Supplementary information S1 (table): Specifications of individual protein protein interactions within the Cbl and Cbl-b interactomes

Size: px
Start display at page:

Download "Supplementary information S1 (table): Specifications of individual protein protein interactions within the Cbl and Cbl-b interactomes"

Transcription

1 Supplementary information S1 (table): Specifications of individual protein protein interactions within the Cbl and Cbl-b interactomes Cbl/Cbl-b binding protein Cbl domain/residue Binding protein domain/residue Indirect (via) Ligand dependency Detection method β, τ, ζ RSxSxP; ps619 + ps623, ps639 + ps C-terminal residues TCR/CD3 engagement, PMA Y2H, IP, GST 3BP2 C-terminal ptyr SH2 TCR/CD3 engagement, PMA GST Abl C-terminal ptyr SH2 TCR/CD3, BCR engagement IP, GST Abl Proline-rich SH3 Constitutive IP Actin Multiple pathways Constitutive and induced IP, GST, IF AIP4/Itch Proline-rich WW Constitutive Y2H, IP APS TKB py618 PDGF IP, APS phosphopeptide pulldown PubMed ID ArgBP2 Proline-rich SH3 B&C Constitutive Y2H, IP B-cell receptor BCR engagement IP, IF BCR Abl ptyr SH2 Y2H, IP Bim?? M-CSF IP, GST, IF Blk C-terminal ptyr SH2 TCR/CD3, BCR engagement IP, GST BLNK TKB py115 BCR engagement GST, far western Bsh??? Y2H Btk Proline-rich ( ) SH3 BCR engagement GST, NMR

2 CAP Proline-rich SH3 C-terminal part of domain Constitutive Y2H, IP, GST Cbl/Cbl-b LZ LZ Constitutive Y2H, IP CD02 CD2AP Inducible IB CD05 TKB DNEpY motif Pervanadate-treated thymocytes IP CD09 Antibody engagement IB CD116 (GM-CSFR) GM-CSF IB CD16 Antibody engagement IB CD19?? p85? IP CD26 IB CD28 integrins? Anti-CD28 receptor antibody IB CD38 Anti-CD38 receptor antibody IB CD40 CD40L IP CD43 Inducible IB CIN85/SETA/RUK C-terminal PXXXPR SH3 A&B&C EGF Y2H, IP, GST CD2AP/CMS C-terminal PXXXPR SH3 A&B&C EGF Y2H, IP, GST c-kit?? Grb2 SCF IP, GST c-met/hgfr TKB py1003 HGF IP

3 c-mp1 (Thrombopoietin R) Grb2 TPO IB Cool-1/βPix C-terminal PXXXPR SH3 Constitutive IP, GST Cool-2/αPix Proline-rich SH3 Constitutive Y2H, IP Crk py700/774 SH2 TCR/CD3 engagement IP, GST CrkII py700/774 SH2 TCR/CD3 engagement IP, GST CrkL Proline-rich SH3 Constitutive GST CrkL py700/774 SH2 TCR/CD3 engagement IP, GST, Far Western CSF1R TKB py-973 CSF IP Csk Indirect IP Cytokeratin 18 Proline-rich ( )?? Y2H Dap160/Intersectin Proline-rich SH3 Ligand dependent Y2H Dynamin Dab160 SH3s A D Ligand dependent IP EGFR TKB py1045 EGF IP Endophilin 1 Proline-rich ( ) SH3 ( )? Spot peptide array screen Endophilin A3 CIN85 Inducible IP, GST, IF

4 EphA2 TKB EphA1 IP, GST EphA3 TKB EphA1 IP EphB4?? EphB2 IP EphB6 TKB? EphB1 IP EpoR APS Epo IB ErbB2 TKB py1112 Ligand dependent IP, IF, GST Ewg??? Y2H FAK Src IP, IF Fas Anti-Fas receptor antibody IB Fcε RI SLP76, Grb2, Shc Antibody engagement IB Fcγ RI, RII, RIII SLP76, Grb2, Shc Antibody engagement IB FGFR 1 3 Grb2 py306 FRS2 FGF IP Fgr C-terminal ptyr SH2 Fibronectin-induced cell adhesion IP Fgr Proline-rich SH3 Constitutive IP Flk-1 TKB VEGF IP Flotillin 1 CAP IP Flt-1 TKB? VEGF IP Flt3 receptor TKB DNEY Flt3 ligand IB FRS2 Proline-rich? Grb2 FGF IP, GST Fyn Proline-rich ( ) SH3 Constitutive IP, GST Fyn/FynT C-term ptyr SH2 TCR/CD3, BCR engagement IP, GST Grb2 Proline-rich ( ) SH3 N-terminal Constitutive IP, GST

