The Human T Cell Receptor Alpha Variable (TRAV) Genes

The Human T Cell Receptor Alpha Joining (TRAJ) Genes

IMGT Locus in Focus Exp Clin Immunogenet 2000;17:97 106 Received: October 15, 1999 The Human T Cell Receptor Alpha Joining (TRAJ) Genes Dominique Scaviner Marie-Paule Lefranc Laboratoire d ImmunoGénétique

The Human T cell Receptor Beta Variable (TRBV) Genes

IMGT Locus in Focus Exp Clin Immunogenet 2000;17:42 54 Received: July 3, 1999 The Human T cell Receptor Beta Variable (TRBV) Genes Géraldine Folch Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire,

The Human T Cell Receptor Beta Diversity (TRBD) and Beta Joining (TRBJ) Genes

IMGT Locus in Focus Exp Clin Immunogenet 2000;17:107 114 Received: October 15, 1999 The Human T Cell Receptor Beta Diversity (TRBD) and Beta Joining (TRBJ) Genes Géraldine Folch Marie-Paule Lefranc Laboratoire

The Human Immunoglobulin Heavy Variable Genes

IMGT Locus on Focus Exp Clin Immunogenet 1999;16:36 60 Received: September 25, 1998 The Human Immunoglobulin Heavy Variable Genes Nathalie Pallarès a Sophie Lefebvre a Valérie Contet a Fumihiko Matsuda

The Teleostei Immunoglobulin Heavy IGH Genes

IMGT Locus in Focus Exp Clin Immunogenet 2000;17:148 161 Received: November 19, 1999 The Teleostei Immunoglobulin Heavy IGH Genes Sylvaine Artéro Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire,

The Human Immunoglobulin Kappa Variable (IGKV) Genes and Joining (IGKJ) Segments

IMGT Locus on Focus Exp Clin Immunogenet 1998;15:171 183 Received: June 13, 1998 Valérie Barbié Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire, CNRS, Université Montpellier II, Montpellier,

Nomenclature of the Human Immunoglobulin Lambda (IGL) Genes

Locus in Focus Exp Clin Immunogenet 2001;18:242 254 Received: March 17, 2001 Nomenclature of the Human Immunoglobulin Lambda (IGL) Genes Marie-Paule Lefranc Nomenclature Committee, CNRS, Université Montpellier

Nomenclature of the Human Immunoglobulin Heavy (IGH) Genes

Locus in Focus Exp Clin Immunogenet 2001;18:100 116 Received: August 31, 2000 Nomenclature of the Human Immunoglobulin Heavy (IGH) Genes Marie-Paule Lefranc Chairperson, Nomenclature Committee, CNRS, Université

IMGT Collier de Perles: the New Look for IgSF and MhcSF in IMGT

IMGT Collier de Perles: the New Look for IgSF and MhcSF in IMGT Quentin Kaas and Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire Université Montpellier, UPR CNRS 1142, IGH Institut Universitaire

Immunoglobulin light chain repertoire in chronic lymphocytic leukemia

NEOPLASIA Immunoglobulin light chain repertoire in chronic lymphocytic leukemia Kostas Stamatopoulos, Chrysoula Belessi, Anastasia Hadzidimitriou, Tatjana Smilevska, Evangelia Kalagiakou, Katerina Hatzi,

Profiling immunoglobulin repertoires across multiple human tissues by RNA sequencing

Profiling immunoglobulin repertoires across multiple human tissues by RNA sequencing SergheiMangul, Igor Mandric, Harry Taegyun Yang, NicolasStrauli, Dennis Montoya, Jeremy Rotman, Will Van Der Wey, Jiem

Partial versus Productive Immunoglobulin Heavy Locus Rearrangements in Chronic Lymphocytic Leukemia: Implications for B-Cell Receptor Stereotypy

Partial versus Productive Immunoglobulin Heavy Locus Rearrangements in Chronic Lymphocytic Leukemia: Implications for B-Cell Receptor Stereotypy Eugenia Tsakou, 1,2 Andreas Agathagelidis, 3,4 Myriam Boudjoghra,

