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers
More informationFusion proteins for immune applications (FPIA)
Fusion proteins for immune applications (FPIA) Marie-Paule Lefranc IMGT, the international ImMunoGeneTics information system http://www.imgt.org Fusion proteins for immune applications (FPIA) Fusion proteins
More informationStructural Analysis of TCRpMHC Complexes Using Computational Tools. Feroze Mohideen Briarcliff High School
Structural Analysis of TCRpMHC Complexes Using Computational Tools Feroze Mohideen Briarcliff High School TCR-pMHC Complexes Peptide Structure of TCR-pMHC complex PDB AO7 Crossreactivity is the ability
More informationa) The statement is true for X = 400, but false for X = 300; b) The statement is true for X = 300, but false for X = 200;
1. Consider the following statement. To produce one molecule of each possible kind of polypeptide chain, X amino acids in length, would require more atoms than exist in the universe. Given the size of
More informationT cell Receptor. Chapter 9. Comparison of TCR αβ T cells
Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain
More informationDevelopment of B and T lymphocytes
Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell
More informationAn#body structure & func#on
An#body structure & func#on Objec&ves You should be able to: ü Define an&body ü Describe an&body structure ü Compare between different types or classes of an&body and their func&on An#bodies = Immunoglobulin
More informationMHC Class II. Alexandra López Laura Taberner Gemma Vilajosana Ilia Villate. Structural Biology Academic year Universitat Pompeu Fabra
MHC Class II Alexandra López Laura Taberner Gemma Vilajosana Ilia Villate Structural Biology Academic year 2012-2013 Universitat Pompeu Fabra Index - Introduction - Peptide binding to MHC class II - pockets
More informationLecture Series 2 Macromolecules: Their Structure and Function
Lecture Series 2 Macromolecules: Their Structure and Function Reading Assignments Read Chapter 4 (Protein structure & Function) Biological Substances found in Living Tissues The big four in terms of macromolecules
More informationLecture Series 2 Macromolecules: Their Structure and Function
Lecture Series 2 Macromolecules: Their Structure and Function Reading Assignments Read Chapter 4 (Protein structure & Function) Biological Substances found in Living Tissues The big four in terms of macromolecules
More informationThe Basics: A general review of molecular biology:
The Basics: A general review of molecular biology: DNA Transcription RNA Translation Proteins DNA (deoxy-ribonucleic acid) is the genetic material It is an informational super polymer -think of it as the
More informationPrinciples of Adaptive Immunity
Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors
More informationTwo categories of immune response. immune response. infection. (adaptive) Later immune response. immune response
Ivana FELLNEROVÁ E-mail: fellneri@hotmail.com, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC
More informationThe Major Histocompatibility Complex of Genes
The Major Histocompatibility Complex of Genes Topic 4 The Major Histocompatibility Complex Outline of Lectures The immunological reasons for transplant rejection How the MHC was discovered using inbred
More informationAmino Acids and Proteins Hamad Ali Yaseen, PhD MLS Department, FAHS, HSC, KU Biochemistry 210 Chapter 22
Amino Acids and Proteins Hamad Ali Yaseen, PhD MLS Department, FAHS, HSC, KU Hamad.ali@hsc.edu.kw Biochemistry 210 Chapter 22 Importance of Proteins Main catalysts in biochemistry: enzymes (involved in
More informationMacromolecules. copyright cmassengale
Macromolecules 1 Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. 2 Carbon (C) Carbon has 4 electrons in outer shell. Carbon can form covalent
More informationOrganic Compounds. Compounds that contain CARBON are called organic. Macromolecules are large organic molecules.
Macromolecules Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. Carbon (C) Carbon has 4 electrons in outer shell. Carbon can form covalent
More informationChapter 5. Generation of lymphocyte antigen receptors
Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of
More informationAntigen Recognition by T cells
Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells
More informationChapter 2. Chemical Composition of the Body
Chapter 2 Chemical Composition of the Body Carbohydrates Organic molecules that contain carbon, hydrogen and oxygen General formula C n H 2n O n -ose denotes a sugar molecule Supply energy Glucose Complex
More informationChapter 5 THE STRUCTURE AND FUNCTION OF LARGE BIOLOGICAL MOLECULES
Chapter 5 THE STRUCTURE AND FUNCTION OF LARGE BIOLOGICAL MOLECULES You Must Know The role of dehydration synthesis in the formation of organic compounds and hydrolysis in the digestion of organic compounds.