5 Hck Proline-rich SH3 Constitutive IP, GST Hck C-terminal ptyr SH2 Induced GST, Far Wstern ICAM-1 cbl-b / mice IL-2R IL-2 IB IL-3R IL-3 IB IL-4R IL-4 IB IL-7R IL-7 IB Insulin receptor APS + CAP Insulin IP, GST, IF Integrins α ΙΙβ, α 4, α V, α 7, α Μ, β 1, β 2, β 3 Multiple pathways Induced IP, IF IRS-1/IRS-2 Insulin IRS-1/IRS-2 knockout mice Itk/Tsk Proline-rich PPPPXXR SH3 Constitutive GST Jak2 Grb2 or APS TPO IP Lck Proline-rich SH3 Cnstitutive GST Lck C-terminal ptyr SH2 TCR/CD3 engagement GST LRIG1 N-terminal half juxtamembrane EGF IP, GST L-selectin Inducible in lymphocytes IB Lyn Proline-rich SH3 Constitutive Y2H, IP, GST Lyn C-terminal ptyr SH2 Induced Y2H Lyp1 TKB Putative PXXpY Constitutive IP

6 Myosin IC Proline-rich ( ) SH3 Y2H Nck Proline-rich SH3 A&B Constitutive IP, Far Western Nedd4 Proline-rich WW Constitutive GST, IP NGFR p75ntr TKB C terminus NGF Y2H, GST Notch1? Intracellular? IP, GST NTAL?? CD3, BCR, Fcγ and Fcε receptor engagement p85α, β Proline-rich SH3 Constitutive GST p85α, β py731 SH2 TCR/CD3, BCR engagement IP, GST Paxillin? N-terminus? Constitutive IP, GST PDGFRα, β TKB py residues DNLY, DNAY (a) DNDY(b) APS (py1021) PDGF IP PKCα /θ C terminus? Constitutive IP, GST PLCγ 1/2 proline rich SH3 Constitutive GST PLCγ 1/2 ptyr Cbl SH2 C-terminal Inducible IP Y2H, IP Prolactin receptor Prolactin IB Pyk2 Src Integrin-inducible IP, IF RNF ? Y2H Ron RTK TKB py py1353 Grb2 py1360 MSP IP, IF Sam68 SFKs Constitutive IP SH3P17 Proline-rich ( ) SH3 Y2H SH3P2 proline rich SH3 Constitutive Y2H, IP SHC Grb2 Induced IP

7 SHIP2?? CAP Constitutive Y2H, IP, GST SHP1 py774 SH2 N-terminal IP SHP2 py Cbl SH2 N-terminal SLP-76 IP, GST SLAP/SLAP2 N terminus (25 351) SLAP: C-terminal hydrophobic region; SLAP2: last C-terminal 70 residues; SLAP2- V does not bind Constitutive SLP76 C terminal/py Cbl Constitutive/FcγRI inducible IP Y2H, IP, GST Sprouty 2 TKB, RING py55 Upon Sprouty 2 induction by ligand Y2H, IP, GST Src TKB py416 Src activation IP Src Proline-rich SH3 Constitutive IP, GST Src C-terminal ptyr SH2 Induced IP, GST Src-viral Proline-rich SH3 Constitutive IP Sts1/Sts2 Proline-rich SH3 Constitutive Y2H, IP Syk TKB py323 TCR/CD3, BCR engagement Y2H, IP, GST, Far Western Syk Proline-rich py317 tubulin Constitutive IP Synapsin I Synaptojanin Dab160 SH3s A B Dab160 SH3s A D Induced IP Talin??? Constitutive IP T-cell receptor TCR/CD3 engagement IP, IF, GST TNFR?? TNFα IB Induced IP TRANCE-R SFKs TRANCE IP