IgCLL group activities in 2009 and beyond. Kostas Stamatopoulos Hematology Department and HCT Unit George Papanicolaou Hospital, Thessaloniki, Greece

IgCLL group activities in 2009 and beyond Kostas Stamatopoulos Hematology Department and HCT Unit George Papanicolaou Hospital, Thessaloniki, Greece Troubleshooting Standardization Standardization and

Stereotyped B Cell Receptors in Chronic Lymphocytic Leukaemia

Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 405 Stereotyped B Cell Receptors in Chronic Lymphocytic Leukaemia Implications for Antigen Selection in Leukemogenesis

Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Scope The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal

Biomarkers in Chronic Lymphocytic Leukemia: the art of synthesis. CLL Immunogenetics. Overview. Anastasia Chatzidimitriou

Biomarkers in Chronic Lymphocytic Leukemia: the art of synthesis CLL Immunogenetics Overview Anastasia Chatzidimitriou Belgrade March 17, 2018 B cells: multiple receptors B cell receptor IG unique signature

Fusion proteins for immune applications (FPIA)

Fusion proteins for immune applications (FPIA) Marie-Paule Lefranc IMGT, the international ImMunoGeneTics information system http://www.imgt.org Fusion proteins for immune applications (FPIA) Fusion proteins

Immunoglobulin diversity gene usage predicts unfavorable outcome in a subset of chronic lymphocytic leukemia patients

Research article Immunoglobulin diversity gene usage predicts unfavorable outcome in a subset of chronic lymphocytic leukemia patients Renee C. Tschumper, 1 Susan M. Geyer, 2 Megan E. Campbell, 2 Neil

Submitted to Leukemia as a Letter to the Editor, May Male preponderance in chronic lymphocytic leukemia utilizing IGHV 1-69.

Submitted to Leukemia as a Letter to the Editor, May 2007 To the Editor, Leukemia :- Male preponderance in chronic lymphocytic leukemia utilizing IGHV 1-69. Gender plays an important role in the incidence,

Intraclonal Cell Expansion and Selection Driven by B Cell Receptor in Chronic Lymphocytic Leukemia

Intraclonal Cell Expansion and Selection Driven by B Cell Receptor in Chronic Lymphocytic Leukemia Monica Colombo, 1 Giovanna Cutrona, 1,2 Daniele Reverberi, 1 Sonia Fabris, 3 Antonino Neri, 3 Marina Fabbi,

The development of clonality testing for lymphomas in the Bristol Genetics Laboratory. Dr Paula Waits Bristol Genetics Laboratory

The development of clonality testing for lymphomas in the Bristol Genetics Laboratory Dr Paula Waits Bristol Genetics Laboratory Introduction The majority of lymphoid malignancies belong to the B cell

Hepatitis B virus-associated diffuse large B-cell lymphoma: unique clinical features, poor outcome, and hepatitis B surface antigen-driven origin

/, Vol. 6, No. 28 Hepatitis B virus-associated diffuse large B-cell lymphoma: unique clinical features, poor outcome, and hepatitis B surface antigen-driven origin Lijuan Deng 1, Yuqin Song 1, Ken H. Young

An Immunogenetic Signature of Ongoing Antigen Interactions in Splenic Marginal Zone Lymphoma Expressing IGHV Receptors

Biology of Human Tumors An Immunogenetic Signature of Ongoing Antigen Interactions in Splenic Marginal Zone Lymphoma Expressing IGHV1-2 04 Receptors Vasilis Bikos 1,2, Maria Karypidou 1,3, Evangelia Stalika

Stereotyped B-cell receptors in one-third of chronic lymphocytic leukemia: a molecular classification with implications for targeted therapies

LYMPHOID NEOPLASIA Stereotyped B-cell receptors in one-third of chronic lymphocytic leukemia: a molecular classification with implications for targeted therapies Andreas Agathangelidis, 1 Nikos Darzentas,

membrane form secreted form 13 aa 26 aa K K V V K K 3aa

Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai secreted form membrane form 13 aa 26 aa K K V V K K 3aa Hapten monosaccharide

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10495 WWW.NATURE.COM/NATURE 1 2 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 3 4 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 5 6 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 7 8 WWW.NATURE.COM/NATURE

MBL in Blood Donors: An Extended Immunophenotypic Analysis of CLL-like, CD5+ MBL.

