Designer Affinity Reagents. Brian Kay
|
|
- Lorena Logan
- 5 years ago
- Views:
Transcription
1 Designer Affinity Reagents Brian Kay
2 Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold
3 M13 Bacteriophage 900 nm x 10 nm
4 Affinity Selection Process
5 The Fibronectin Type III Domain as a Scaffold Only 94 aa (vs. 250 aa for antibody fragment) Easier to work with than antibody fragments (more stable, express at higher levels in bacteria) Can bind targets inside cells Used by Shohei Koide, Dario Neri, Dane Wittrup, and Rihe Liu as a scaffold for affinity reagent generation Also called monobody
6 Construction of a Phage-displayed Library of FN3 Monobodies Immunoglobulin-like fold: monobody Small: 94 amino acids Stable: T m = 90ºC BC loop FG loop Expected diversity NNK (5 residues) NNK (5 residues) 1X10 13 (20 10 ) Actual diversity 1.3X electroporations were used to produce 2.8 x transformants, 46% of which (1.3 x ) have both loops mutated.
7 Construction of Phage Library by Kunkel Mutagenesis WT-gIII Phagemid DNA Phagemid DNA M13-K07 helper Uracilated ssdna E.coli CJ236 (F dut - ung - ) Phage particle with uracilated DNA Bacterial colonies E. coli TG1 (F dut + ung + ) x x x Heteroduplex x x x Synthesis of heteroduplex dsdna Annealing of mutagenic oligos
8 Src Family PxxP linker Y SH3 SH2 Kinase domain Create biosensors for members of the Src family of protein tyrosine kinases (54-81% similarity) Fabricate and test biosensors of Src family member activation in living cells SFKs Fgr Fyn Yes Src Lyn Hck Lck Blk
9 Identification of Lyn SH3 Domain Binders Phage ELISA Phage ELISA OD405nm
10 Both TA1 and TA8 Are Highly Selective for the Lyn SH3 Domain TA1 TA8
11 Construction of Secondary Libraries with a Mega-primer Generated by Error-prone and/or Asymmetric PCR 11
12 Two Variants Bind more than 130-fold Tighter than the Original Clone TA8 2H7 3C12 K D = 6.2 µm K D = 28 nm K D = 47 nm BC loop FG loop WT-TA8: WD APNTQHG YY VT TRPSISK PI 2H7: WD IRNTAHG YY VT TRPKIGL PI 3C12: WD ISNTSHG YY VT TRPKIGL PI The K D s of 2H7 and 3C12 for SH3 domains of Hck and Btk > 3 µm. 12
13 Successful Pull-down of Lyn from Cells with the Improved FN3 Monobody 13
14 Abs 405nm Isolated Monobodies Preferentially Bind to the Fyn SH3 Domain in the Src Family
15 Out of 150 Human SH3 Domains, the G9 Monobody Only Binds Fyn A. B. C. D. Dots lining the bottom and the right side of the membranes are histagged ligands, which are used for the purpose of alignment
16 ITC Experiments to Determine the Affinity of G9 Monobody to Three SH3 Domains Fyn SH3 Fgr SH3 Yes SH3 K D s: 166 nm ±6 nm N= 0.89 ΔH= 2.22x10 4 cal/mole ΔS= Joule/ºK
17 The SH3 Domain of Src becomes Accessible upon Activation PxxP linker Y SH3 SH2 Kinase domain Inactive Active An affinity reagent that bind to SH3 domain can be used to monitor activation.
18 Pull-down of Activated Src Akash Gulyani Klaus Hahn (UNC-CH)
19 Fluorescently labeled Monobody Responds to Src Binding 19
20 Sensing Src Activation Merocyanine SH3 domain Kinase domain SH2 domain Src kinase
21 Ratio Imaging Akash Gulyani Klaus Hahn (UNC-CH)
22 Biosensor Experiments Inject cells with biosensor proteins and monitor changes in fluorescence.
23 PDGF Induced Dorsal Ruffling Platelet-derived Growth Factor (PDGF) stimulation induces actin-based dorsal protrusions in fibroblasts. Dorsal ruffles are precursors to macropinosomes. Video removed Src activity is previously known to be required for dorsal ruffle formation and macropinocytosis.
24 Src activation Followed with the Biosensor Video removed Sites of white, red, and yellow coloration are interpreted as sites of Src activation.