8 Tubulin?? CIN85 Alix or Syk or Vav Constitutive IP, IF, colchicine agarose pulldown TULA Proline-rich SH3 Constitutive IP Tyk2 Proline-rich Constitutive IP Tyk2 IFNα IP Type 1 INFR IFNα, β IB Type 2 INFR IFNγ IB UBC4 RING? Constitutive in vitro UBcH5B/C RING? Constitutive in vitro UbcH7 RING L1 and L2 loops and H1 helix Constitutive Y2H, IP, GST ubiquitin UBA of Cbl-b Hydrophobic patch Constitutive GST Vav1/Vav2 py700 SH2 TCR/CD3 engagement IP, GST, Far Western VCAM-1 Anti-VCAM-1 antibodies IB ZAP-70 TKB py292 TCR/CD3, BCR engagement IP, GST This table characterizes individual interactions of the Cbl/Cbl-b interactome. The first column (Cbl/Cbl-b binding protein) outlines the proteins that have been described to undergo an interaction with Cbl or Cbl-b. The second column (Cbl domain/residue) outlines where the interaction takes place within the Cbl molecule. Please note that this panel exclusively applies to the Cbl molecule, not to Cbl-b. In the case of a direct interaction, the third column (Binding protein domain/residue) identifies the Cbl-binding site within the target molecule. If the interaction is indirect, the protein that mediates the interaction is identified in the fourth column (Indirect (via)). The fifth column (Ligand dependency) describes whether an interaction is constitutive or if it is triggered by a certain stimulus. It also names the stimulus necessary to induce the interaction. The sixth column (Detection method) lists the techniques used to identify a certain interaction, and the last panel (PubMed ID) gives a limited overview on the literature used to compile this dataset. Copying and pasting the ID into PubMed ( directs the reader to the corresponding abstract of the cited article. Please note that the list can only reflect the current knowledge about the Cbl/Cbl-b interactomes. For an updated version of the interactomes please follow the Cbl and

9 Cbl-b interactome links given in the main body of the manuscript. It will take you to the Cbl and Cbl-b interactomes at The Grid, which are permanently under revision. The Osprey program will enable readers to create a more update version of the interactomes there. Acronyms: 3BP2, c-abl-sh3-domain-binding protein-2; AIP4, atrophin-1-interacting protein-4; APS, adaptor protein with pleckstrin homology and SH2 domains; ArgBP2, Arg/Ablbinding protein-2; BCR, B-cell receptor; BLNK, B-cell linker; CAP, c-cbl-associated protein; CD2AP, CD2-associated protein; CMS, Cas ligand with multiple SH3 domains; CrkL, Crk ligand; CSF, colony-stimulating factor; CSF-1R, CSF-1 receptor; EGF, epidermal growth factor receptor; EGFR, EGF receptor; Epo, erythropoietin; EpoR, Epo receptor; FAK, focal adhesion kinase; FGF, fibroblast growth factor receptor; FGFR, FGF receptor; FRS2, FGFR substrate-2; Grb2, growth-factor-receptorbound-2; GM-CSFR, granulocyte-macrophage CSF receptor; GST, glutathione-s-transferase pulldown; HGF, hepatocyte growth factor; HGFR, HGF receptor; IB, immunoblotting; ICAM-1, intercellular adhesion molecule-1; IF, immunofluorescence; IL, interleukin; IL-R, IL receptor; IFN, interferon; IFNR, IFN receptor; IP, immunoprecipitation; IRS, insulin receptor substrate; Itk, IL-2-inducible T-cell kinase; Jak, Janus kinase; LRIG1, leucine-rich repeats and immunoglobulin-like domains protein-1; LZ, leucine zipper; M-CSF, macrophage CSF; MSP, macrophage-stimulating protein; NGF, nerve growth factor receptor; NGFR, NGF receptor; NMR, nuclear magnetic resonance; NTAL, non-t-cell activation linker; NTR; neurotrophin; PDGF, platelet-derived growth factor; PDGFR, PDGF receptor; PKC, protein kinase C; PLC, phospholipase C; Pix (p21-activated kinase (PAK)-interacting exchange factor; PMA; phorbol 12-myristate 13-acetate; RTK, receptor tyrosine kinase; SCF, stem-cell factor; SETA, SH3 domain-containing gene expressed in tumorigenic astrocytes; SH2, Src-homology-2; SH3, Src-homology-3; SHC, SH2-domain-containing; SFKs, Src-family kinases; SHIP, SH2-containing inositol phosphatase; SHP, SH2-containing phosphatase; SLAP, Src-like adaptor protein; SLP-76, SH2-domain-containing leukocyte protein of 76 kda; TCR, T-cell receptor; TKB, tyrosine kinase-binding; TNF, tumour necrosis factor; TNFR, TNF receptor; TPO, thrombopoietin; TRANCE, TNF-related activation-induced cytokine ; TRANCE-R, TRANCE receptor; Tsk, T-cell-specific kinase; TULA, T cell ubiquitin ligand; UBA, ubiquitin-associated; UBC, ubiquitinconjugating; VCAM, vascular cell adhesion molecule; VEGF, vascular endothelial growth factor; WW, domain with two conserved tryptophan (W) residues; Y2H, yeast two-hybrid; ZAP70, zeta-associated protein of 70 kda.