1 th Canadian CLL Meeting Winnipeg, Manitoba Inn at the Forks September 18-19, 214 MBL in Blood Donors: An Extended Immunophenotypic Analysis of CLL-like, CD5+ MBL. Fatima Abbasi 1, Justin Meskas 2, Ryan

Comprehensive translocation and clonality detection in lymphoproliferative disorders by next generation sequencing

Comprehensive translocation and clonality detection in lymphoproliferative disorders by next generation sequencing Wren, D., Walker, B. A., Bruggemann, M., Catherwood, M. A., Pott, C., Stamatopoulos, K.,...

Peanut oral immunotherapy transiently expands circulating Ara h 2 specific B cells with a homologous repertoire in unrelated subjects

Peanut oral immunotherapy transiently expands circulating Ara h 2 specific B cells with a homologous repertoire in unrelated subjects The MIT Faculty has made this article openly available. Please share

Dumpster diving in RNA-Seq to find the source of 1 trillion reads across adult human tissues

Dumpster diving in RNA-Seq to find the source of 1 trillion reads across adult human tissues Serghei Mangul University of California, Los Angeles Eskin Lab (ZarLab) http://www.sergheimangul.com/ @serghei_mangul

Evidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire

Evidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire Geoffrey M. Lowman, PhD Senior Staff Scientist EACR - 02 July 2018 For Research Use Only. Not for use in diagnostic

Primary cutaneous B cell lymphomas (PCBCL) occur in

Primary Cutaneous Follicle Center Cell Lymphomas and Large B Cell Lymphomas of the Leg Descend from Germinal Center Cells. A Single Cell Polymerase Chain Reaction Analysis Sylke Gellrich, Sascha Rutz,

A HLA-DRB supertype chart with potential overlapping peptide binding function

A HLA-DRB supertype chart with potential overlapping peptide binding function Arumugam Mohanapriya 1,2, Satish Nandagond 1, Paul Shapshak 3, Uma Kangueane 1, Pandjassarame Kangueane 1, 2 * 1 Biomedical

Role of liquid biopsies and circulating tumor DNA. Pierre Laurent-Puig European Georges Pompidou Hospital Paris Descartes University

Role of liquid biopsies and circulating tumor DNA Pierre Laurent-Puig European Georges Pompidou Hospital Paris Descartes University DISCLOSURE AMGEN ASTRAZENECA BIOCARTIS BOERINGHER INGELHEIM INTEGRAGEN

LU:research Institutional Repository of Lund University

LU:research Institutional Repository of Lund University This is an author produced version of a paper published in The Journal of allergy and clinical immunology. This paper has been peer-reviewed but

PhD in Immunology Institut Pasteur / Paris Diderot University / B3MI, Paris, France

Hélène D. Moreau Postdoctoral fellow Spatio-temporal regulation of antigen presentation Unit, INSERM U932 Institut Curie, 12 rue Lhomond, 75005 Paris, France. +33 (0) 1.56.24.68.06 - helene.moreau@curie.fr

Dietary intake profile among Tunisians school children having iodine deficiency or excess

Dietary intake profile among Tunisians school children having R. Doggui* 1, M. El Ati-Hellal 2, P. Traissac 3, H. Ben Gharbia 4, J. El Ati 1 1 Institut National de Nutrition et de Technologie Alimentaire,

Development of B and T lymphocytes

Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell

The ineffectiveness of human immunodeficiency virus (HIV)

Neutralizing Capacity of Monoclonal Antibodies That Recognize Peptide Sequences Underlying the Carbohydrates on gp41 of Simian Immunodeficiency Virus José M. Martinez-Navio and Ronald C. Desrosiers Department

Introduction. 8 These authors contributed equally to this work

ARTICLE Complete Haplotype Sequence of the Human Immunoglobulin Heavy-Chain Variable, Diversity, and Joining Genes and Characterization of Allelic and Copy-Number Variation Corey T. Watson, 1,7 Karyn M.