25 Negative Control Video removed Injection of a fluorescent monobody (point mutant) that does NOT bind the Src SH3 domain.
26 Results of Preliminary Screening External Set 1: Human Proteins Target Full name/function FN3 Hits USP11 Ubiquitin carboxyl-terminal hydrolase 11 GTP-binding protein SAR1a Yes SAR1A Heat shock protein 90kDa beta HSP90B1 member 1 CTBP2 C-terminal-binding protein 2 Yes Phospholipase A-2-activating Yes PLAA protein Ribosomal protein S6 kinase, RPS6KA3 90kDa, polypeptide 3 mitogen-activated protein kinase Yes MAP2K5 kinase 5 CTBP1 C-terminal-binding protein 1 Yes CDK2 Cyclin-dependent kinase 2 Yes MAPK8 mitogen-activated protein kinase 8 Yes SF3A1 Splicing factor 3 subunit 1 Yes COPS5 constitutive photomorphogenic homolog subunit 5 Yes Targets Prepared by the Structural Genomics Consortium (SGC)
27 27
28 Acknowledgements Renhua Huang Chris Vinci Kevin Gorman Kritika Pershad Funding: NIH U54, Common Fund
Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain.
Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm 10 nm
More informationIncorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
More informationEffects of Second Messengers
Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many
More informationDepartment of Chemistry, University of Washington, Seattle, Washington 98195, United States *S Supporting Information
This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. pubs.acs.org/biochemistry
More informationLysosomes and endocytic pathways 9/27/2012 Phyllis Hanson
Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson General principles Properties of lysosomes Delivery of enzymes to lysosomes Endocytic uptake clathrin, others Endocytic pathways recycling vs.
More informationRAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
More informationCell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,
More informationSignaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationLecture 7: Signaling Through Lymphocyte Receptors
Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural
More informationAntigen Recognition by T cells
Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells
More informationStructural biology of viruses
Structural biology of viruses Biophysical Chemistry 1, Fall 2010 Coat proteins DNA/RNA packaging Reading assignment: Chap. 15 Virus particles self-assemble from coat monomers Virus Structure and Function
More informationIntroduction 1/3. The protagonist of our story: the prokaryotic ribosome
Introduction 1/3 The protagonist of our story: the prokaryotic ribosome Introduction 2/3 The core functional domains of the ribosome (the peptidyl trasferase center and the decoding center) are composed
More informationChapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.
Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature
More informationProtein tyrosine kinase signaling
rotein tyrosine kinase signaling Serge ROCHE CRBM CNRS/Montpellier University serge.roche@crbm.cnrs.fr rotein phosphorylation on Tyr A central mechanism to control cell communication in a multicellular
More information7.012 Quiz 3 Answers
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84
More informationChapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.
Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature
More informationSignal-Transduction Cascades - 2. The Phosphoinositide Cascade
Signal-Transduction Cascades - 2 The Phosphoinositide Cascade Calcium ion as a second messenger Tyrosine kinase and receptor dimerization scribd.com Faisal Khatib JU The Phosphoinositide Cascade Used by
More informationMolecular Biology (BIOL 4320) Exam #2 May 3, 2004
Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good
More informationThe Tissue Engineer s Toolkit
The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli
More informationSupplements. Figure S1. B Phalloidin Alexa488
Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with
More informationSignaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research
Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationEnzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
More informationSignal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire
Signal Transduction: Information Metabolism Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Introduction Information Metabolism How cells receive, process and respond
More informationChapter 18. Viral Genetics. AP Biology
Chapter 18. Viral Genetics 2003-2004 1 A sense of size Comparing eukaryote bacterium virus 2 What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron
More informationGenome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department
Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause
More informationDetermination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationRNA (Ribonucleic acid)
RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal
More informationIdentification of Oral Bioavailable, Type2 Inhibitors of Discoidin Domain-containing Receptor 1/2 (DDR1/DDR2) using Back-to-Front X-Ray FBDD
Identification of ral Bioavailable, Type2 Inhibitors of Discoidin Domain-containing Receptor 1/2 (DDR1/DDR2) using Back-to-Front X-Ray FBDD Emiliano Tamanini 26 th Symposium on Medicinal Chemistry in Eastern
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationCell Cycle, Mitosis, and Microtubules. LS1A Final Exam Review Friday 1/12/07. Processes occurring during cell cycle
Cell Cycle, Mitosis, and Microtubules LS1A Final Exam Review Friday 1/12/07 Processes occurring during cell cycle Replicate chromosomes Segregate chromosomes Cell divides Cell grows Cell Growth 1 The standard
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationOrigin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes
Oncogenes and Proto-oncogenes Jekyll and Hyde A double edged sword Origin of oncogenes? Oncogene hypothesis Retroviral oncogenes and cell proto-oncogenes (v-onc) (c-onc) The role of c-onc in cancer How
More information7.012 Problem Set 6 Solutions
Name Section 7.012 Problem Set 6 Solutions Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed
More informationotherwise known as Cytotoxic T lymphocytes (CTLs)
MIT Biology Department 7.012: Introductory Biology - Fall 200 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 5 FRIDAY October 29, 2004
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture 6 Notes: Control Systems in Gene Expression Pulling it all together: coordinated control of transcriptional regulatory molecules Simple Control:
More informationApoptosis Oncogenes. Srbová Martina
Apoptosis Oncogenes Srbová Martina Cell Cycle Control point Cyclin B Cdk1 Cyclin D Cdk4 Cdk6 Cyclin A Cdk2 Cyclin E Cdk2 Cyclin-dependent kinase (Cdk) have to bind a cyclin to become active Regulation
More informationCellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
More informationUnderstanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
More informationTrim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
More informationNature Methods: doi: /nmeth.4257
Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.
More informationViral Genetics. BIT 220 Chapter 16
Viral Genetics BIT 220 Chapter 16 Details of the Virus Classified According to a. DNA or RNA b. Enveloped or Non-Enveloped c. Single-stranded or double-stranded Viruses contain only a few genes Reverse
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationHow Cells Divide. Chapter 10
How Cells Divide Chapter 10 Bacterial Cell Division Bacteria divide by binary fission. -the single, circular bacterial chromosome is replicated -replication begins at the origin of replication and proceeds
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12864 Supplementary Table 1 1 2 3 4 5 6 7 Peak Gene code Screen Function or Read analysis AMP reads camp annotation reads minor Tb927.2.1810 AMP ISWI Confirmed
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationMCB*4010 Midterm Exam / Winter 2008
MCB*4010 Midterm Exam / Winter 2008 Name: ID: Instructions: Answer all 4 questions. The number of marks for each question indicates how many points you need to provide. Write your answers in point form,
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationSupplemental Information. Lck/Hck/Fgr-Mediated Tyrosine. Phosphorylation Negatively Regulates. TBK1 to Restrain Innate Antiviral Responses
Cell Host & Microbe, Volume 21 Supplemental Information Lck/Hck/FgrMediated Tyrosine Phosphorylation Negatively Regulates to Restrain Innate Antiviral Responses Shengduo Liu, Shasha Chen, Xinran Li, Shiying
More informationsupplementary information
a Phalloidin GM13 p-tyr b p-tyr 23 116 96 PDGF Control Control EGF PDGF 52 35 28 Figure S1 Tyrosine phosphorylation induced by growth factors differs from that arising from the arrival of traffic at the
More informationSHORT LINEAR MOTIFS. Holger Dinkel EMBO Practical Course Computational analysis of protein-protein interactions From sequences to networks
Holger Dinkel EMBO Practical Course Computational analysis of protein-protein interactions From sequences to networks IMPORTANCE OF 2 / 19 IMPORTANCE OF 2 / 19 IMPORTANCE OF 2 / 19 IMPORTANCE OF 2 / 19
More informationSupplemental Data. Wu et al. (2010). Plant Cell /tpc
Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),
More information1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli
Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy
More informationLife Science 1A Final Exam. January 19, 2006
ame: TF: Section Time Life Science 1A Final Exam January 19, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use non-erasable
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationMechanisms of resistance to JAK inhibitors. L. Knoops
Mechanisms of resistance to JAK inhibitors L. Knoops 1 : Resistance to tyrosine kinase inhibition in cancer are related in sequence and structure. The main diagram illustrates the similarity between the
More informationAP Biology Protein Structure and Enzymes
AP Biology Protein Structure and Enzymes Connection to the Nitrogen-cycle Amino acids (protein) Nucleic acids (RNA and DNA) ATP 78% 1. Assimilation of nitrate by photosynthetic eukaryotes 2. Nitrogen fixation
More informationSignal transduction by immunoglobulin Fc receptors
Signal transduction by immunoglobulin Fc receptors Gabriela Sánchez-Mejorada and Carlos Rosales Immunology Department, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México,
More informationViruses defined acellular organisms genomes nucleic acid replicate inside host cells host metabolic machinery ribosomes
The Viruses Viruses Viruses may be defined as acellular organisms whose genomes consist of nucleic acid, obligately replicate inside host cells using host metabolic machinery and ribosomes to form a pool
More informationYong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Jay Vadgama, Ph.D Chief, Division of Cancer Research and Training Background One in 8 women
More informationG-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
More information2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
More informationChapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling
Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules
More informationGenetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
More informationMolecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
More informationKEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION
Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationSupplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
More informationControl of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation?