Signaling Through Immune System Receptors (Ch. 7)

Signaling Through Immune System Receptors (Ch. 7) Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

Protein tyrosine kinase signaling

Protein tyrosine kinase signaling rotein tyrosine kinase signaling Serge ROCHE CRBM CNRS/Montpellier University serge.roche@crbm.cnrs.fr rotein phosphorylation on Tyr A central mechanism to control cell communication in a multicellular

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

Mechanisms of resistance to JAK inhibitors. L. Knoops

Mechanisms of resistance to JAK inhibitors. L. Knoops Mechanisms of resistance to JAK inhibitors L. Knoops 1 : Resistance to tyrosine kinase inhibition in cancer are related in sequence and structure. The main diagram illustrates the similarity between the

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

Tyrosine kinases. Cell surface receptors ligand binding. Producer cell RNA. Target cell

Tyrosine kinases.   Cell surface receptors ligand binding. Producer cell RNA. Target cell Tyrosine kinases http://msbl.helsinki.fi/tkseminar roducer cell Signaling molecules Receptor binding Signal transduction Target cell Activation of Gene expression RNA Biological responses proliferation,

More information

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters

More information

T cell and Cell-mediated immunity

T cell and Cell-mediated immunity T cell and Cell-mediated immunity Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, it School of Medicine i Medical Research Building B815-819 Email: Lu.Linrong@gmail.com

More information

T cell and Cell-mediated immunity

T cell and Cell-mediated immunity T cell and Cell-mediated immunity ( 第十章 第十二章第十二章 ) Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, School of Medicine Medical Research Building B815-819

More information

Review Article The Role of Suppressors of Cytokine Signalling in Human Neoplasms

Review Article The Role of Suppressors of Cytokine Signalling in Human Neoplasms Molecular Biology International, Article ID 630797, 24 pages http://dx.doi.org/10.1155/2014/630797 Review Article The Role of Suppressors of Cytokine Signalling in Human Neoplasms Walid Sasi, 1 Anup K.

More information

THE HALLMARKS OF CANCER

THE HALLMARKS OF CANCER THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated

More information

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow. Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

More information

Signal Transduction I

Signal Transduction I Signal Transduction I Prof. Tianhua Zhou Department of Cell Biology Zhejiang University School of Medicine Office hours by appointment tzhou@zju.edu.cn Signal transduction: Key contents for signal transduction:

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM

CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM CD43: the molecule and its signaling capacities favors a Th1 differentiation pattern and contributes

More information

Chapter 15: Signal transduction

Chapter 15: Signal transduction Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Signal transduction by immunoglobulin Fc receptors

Signal transduction by immunoglobulin Fc receptors Signal transduction by immunoglobulin Fc receptors Gabriela Sánchez-Mejorada and Carlos Rosales Immunology Department, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México,