Dedicated to my family

Dedicated to my family List of Papers This thesis is based on the following Papers, which are referred to in the text by their Roman numerals. I Cahill N, Sutton LA, Jansson M, Murray F, Mansouri L, Gunnarsson

ABSTRACT. Original Article

Original Article Molecular analysis of immunoglobulin variable genes in human immunodeficiency virus-related non-hodgkin s lymphoma reveals implications for disease pathogenesis and histogenesis Daniela

Probable involvement of immunoglobulin superfamily genes in most recurrent chromosomal rearrangements from ataxia telangiectasia

Hum Genet (1986) 72 : 210-214 Springer-Verlag 1986 Probable involvement of immunoglobulin superfamily genes in most recurrent chromosomal rearrangements from ataxia telangiectasia A. Aurias and B. Dutrillaux

An innovative multi-dimensional NGS approach to understanding the tumor microenvironment and evolution

An innovative multi-dimensional NGS approach to understanding the tumor microenvironment and evolution James H. Godsey, Ph.D. Vice President, Research & Development Clinical Sequencing Division (CSD) Life

Reply to The question of heterogeneity in Marfan syndrome

Reply to The question of heterogeneity in Marfan syndrome Catherine Boileau, Claudine Junien, Gwenaëlle Collod, Guillaume Jondeau, Olivier Dubourg, Jean-Pierre Bourdarias, Catherine Bonaïti-Pellié, Jean

Applicability of Textual Clinical Practice Guidelines: Impact of Physician Interpretation

545 Applicability of Textual Clinical Practice Guidelines: Impact of Physician Interpretation Jean-Charles Dufour a, Roch Giorgi a, Jean-Robert Harlé b, Dominique Fieschi a, Françoise Volot a, Marius Fieschi

REPORT ON THE RESEARCH UNIT:

Research evaluation REPORT ON THE RESEARCH UNIT: Laboratory for Osteo-Articular Bioengineering and Bioimaging (B2OA) UNDER THE SUPERVISION OF THE FOLLOWING INSTITUTIONS AND RESEARCH BODIES: Université

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response

Ivana FELLNEROVÁ E-mail: fellneri@hotmail.com, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC

Antibody-Cytokine- Autoimmune

Antibody-Cytokine- Autoimmune Surasak Wongratanacheewin, Ph.D Dean, Graduate School, KKU Microbiology, Faculty of Medicine, KKU sura_wng@kku.ac.th การอบรมหล กส ตรประกาศน ยบ ตรการข นทะเบ ยนช วว ตถ ว นท

Translocations and clonality detection in lymphoproliferative disorders by capturebased Next-generation sequencing

Translocations and clonality detection in lymphoproliferative disorders by capturebased Next-generation sequencing Dörte Wren MSc MPhil on behalf of the EuroClonality-NGS consortium Molecular Diagnostics

Author Manuscript Faculty of Biology and Medicine Publication

Serveur Académique Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication This paper has been peer-reviewed but dos not include the final publisher proof-corrections

Dietary fat and the risk of age-related maculopathy: the POLANUT Study.

Dietary fat and the risk of age-related maculopathy: the POLANUT Study. Cécile Delcourt, Isabelle Carrière, Jean-Paul Cristol, Annie Lacroux, Mariette Gerber, Polanut Study Group To cite this version:

Comprehensive assessment of T-cell receptor -chain diversity in T cells

IMMUNOBIOLOGY Comprehensive assessment of T-cell receptor -chain diversity in T cells *Harlan S. Robins, 1 *Paulo V. Campregher, 1 *Santosh K. Srivastava, 1 Abigail Wacher, 1 Cameron J. Turtle, 1,2 Orsalem

T cell Receptor. Chapter 9. Comparison of TCR αβ T cells

Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain

Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU

Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU Lecture outline Time 10:00 11:00 11:15 12:10 12:20 13:15 Content Introduction to lymphoma Review of lymphocyte biology