More informationpaper and beads don t fall off. Then, place the beads in the following order on the pipe cleaner:
Beady Pipe Cleaner Proteins Background: Proteins are the molecules that carry out most of the cell s dayto-day functions. While the DNA in the nucleus is "the boss" and controls the activities of the cell,
More informationGeneration of antibody diversity October 18, Ram Savan
Generation of antibody diversity October 18, 2016 Ram Savan savanram@uw.edu 441 Lecture #10 Slide 1 of 30 Three lectures on antigen receptors Part 1 : Structural features of the BCR and TCR Janeway Chapter
More informationH C. C α. Proteins perform a vast array of biological function including: Side chain
Topics The topics: basic concepts of molecular biology elements on Python overview of the field biological databases and database searching sequence alignments phylogenetic trees microarray data analysis
More informationProtein Structure and Function
Protein Structure and Function Protein Structure Classification of Proteins Based on Components Simple proteins - Proteins containing only polypeptides Conjugated proteins - Proteins containing nonpolypeptide
More informationLecture Series 2 Macromolecules: Their Structure and Function
Lecture Series 2 Macromolecules: Their Structure and Function Reading Assignments Read Chapter 4 (Protein structure & Function) Biological Substances found in Living Tissues The big four in terms of macromolecules
More informationThe Major Histocompatibility Complex (MHC)
The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens
More informationSignificance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationSAM Teacher s Guide Four Levels of Protein Structure
SAM Teacher s Guide Four Levels of Protein Structure Overview Students explore how protein folding creates distinct, functional proteins by examining each of the four different levels of protein structure.
More informationAntibody-Cytokine- Autoimmune
Antibody-Cytokine- Autoimmune Surasak Wongratanacheewin, Ph.D Dean, Graduate School, KKU Microbiology, Faculty of Medicine, KKU sura_wng@kku.ac.th การอบรมหล กส ตรประกาศน ยบ ตรการข นทะเบ ยนช วว ตถ ว นท
More information!"#$%&' (#%) /&'(2+"( /&3&4,, ! " #$% - &'()!% *-sheet -(!-Helix - &'(&') +,(-. - &'()&+) /&%.(0&+(! - &'(1&2%( Basic amino acids
Basic amino acids pk ~ 10.5 pk ~ 12.5 pk ~ 6.0 Polar 25!"#$%&' (#%)! " #$% - &'()!% *-sheet -(!-Helix - &'(&') +,(-. - &'()&+) /&%.(0&+(! - &'(1&2%( /&'(2+"( /&3&4,, :++55 ('&.! 6($.(" 40 > 3&4,, ('&.!
More informationNomenclature of the Human Immunoglobulin Lambda (IGL) Genes
Locus in Focus Exp Clin Immunogenet 2001;18:242 254 Received: March 17, 2001 Nomenclature of the Human Immunoglobulin Lambda (IGL) Genes Marie-Paule Lefranc Nomenclature Committee, CNRS, Université Montpellier
More informationWHY IS THIS IMPORTANT?
CHAPTER 2 FUNDAMENTAL CHEMISTRY FOR MICROBIOLOGY WHY IS THIS IMPORTANT? An understanding of chemistry is essential to understand cellular structure and function, which are paramount for your understanding
More informationAntibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity
Antibodies and T Cell Receptor Genetics 2008 Peter Burrows 4-6529 peterb@uab.edu Generation of Antigen Receptor Diversity Survival requires B and T cell receptor diversity to respond to the diversity of
More informationOrganic Compounds. Compounds that contain CARBON are called organic. Macromolecules are large organic molecules.
Macromolecules 1 Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. 2 Carbon (C) Carbon has 4 electrons in outer shell. Carbon can form covalent
More informationA. Lipids: Water-Insoluble Molecules
Biological Substances found in Living Tissues Lecture Series 3 Macromolecules: Their Structure and Function A. Lipids: Water-Insoluble Lipids can form large biological molecules, but these aggregations
More informationHelminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii. Ringworm fungus HIV Influenza
Helminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii Ringworm fungus HIV Influenza Candida Staph aureus Mycobacterium tuberculosis Listeria Salmonella Streptococcus Levels
More informationBiology 2E- Zimmer Protein structure- amino acid kit
Biology 2E- Zimmer Protein structure- amino acid kit Name: This activity will use a physical model to investigate protein shape and develop key concepts that govern how proteins fold into their final three-dimensional
More informationA look at macromolecules (Text pages 38-54) What is the typical chemical composition of a cell? (Source of figures to right: Madigan et al.