More information

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma

More information

Phospholipase C γ Prof. Graham Carpenter

Phospholipase C γ Prof. Graham Carpenter Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular

More information

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Discovery and ptimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Feng Zhang Wipf Group Research Topic Seminar 02-09-2013 1 Feng Zhang @ Wipf

More information

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys

More information

Supplementary information

Supplementary information Supplementary information Pyk2 activates the NLRP3 inflammasome by directly phosphorylating ASC and contributes to inflammasome-dependent peritonitis I-Che Chung 1, Chun-Nan OuYang 1, Sheng-Ning Yuan 1,

More information

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How

More information

Designer Affinity Reagents. Brian Kay

Designer Affinity Reagents. Brian Kay Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm x 10

More information

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow. Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain.

Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain. Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm 10 nm

More information

For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs).

For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs). RayBio Phosphorylation Antibody Array I For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs). User Manual (Revised Jul 25, 2007) (Cat# AAH-PRTK-1-2;

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours

More information

The Tissue Engineer s Toolkit

The Tissue Engineer s Toolkit The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli

More information

Cell, Volume 141. Supplemental Information Cell Signaling by Receptor Tyrosine Kinases Mark A. Lemmon and Joseph Schlessinger

Cell, Volume 141. Supplemental Information Cell Signaling by Receptor Tyrosine Kinases Mark A. Lemmon and Joseph Schlessinger Cell, Volume 141 Supplemental Information Cell Signaling by Receptor Tyrosine Kinases Mark A. Lemmon and Joseph Schlessinger Figure S1. RTK Mutations in Diseases Locations of gain-of-function (green arrows)

More information

Supplements. Figure S1. B Phalloidin Alexa488

Supplements. Figure S1. B Phalloidin Alexa488 Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with

More information

Lecture 7: Signaling Through Lymphocyte Receptors

Lecture 7: Signaling Through Lymphocyte Receptors Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural

More information

Effects of Second Messengers

Effects of Second Messengers Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many

More information

PATHOGEN INNOCUOUS ANTIGEN. No Danger- very low expression of costimulatory ligands Signal One Only

PATHOGEN INNOCUOUS ANTIGEN. No Danger- very low expression of costimulatory ligands Signal One Only Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv illai AICD Naive Activated Effector Memory Activated Effector Naive AICD Activated

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

More information

Signal-Transduction Cascades - 2. The Phosphoinositide Cascade

Signal-Transduction Cascades - 2. The Phosphoinositide Cascade Signal-Transduction Cascades - 2 The Phosphoinositide Cascade Calcium ion as a second messenger Tyrosine kinase and receptor dimerization scribd.com Faisal Khatib JU The Phosphoinositide Cascade Used by

More information

Cell Signaling part 2

Cell Signaling part 2 15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

More information

MCB*4010 Midterm Exam / Winter 2008

MCB*4010 Midterm Exam / Winter 2008 MCB*4010 Midterm Exam / Winter 2008 Name: ID: Instructions: Answer all 4 questions. The number of marks for each question indicates how many points you need to provide. Write your answers in point form,

More information

IMMUNORECEPTOR SIGNALING AS ATOPIC OF RESEARCH has a history of about 30 years. Though the effects of

IMMUNORECEPTOR SIGNALING AS ATOPIC OF RESEARCH has a history of about 30 years. Though the effects of Preface IMMUNORECEPTOR SIGNALING AS ATOPIC OF RESEARCH has a history of about 30 years. Though the effects of plant lectins on lymphocyte activation were studied back in the 1960s, the modern era began

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

A RENAISSANCE FOR SRC

A RENAISSANCE FOR SRC A RENAISSANCE FOR SRC Timothy J. Yeatman The c-src non-receptor tyrosine kinase is overexpressed and activated in a large number of human malignancies and has been linked to the development of cancer and

More information

Expression and regulation. Thymocytes, T cells and B-1a cells Developmentally regulated. Activated T cells Intracellular pool reservoir

Expression and regulation. Thymocytes, T cells and B-1a cells Developmentally regulated. Activated T cells Intracellular pool reservoir Supplementary information Table 1 Additional negative regulators of T-cell-receptor-induced signalling Negative regulator Membrane receptors CD5 1-4 Localization and key structural features Three scavenger