Immunoglobulin gene rearrangements in Chinese and Italian patients with chronic lymphocytic leukemia

Title Author(s) Immunoglobulin gene rearrangements in Chinese and Italian patients with chronic lymphocytic leukemia Marinelli, M; Ilari, I; Xia, Y; Giudice, ID; Cafforio, L; Starza, ID; Raponi, S; Mariglia,

0a)le of contents. E ecutive Summary. Goals. MyPeBS in short. Consortium. Participants. Contact us

Octo)er 8 0a)le of contents E ecutive Summary Conte t Goals MyPeBS in short 05 Consortium Participants Contact us Octo)er 8 Executive summary MyPeBS is an innovative international research project, funded

Patient Identification: Patient Name (first, middle, last)

Patient Identification: Patient Name (first, middle, last) Patient s USIDNET Registry Number assigned after online enrollment Date of Birth / / (mm/dd/yyyy) or Year of Birth Gender: male [ ], female [

REPORT ON THE RESEARCH UNIT:

Research evaluation REPORT ON THE RESEARCH UNIT: Physiopathology and Epidemiology of Respiratory Diseases (PHERE) UNDER THE SUPERVISION OF THE FOLLOWING INSTITUTIONS AND RESEARCH BODIES: Université Paris

Spontaneous Control of Viral Replication during Primary HIV Infection: When Is HIV Controller Status Established?

HIV/AIDS BRIEF REPORT Spontaneous Control of Viral Replication during Primary HIV Infection: When Is HIV Controller Status Established? Cécile Goujard, 1,2 Marie-Laure Chaix, 3 Olivier Lambotte, 1,2 Christiane

Antigen Receptor Structures October 14, Ram Savan

Antigen Receptor Structures October 14, 2016 Ram Savan savanram@uw.edu 441 Lecture #8 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Today): Structural features of the BCR and TCR Janeway Chapter

ESEMeD/MHEDEA The European Study of the Epidemiology of Mental Disorders/Mental Health Disability : a

ESEMeD/MHEDEA 2000 - The European Study of the Epidemiology of Mental Disorders/Mental Health Disability : a European Assessment in the year 2000 (ESEMeD/MHEDEA 2000) Head : Kovess-Masfety Viviane, INSERM

SUPPLEMENTARY DATA. Biologie and Pathology, Grenoble, France,

SUPPLEMENTARY DATA MitoCeption as a new tool to assess the effects of mesenchymal stem/stromal cell mitochondria on cancer cell metabolism and functions Andrés Caicedo a,b, Vanessa Fritz c, Jean-Marc Brondello

The French breast cancer screening programme. Epidemiological and economic results of the first round of screening

EUROPEAN JOURNAL OF PUBLIC HEALTH 1996; 6: 43-48 The French breast cancer screening programme Epidemiological and economic results of the first round of screening SUZANNE H. WAIT, HUBERT M. ALLEMAND *

Antigen selection in the IgE response of allergic and nonallergic individuals

Antigen selection in the IgE response of allergic and nonallergic individuals Isabell Dahlke, PhD, a David J. Nott, PhD, a,b John Ruhno, MBBS FRACP, c William A. Sewell, MBBS PhD, d and Andrew M. Collins,

Chapter 5. Generation of lymphocyte antigen receptors

Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of

Combining Calcium Phosphates with Polysaccharides: A Bone Inspired Material Modulating Monocyte/Macrophage Early Inflammatory Response

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Type of the Paper (Article) Combining Calcium Phosphates with Polysaccharides: A Bone Inspired Material Modulating Monocyte/Macrophage

Current practice, needs and future directions in immuno-oncology research testing

Current practice, needs and future directions in immuno-oncology research testing Jose Carlos Machado IPATIMUP - Porto, Portugal ESMO 2017- THERMO FISHER SCIENTIFIC SYMPOSIUM Immune Therapies are Revolutionizing

Immunoglobulin Gene Analysis in Chronic Lymphocytic Leukemia

Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1360 Immunoglobulin Gene Analysis in Chronic Lymphocytic Leukemia Characterization of New Prognostic and Biological Subsets

Detection of Burkitt Lymphoma immunoglobulin rearrangements in blood may have prognostic value

Detection of Burkitt Lymphoma immunoglobulin rearrangements in blood may have prognostic value Katharine Lombardo Fred Hutchinson Cancer Research Center 1 Outline B cell receptor in normal cells and in

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

Molecular Diagnosis. Nucleic acid based testing in Oncology

Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,

Nature Genetics: doi: /ng Supplementary Figure 1. Workflow of CDR3 sequence assembly from RNA-seq data.