A look at macromolecules (Text pages 38-54) What is the typical chemical composition of a cell? (Source of figures to right: Madigan et al. 2002 Chemical Bonds Ionic Electron-negativity differences cause
More informationMajor Histocompatibility Complex (MHC) and T Cell Receptors
Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC
More informationMost life processes are a series of chemical reactions influenced by environmental and genetic factors.
Biochemistry II Most life processes are a series of chemical reactions influenced by environmental and genetic factors. Metabolism the sum of all biochemical processes 2 Metabolic Processes Anabolism-
More informationHonors Biology Chapter 3: Macromolecules PPT Notes
Honors Biology Chapter 3: Macromolecules PPT Notes 3.1 I can explain why carbon is unparalleled in its ability to form large, diverse molecules. Diverse molecules found in cells are composed of carbon
More information1. Describe the difference between covalent and ionic bonds. What are the electrons doing?
Exam 1 Review Bio 212: 1. Describe the difference between covalent and ionic bonds. What are the electrons doing? 2. Label each picture either a Carbohydrate, Protein, Nucleic Acid, or Fats(Lipid). a.
More informationCh5: Macromolecules. Proteins
Ch5: Macromolecules Proteins Essential Knowledge 4.A.1 The subcomponents of biological molecules and their sequence determine the properties of that molecule A. Structure and function of polymers are derived
More informationBiology 5A Fall 2010 Macromolecules Chapter 5
Learning Outcomes: Macromolecules List and describe the four major classes of molecules Describe the formation of a glycosidic linkage and distinguish between monosaccharides, disaccharides, and polysaccharides
More informationCELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM.
!! www.clutchprep.com CONCEPT: OVERVIEW OF HOST DEFENSES The human body contains three lines of against infectious agents (pathogens) 1. Mechanical and chemical boundaries (part of the innate immune system)
More informationLesson 5 Proteins Levels of Protein Structure
Lesson 5 Proteins Levels of Protein Structure Primary 1º Structure The primary structure is simply the sequence of amino acids in a protein. Chains of amino acids are written from the amino terminus (N-terminus)
More informationProteins. (b) Protein Structure and Conformational Change
Proteins (b) Protein Structure and Conformational Change Protein Structure and Conformational Change Proteins contain the elements carbon (C), hydrogen (H), oxygen (O2) and nitrogen (N2) Some may also
More informationmembrane form secreted form 13 aa 26 aa K K V V K K 3aa
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai secreted form membrane form 13 aa 26 aa K K V V K K 3aa Hapten monosaccharide
More informationThe Building blocks of life. Macromolecules
The Building blocks of life Macromolecules 1 copyright cmassengale 2 Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. 3 LIFE ON EARTH IS CARBON-BASED
More informationIntroduction. Introduction. Lymphocyte development (maturation)
Introduction Abbas Chapter 8: Lymphocyte Development and the Rearrangement and Expression of Antigen Receptor Genes Christina Ciaccio, MD Children s Mercy Hospital January 5, 2009 Lymphocyte development
More informationObjective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
More informationProteins consist of joined amino acids They are joined by a Also called an Amide Bond
Lecture Two: Peptide Bond & Protein Structure [Chapter 2 Berg, Tymoczko & Stryer] (Figures in Red are for the 7th Edition) (Figures in Blue are for the 8th Edition) Proteins consist of joined amino acids
More informationChem Lecture 2 Protein Structure
Chem 452 - Lecture 2 Protein Structure 110923 Proteins are the workhorses of a living cell and involve themselves in nearly all of the activities that take place in a cell. Their wide range of structures
More informationBasic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction
Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.