More information

G-Protein-Coupled Receptors

G-Protein-Coupled Receptors Cellular Signalling Cells must be ready to respond to essential signals in their environment. These are often chemicals in the extracellular fluid (ECF) from distant locations in a multicellular organism

More information

Cbl ubiquitin ligase: Lord of the RINGs

Cbl ubiquitin ligase: Lord of the RINGs Cbl ubiquitin ligase: Lord of the RINGs Not just quite interesting - really interesting! A cell must be able to degrade proteins when their activity is no longer required. Many eukaryotic proteins are

More information

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules

More information

A. Incorrect! It s not correct. Synergism of cytokines refers to two or more cytokines acting together.

A. Incorrect! It s not correct. Synergism of cytokines refers to two or more cytokines acting together. Immunology - Problem Drill 11: Cytokine and Cytokine Receptors Question No. 1 of 10 1. A single cytokine can act on several different cell types, which is known as. Question #1 (A) Synergism (B) Pleiotropism

More information

Vesicular Trafficking of Tyrosine Kinase Receptors and Associated Proteins in the Regulation of Signaling and Vascular Function

Vesicular Trafficking of Tyrosine Kinase Receptors and Associated Proteins in the Regulation of Signaling and Vascular Function This Review is part of a thematic series on Microdomains in Cardiovascular Signaling, which includes the following articles: Caveolae and Caveolins in the Cardiovascular System Focal Adhesion: Paradigm

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Phosphotyrosine Phosphatases: Regulators of Cell Signaling

Phosphotyrosine Phosphatases: Regulators of Cell Signaling Phosphotyrosine Phosphatases: Regulators of Cell Signaling Gary Schieven, Ph.D. Bristol-Myers Squibb Princeton, NJ Tyrosine phosphorylation signal pathways Lymphocytes as a model system Positive and negative

More information

Additional file 2 List of pathway from PID

Additional file 2 List of pathway from PID Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent

More information

Suppressors of Cytokine Signaling: Relevance to Gastrointestinal Function and Disease

Suppressors of Cytokine Signaling: Relevance to Gastrointestinal Function and Disease GASTROENTEROLOGY 2002;123:2064 2081 SPECIAL REPORTS AND REVIEWS Suppressors of Cytokine Signaling: Relevance to Gastrointestinal Function and Disease CHRISTOPHER J. GREENHALGH,* MEGAN E. MILLER, DOUGLAS

More information

The Yeast Two-Hybrid System

The Yeast Two-Hybrid System The Yeast Two-Hybrid System What is the yeast two-hybrid system used for? Identifies novel protein-protein interactions Can identify protein cascades Identifies mutations that affect protein-protein binding

More information

Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire

Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Signal Transduction: Information Metabolism Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Introduction Information Metabolism How cells receive, process and respond

More information

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information

Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas

Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas Chapter 04: Antigen Recognition in the Adaptive Immune System Test Bank MULTIPLE CHOICE 1. Most T lymphocytes

More information

The Pennsylvania State University. The Graduate School. Department of Biochemistry, Microbiology and Molecular Biology

The Pennsylvania State University. The Graduate School. Department of Biochemistry, Microbiology and Molecular Biology The Pennsylvania State University The Graduate School Department of Biochemistry, Microbiology and Molecular Biology REGULATION OF T HELPER CELL RESPONSES AND ALLERGIC ASTHMA BY TEC KINASES, ITK AND TXK

More information

Perspective SERIES on protein protein interaction domains in signal transduction

Perspective SERIES on protein protein interaction domains in signal transduction The role of protein protein interaction domains in signal transduction has been a topic of intensive study for the last ten years. Many of these studies have focused on the role of protein protein interactions

More information

Role of Non Receptor Tyrosine Kinases in Hematological Malignances and its Targeting by Natural Products

Role of Non Receptor Tyrosine Kinases in Hematological Malignances and its Targeting by Natural Products Siveen et al. Molecular Cancer (2018) 17:31 https://doi.org/10.1186/s12943-018-0788-y REVIEW Role of Non Receptor Tyrosine Kinases in Hematological Malignances and its Targeting by Natural Products Open