Supplementary Figure 1 Workflow of CDR3 sequence assembly from RNA-seq data. Paired-end short-read RNA-seq data were mapped to human reference genome hg19, and unmapped reads in the TCR regions were extracted

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG

Nucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis

Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor

Use of MYC, BCL2 and BCL6 FISH for investigations of high grade B cell lymphoma

Use of MYC, BCL2 and BCL6 FISH for investigations of high grade B cell lymphoma Dr Anthony Bench Haematopathology and Oncology Diagnostic Service Cambrıdge Unıversıty Hospitals NHS Foundatıon Trust Cambridge

Dietary fat and the risk of age-related maculopathy : the POLANUT

Author manuscript, published in "European Journal of Clinical Nutrition 00;():-" DOI :./sj.ejcn. Dietary fat and the risk of age-related maculopathy : the POLANUT Study Cécile Delcourt, Isabelle Carrière,

How can retailers support national nutrition campaigns? National Nutrition Health Programme «PNNS» ( ) Stakes and proposals.

1 How can retailers support national nutrition campaigns? 2 PNNS : National Nutrition Health Programme National Nutritional Health Programme Offering consumer choice Training Public health policy Le Programme

A novel research program on traumatic memories

PRESS RELEASE I PARIS I 17 JUNE 2016 A novel research program on traumatic memories How will the traumatic events of the terrorist attacks of 13 November 2015 evolve in people s memories, whether collective

B-cell chronic lymphocytic leukemia (CLL) is characterized

Chronic Lymphocytic Leukemia VH gene usage differs in germline and mutated B-cell chronic lymphocytic leukemia VERONIQUE M. DUKE, DOMENICA GANDINI, PAUL D. SHERRINGTON, KE LIN, BRIDGET HEELAN, PETER AMLOT,

Evidence for Ebola virus superantigen activity

JVI Accepts, published online ahead of print on 9 February 2011 J. Virol. doi:10.1128/jvi.00181-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

Abstract. Available online commentary review reports primary research

Primary research BRCA1 and BRCA2 protein expressions in an ovotestis of a 46, XX true hermaphrodite Dominique J Bernard-Gallon*, Pierre Déchelotte, Cécile Vissac*, Bénédicte Aunoble*, Laetitia Cravello*,

CRITICAL APPRAISAL OF THE SPINE LITERATURE: THE FUNDAMENTALS FINAL PROGRAMME

CRITICAL APPRAISAL OF THE SPINE LITERATURE: THE FUNDAMENTALS FINAL PROGRAMME QUICK FACTS WHEN: January 11, 2018 WHERE: Institut Franco-Européen de Chiropraxie (IFEC), 72 chemin de la Flambère, 31300 Toulouse,

Managing Continuity through Collaborative Care Plans: A Study of Palliative Care Patients

Managing Continuity through Collaborative Care Plans: A Study of Palliative Care Patients June, 2004 Deborah Dudgeon, MD, FRCPC Christine Knott, MSc, PhD (cand.) Ray Viola, MD, MSc, CCFP Janice P. Van

3 rd course on BREAST CANCER: FROM CLINICS TO BIOLOGY June 19-23, 2017 Institut Curie - Training Unit - International Course

08/03/2017 Monday, june 19 th : Clinical management Chair: Roman Rouzier 10:15 Training Unit Welcome: practical aspects & coffee 10:30 11:15 11:15 11:45 Anne Vincent-Salomon & Roman Rouzier Mathilde His

DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS

DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS The definitions below are intended as general concepts. There will be exceptions to these general definitions. These definitions do not imply any specific

arthrosis and coxarthrosis) in the general population and in those treated by spa therapy

ESCAPE - Estimated cost of the lower limb osteoarthrosis (knee arthrosis and coxarthrosis) in the general population and in those treated by spa therapy Head : Moore Nicholas, Service de Pharmacologie,

doi: /brain/awq350 Brain 2011: 134; Related B cell clones populate the meninges and parenchyma of patients with multiple sclerosis

doi:10.1093/brain/awq350 Brain 2011: 134; 534 541 534 BRAIN A JOURNAL OF NEUROLOGY Related B cell clones populate the meninges and parenchyma of patients with multiple sclerosis Laura Lovato, 1,2 Simon

Long-Term Post Transplantation Care. Pathogenesis and Management of Long Term Cardiovascular and Metabolic Complications in Renal Transplantation

3 rd ERA-EDTA CME COURSE Long-Term Post Transplantation Care Pathogenesis and Management of Long Term Cardiovascular and Metabolic Complications in Renal Transplantation What the Non Transplant-Nephrologists

Immunological aspects in chronic lymphocytic leukemia (CLL) development

Ann Hematol (2012) 91:981 996 DOI 10.1007/s00277-012-1460-z REVIEW ARTICLE Immunological aspects in chronic lymphocytic leukemia (CLL) development Ricardo García-Muñoz & Verónica Roldan Galiacho & Luis

Setting up an effective falls prevention assessment and intervention programme : Experiences in the Region Languedoc-Roussillon

Falls prevention: Evidence into Practice European Seminar Glasgow, 19 November 2014 Setting up an effective falls prevention assessment and intervention programme : Experiences in the Region Languedoc-Roussillon

Mathieu Hatt, Dimitris Visvikis. To cite this version: HAL Id: inserm

Defining radiotherapy target volumes using 18F-fluoro-deoxy-glucose positron emission tomography/computed tomography: still a Pandora s box?: in regard to Devic et al. (Int J Radiat Oncol Biol Phys 2010).

Atelier anti-pd1 Recherche de cible

Atelier anti-pd1 Recherche de cible Nathalie Bonnefoy Institut de Recherche en Cancérologie de Montpellier Equipe Immunité et Cancer Nathalie.bonnefoy@inserm.fr Majid Khatib Laboratoire de l'angiogénèse

To understand the human movement, to restore it. and choosing it as a health value

International To understand the human movement, to restore it and choosing it as a health value Presentation Founded in 1968 with the aim to experiment pedagogic novel methods and to improve the physiotherapists

Low-intensity ultrasound (Exogen TM ) for the treatment of fractures

Low-intensity ultrasound (Exogen TM ) for the treatment of fractures SUMMARY AGENCE D ÉVALUATION DES TECHNOLOGIES ET DES MODES D INTERVENTION EN SANTÉ Low-intensity ultrasound (Exogen TM ) for the treatment

The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D.

The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D. OBJECTIVES 1. To understand how ordered Ig gene rearrangements lead to the development

CAPTURE THE FRACTURE

CAPTURE THE FRACTURE Kristina Åkesson, MD, PhD Chair IOF Fracture working group & Capture the fracture Professor, senior consultant Department of Orthopedics, Skane University Hospital SWEDEN Today s Discussion

Air Pollution & mhealth Prevention and Control of Chronic Respiratory Diseases

Air Pollution & mhealth Prevention and Control of Chronic Respiratory Diseases 23 MARCH 2018 Lithuanian Seimas (Parliament) Gedimino Av. 53, Vilnius, Lithuania Organized by: EU Summit 2018 - Vilnius, Lithuania

IHCP bulletin INDIANA HEALTH COVERAGE PROGRAMS BT MARCH 13, 2012

IHCP bulletin INDIANA HEALTH COVERAGE PROGRAMS BT201208 MARCH 13, 2012 Updates to the 2012 Healthcare Common Coding System This bulletin updates information published by the Indiana Health Coverage Programs