More informationCorso di Immunologia A.A Immunoglobuline. Struttura e Funzione
Corso di Immunologia A.A. 2009-10 Immunoglobuline Struttura e Funzione 1 Definitions Immunoglobulins (Ig) - Glycoprotein molecules which are produced by plasma cells in response to an immunogen and which
More informationSupplementary Information
Supplementary Information Two common structural motifs for TCR recognition by staphylococcal enterotoxins Karin Erica Johanna Rödström 1, Paulina Regenthal 1, Christopher Bahl 2, Alex Ford 2, David Baker
More informationThe Structure and Function of Macromolecules
The Structure and Function of Macromolecules Macromolecules are polymers Polymer long molecule consisting of many similar building blocks. Monomer the small building block molecules. Carbohydrates, proteins
More informationBiological Molecules. Carbohydrates, Proteins, Lipids, and Nucleic Acids
Biological Molecules Carbohydrates, Proteins, Lipids, and Nucleic Acids Organic Molecules Always contain Carbon (C) and Hydrogen (H) Carbon is missing four electrons Capable of forming 4 covalent bonds
More informationAP BIOLOGY: READING ASSIGNMENT FOR CHAPTER 5
1) Complete the following table: Class Monomer Functions Carbohydrates 1. 3. Lipids 1. 3. Proteins 1. 3. 4. 5. 6. Nucleic Acids 1. 2) Circle the atoms of these two glucose molecules that will be removed
More informationUnit 3: Chemistry of Life Mr. Nagel Meade High School
Unit 3: Chemistry of Life Mr. Nagel Meade High School IB Syllabus Statements 3.2.1 Distinguish between organic and inorganic compounds. 3.2.2 Identify amino acids, glucose, ribose and fatty acids from
More informationTEMA 5. ANTICUERPOS Y SUS RECEPTORES
TEMA 5. ANTICUERPOS Y SUS RECEPTORES The B-cell antigen receptor (left) consists of two identical heavy (H) chains and two identical light (L) chains. In addition, secondary components (Ig-α and Ig-β)
More informationCrystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen
Crystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen David Lutje Hulsik Unit for Virus Host Cell Interaction UMI 3265 University Joseph Fourier-EMBL-CNRS, Grenoble Env catalyzed
More informationAntibody Structure and Function*
Antibody Structure and Function* Jeffrey K. Actor, Ph.D. Pathology and Laboratory Medicine The University of Texas-Houston Medical School * Special thanks to Dr. L. Scott Rodkey, Ph.D. Anatomy and Physiology
More informationPhenylketonuria (PKU) Structure of Phenylalanine Hydroxylase. Biol 405 Molecular Medicine
Phenylketonuria (PKU) Structure of Phenylalanine Hydroxylase Biol 405 Molecular Medicine 1998 Crystal structure of phenylalanine hydroxylase solved. The polypeptide consists of three regions: Regulatory
More informationLevels of Protein Structure:
Levels of Protein Structure: PRIMARY STRUCTURE (1 ) - Defined, non-random sequence of amino acids along the peptide backbone o Described in two ways: Amino acid composition Amino acid sequence M-L-D-G-C-G
More informationProtein Classification based upon Biological functions
PROTEINS (a) The light produced by fireflies is the result of a reaction involving the protein luciferin and ATP, catalyzed by the enzyme luciferase. (b) Erythrocytes contain large amounts of the oxygen-transporting
More informationChapter 5: The Structure and Function of Large Biological Molecules
Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called
More informationChapter 5: The Structure and Function of Large Biological Molecules
Chapter 5: The Structure and Function of Large Biological Molecules 1. Name the four main classes of organic molecules found in all living things. Which of the four are classified as macromolecules. Define
More informationκ λ Antigen-Independent B-Cell Development Bone Marrow Ordered Rearrangement of Ig Genes During B-Cell Development in the Bone Marrow
Antigen-Independent B-Cell Development Bone Marrow 1. DNA rearrangements establish the primary repertoire, creating diversity 2. Allelic exclusion ensures that each clone expresses a single antibody on
More information! Proteins are involved functionally in almost everything: " Receptor Proteins - Respond to external stimuli. " Storage Proteins - Storing amino acids
Proteins Most structurally & functionally diverse group! Proteins are involved functionally in almost everything: Proteins Multi-purpose molecules 2007-2008 Enzymatic proteins - Speed up chemical reactions!
More informationSupplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.
Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG
More informationthe HLA complex Hanna Mustaniemi,
the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important
More informationSupporting Information
Supporting Information McCullough et al. 10.1073/pnas.0801567105 A α10 α8 α9 N α7 α6 α5 C β2 β1 α4 α3 α2 α1 C B N C Fig. S1. ALIX Bro1 in complex with the C-terminal CHMP4A helix. (A) Ribbon diagram showing
More informationBiochemistry Macromolecules and Enzymes. Unit 02
Biochemistry Macromolecules and Enzymes Unit 02 Organic Compounds Compounds that contain CARBON are called organic. What is Carbon? Carbon has 4 electrons in outer shell. Carbon can form covalent bonds
More informationPrevious Class. Today. Detection of enzymatic intermediates: Protein tyrosine phosphatase mechanism. Protein Kinase Catalytic Properties
Previous Class Detection of enzymatic intermediates: Protein tyrosine phosphatase mechanism Today Protein Kinase Catalytic Properties Protein Phosphorylation Phosphorylation: key protein modification
More informationBiological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:
More informationIgCLL group activities in 2009 and beyond. Kostas Stamatopoulos Hematology Department and HCT Unit George Papanicolaou Hospital, Thessaloniki, Greece
IgCLL group activities in 2009 and beyond Kostas Stamatopoulos Hematology Department and HCT Unit George Papanicolaou Hospital, Thessaloniki, Greece Troubleshooting Standardization Standardization and
More informationANTIBODIES Jiri Mestecky, M.D., Ph.D. - Lecturer
ANTIBODIES Jiri Mestecky, M.D., Ph.D. - Lecturer Distribution in body fluids: secretions plasma (serum), tears, saliva, milk, genitourinary, and intestinal Cells producing antibodies and their tissue distribution:
More informationChp 2 (cont.) Organic Molecules. Spider s web and close up of capture strand - spider silk protein
Chp 2 (cont.) Organic Molecules Spider s web and close up of capture strand - spider silk protein 1! Molecular Diversity is Based on Carbon An organic molecule contains both carbon and hydrogen. Ex: Methane
More informationQ1: Circle the best correct answer: (15 marks)
Q1: Circle the best correct answer: (15 marks) 1. Which one of the following incorrectly pairs an amino acid with a valid chemical characteristic a. Glycine, is chiral b. Tyrosine and tryptophan; at neutral
More informationMethionine (Met or M)
Fig. 5-17 Nonpolar Fig. 5-17a Nonpolar Glycine (Gly or G) Alanine (Ala or A) Valine (Val or V) Leucine (Leu or L) Isoleucine (Ile or I) Methionine (Met or M) Phenylalanine (Phe or F) Polar Trypotphan (Trp
More informationPartial versus Productive Immunoglobulin Heavy Locus Rearrangements in Chronic Lymphocytic Leukemia: Implications for B-Cell Receptor Stereotypy
Partial versus Productive Immunoglobulin Heavy Locus Rearrangements in Chronic Lymphocytic Leukemia: Implications for B-Cell Receptor Stereotypy Eugenia Tsakou, 1,2 Andreas Agathagelidis, 3,4 Myriam Boudjoghra,
More informationA HLA-DRB supertype chart with potential overlapping peptide binding function
A HLA-DRB supertype chart with potential overlapping peptide binding function Arumugam Mohanapriya 1,2, Satish Nandagond 1, Paul Shapshak 3, Uma Kangueane 1, Pandjassarame Kangueane 1, 2 * 1 Biomedical
More informationthe nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma
More informationMacrophage Activation & Cytokine Release. Dendritic Cells & Antigen Presentation. Neutrophils & Innate Defense
Macrophage Activation & Cytokine Release Dendritic Cells & Antigen Presentation Neutrophils & Innate Defense Neutrophils Polymorphonuclear cells (PMNs) are recruited to the site of infection where they
More informationIMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS
LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the
More informationProteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
More informationAP Biology Protein Structure and Enzymes
AP Biology Protein Structure and Enzymes Connection to the Nitrogen-cycle Amino acids (protein) Nucleic acids (RNA and DNA) ATP 78% 1. Assimilation of nitrate by photosynthetic eukaryotes 2. Nitrogen fixation
More informationبسم هللا الرحمن الرحيم. Immunology lecture 7
بسم هللا الرحمن الرحيم Immunology lecture 7 Last time we studied the B cell receptor which is IgM & IgD. Today we will talk about the T Cell Receptor which is the TCR #TCR: it is the receptor that belongs
More informationChemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
More information