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

The elements of G protein-coupled receptor systems

The elements of G protein-coupled receptor systems The elements of G protein-coupled receptor systems Prostaglandines Sphingosine 1-phosphate a receptor that contains 7 membrane-spanning domains a coupled trimeric G protein which functions as a switch

More information

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

Project one: The Role Of Lyp Phosphatase in Primary Human Macrophages

Project one: The Role Of Lyp Phosphatase in Primary Human Macrophages Project one: The Role Of Lyp Phosphatase in Primary Human Macrophages Project two: crel and its effect on class switch recombination, IRF4 induction and plasma cell differentiation during a T-Independent

More information

Generation of the Immune Response

Generation of the Immune Response Generation of the Immune Response Sheet 18 immunity I only added extra notes that were explained in the lecture, refer back to the slides. SLIDE 3: In the generation of Immune response whether by B or

More information

Antibodies. Product Name Cat. No. Size. GH (Growth Hormone) Antibody µg, 100 µg GM-CSF Antibody µg, 100 µg

Antibodies. Product Name Cat. No. Size. GH (Growth Hormone) Antibody µg, 100 µg GM-CSF Antibody µg, 100 µg JAK/STAT Signaling The JAK/STAT signaling pathway transmits a signal from outside the cell eventually resulting in DNA transcription and activity in the cell. Leptin (a product of the obese gene) can induce

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our

More information

Cytokines and Growth Factors

Cytokines and Growth Factors Cytokines and Growth Factors Cytokines are a category of signalling proteins and glycoproteins that, like hormones and neurotransmitters, are used extensively in cellular communication. While hormones

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

T-cell receptor signalling

T-cell receptor signalling First Summer School: 31 Aug-4 Sep 2009. School of Mathematics, University of Leeds Theoretical and Experimental Immunology T-cell receptor signalling Klaus Okkenhaug, PhD The Babraham Institute Cambridge,

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving

More information

TRAF3 as a regulator of T lymphocyte activation

TRAF3 as a regulator of T lymphocyte activation University of Iowa Iowa Research Online Theses and Dissertations Summer 2017 TRAF3 as a regulator of T lymphocyte activation Alicia M. Wallis University of Iowa Copyright 2017 Alicia M. Wallis This dissertation

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture 6 Notes: Control Systems in Gene Expression Pulling it all together: coordinated control of transcriptional regulatory molecules Simple Control:

More information

LFA-1 activates focal adhesion kinases FAK1/PYK2 to generate LAT-GRB2-SKAP1 complexes that terminate T-cell conjugate formation

LFA-1 activates focal adhesion kinases FAK1/PYK2 to generate LAT-GRB2-SKAP1 complexes that terminate T-cell conjugate formation Received 27 Sep 216 Accepted 23 May 217 Published 12 Jul 217 DOI: 1.138/ncomms161 OPEN LFA-1 activates focal adhesion kinases /PYK2 to generate -GRB2- complexes that terminate T-cell conjugate formation

More information

Signal transduction and protein kinase inhibitors. Feng Qian ( 钱峰 )

Signal transduction and protein kinase inhibitors. Feng Qian ( 钱峰 ) Signal transduction and protein kinase inhibitors Feng Qian ( 钱峰 ) fengqian@sjtu.edu.cn Protein Kinases in the Human Genome 518 kinases 1.7 % of human genome Lipid kinases Nucleotide kinases Cell Signaling

More information

Functional analysis of LAT in TCR-mediated signaling pathways using a LAT-deficient Jurkat cell line

Functional analysis of LAT in TCR-mediated signaling pathways using a LAT-deficient Jurkat cell line International Immunology, Vol. 11, No. 6, pp. 943 950 Functional analysis of LAT in TCR-mediated signaling pathways using a LAT-deficient Jurkat cell line Weiguo Zhang, Brenda J. Irvin 1,2, Ronald P. Trible,

More information

TCR, MHC and coreceptors

TCR, MHC and coreceptors Cooperation In Immune Responses Antigen processing how peptides get into MHC Antigen processing involves the intracellular proteolytic generation of MHC binding proteins Protein antigens may be processed

More information

Regulation of Enzymatic Activity. Lesson 4

Regulation of Enzymatic Activity. Lesson 4 Regulation of Enzymatic Activity Lesson 4 Regulation of Enzymatic Activity no real regulation: - regulation of enzyme expression and turnover - control of enzyme trafficking - supply of cofactors real

More information

EMBO. Organization of complex situations in the immune system. reports. Conference: Signal processing through protein complexes.

EMBO. Organization of complex situations in the immune system. reports. Conference: Signal processing through protein complexes. EMBO reports Organization of complex situations in the immune system Conference: Signal processing through protein complexes Introduction Over the last few decades, the search for and identification of

More information

Regulation of insulin and type 1 insulin-like growth factor signaling and action by the Grb10/14 and SH2B1/B2 adaptor proteins

Regulation of insulin and type 1 insulin-like growth factor signaling and action by the Grb10/14 and SH2B1/B2 adaptor proteins REVIEW ARTICLE Regulation of insulin and type 1 insulin-like growth factor signaling and action by the Grb10/14 and SH2B1/B2 adaptor proteins Bernard Desbuquois, Nadege Carre* and Anne-Francßoise Burnol

More information

Studies on signaling pathways induced by FLT3, an important oncogene in AML

Studies on signaling pathways induced by FLT3, an important oncogene in AML Studies on signaling pathways induced by FLT3, an important oncogene in AML Razumovskaya, Elena Published: 2011-01-01 Link to publication Citation for published version (APA): Razumovskaya, E. (2011).

More information

CHAPTER 3: EGFR ACTIVATION IMPACTS ON FAK PROTEIN EXPRESSION AND PHOSPHORYLATION STATUS IN HOSCC CELL LINES

CHAPTER 3: EGFR ACTIVATION IMPACTS ON FAK PROTEIN EXPRESSION AND PHOSPHORYLATION STATUS IN HOSCC CELL LINES CHAPTER 3: EGFR ACTIVATION IMPACTS ON FAK PROTEIN EXPRESSION AND PHOSPHORYLATION STATUS IN HOSCC CELL LINES 3.1 Introduction Developmental processes such as cell migration depend on signals from both the

More information

Cell Motility. Junfeng Ji ( 纪俊峰 ), PhD

Cell Motility.   Junfeng Ji ( 纪俊峰 ), PhD Cell Motility Junfeng Ji ( 纪俊峰 ), PhD Professor Laboratory of Somatic Reprogramming and Stem Cell Aging Center for Stem Cell and Tissue Engineering School of Medicine Zhejiang University Email: jijunfeng@zju.edu.cnedu

More information

Mechanism of B-Cell Receptor-Induced Phosphorylation and Activation of Phospholipas...

Mechanism of B-Cell Receptor-Induced Phosphorylation and Activation of Phospholipas... Mechanism of B-Cell Receptor-Induced Phosphorylation and Activation of Phospholipas... Page 1 of 31 Journal List > Mol Cell Biol > v.24(22); Nov 2004 Mol Cell Biol. 2004 November; 24(22): 9986 9999. doi:

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Revision. camp pathway

Revision. camp pathway االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition

More information

For Aga, Sta, Tosia and my wonderful Family

For Aga, Sta, Tosia and my wonderful Family For Aga, Sta, Tosia and my wonderful Family ... they will not convince us that white is white and black is black! - former Prime Minister of Poland, Jaros aw Kaczy ski A real man is recognized by the

More information

Chem Lecture 10 Signal Transduction

Chem Lecture 10 Signal Transduction Chem 452 - Lecture 10 Signal Transduction 111130 Here we look at the movement of a signal from the outside of a cell to its inside, where it elicits changes within the cell. These changes are usually mediated

More information

Molecular mechanisms of thrombin-induced early and late-phase of ERK1/2 phosphorylation in vascular smooth muscle cells

Molecular mechanisms of thrombin-induced early and late-phase of ERK1/2 phosphorylation in vascular smooth muscle cells Molecular mechanisms of thrombin-induced early and late-phase of ERK1/2 phosphorylation in vascular smooth muscle cells Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften

More information