Control of Cell Proliferation by Peptide Growth Factors Autocrine Growth Factor Production Causes Malignant Transformation? Transforming Activities From Condition Media from a Tumor Cell Line Condition
More informationSUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter
1 SUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter Pglr-3:mCherry (red) and Pnlp-22:gfp (green) shows co-localization
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationDiscovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck
Discovery and ptimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Feng Zhang Wipf Group Research Topic Seminar 02-09-2013 1 Feng Zhang @ Wipf
More informationPolyomaviridae. Spring
Polyomaviridae Spring 2002 331 Antibody Prevalence for BK & JC Viruses Spring 2002 332 Polyoma Viruses General characteristics Papovaviridae: PA - papilloma; PO - polyoma; VA - vacuolating agent a. 45nm
More informationSignal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
More informationMoore s law in information technology. exponential growth!
Moore s law in information technology exponential growth! ... and how it compares to developments in bio sciences Biology is driven by an avalanche of new information... DNA sequencing methods and throughput
More informationThe functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
More informationFyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1
Biochem. J. (2003) 376, 159 168 (Printed in Great Britain) 159 Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1 Amy R. SANGUINETTI 1,Haiming CAO 2 and
More informationSignal Transduction Pathways. Part 2
Signal Transduction Pathways Part 2 GPCRs G-protein coupled receptors > 700 GPCRs in humans Mediate responses to senses taste, smell, sight ~ 1000 GPCRs mediate sense of smell in mouse Half of all known
More informationSupplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Stelter et al., http://www.jcb.org/cgi/content/full/jcb.201105042/dc1 S1 Figure S1. Dyn2 recruitment to edid-labeled FG domain Nups.
More informationCell cycle and Apoptosis. Chalermchai Mitrpant
Cell cycle and Apoptosis 2556 Chalermchai Mitrpant Overview of the cell cycle Outline Regulatory mechanisms controlling cell cycle Progression of the cell cycle Checkpoint of the cell cycle Phases of the
More informationSupplementary Information
Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu
More informationNeurotransmitter Systems II Receptors. Reading: BCP Chapter 6
Neurotransmitter Systems II Receptors Reading: BCP Chapter 6 Neurotransmitter Systems Normal function of the human brain requires an orderly set of chemical reactions. Some of the most important chemical
More informationThe unique N-terminal region of SRMS regulates enzymatic activity and phosphorylation of its novel substrate docking protein 1
The unique N-terminal region of SRMS regulates enzymatic activity and phosphorylation of its novel substrate docking protein 1 Raghuveera K. Goel, Sayem Miah, Kristin Black, Natasha Kalra, Chenlu Dai and
More informationmembrane form secreted form 13 aa 26 aa K K V V K K 3aa
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai secreted form membrane form 13 aa 26 aa K K V V K K 3aa Hapten monosaccharide
More informationThe antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationRelative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationCapacity of simian immunodeficiency virus strain mac Nef for high-affinity Src homology 3 (SH3) binding revealed by ligand-tailored SH3 domains
Journal of General Virology (2002), 83, 3147 3152. Printed in Great Britain... Capacity of simian immunodeficiency virus strain mac Nef for high-affinity Src homology 3 (SH3) binding revealed by ligand-tailored
More informationProblem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
More informationBiochem 503 Fall Protein Tyr Phosphatases
Biochem 503 Fall 2005 Protein Tyr Phosphatases David Brautigan assigned reading: Stoker (2005) J. Endocrin. 185:19-33 History 1981-1982 First description of P-Tyr specific phosphohydrolyase activity in
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are
More informationNucleotide polymorphisms of pfcrt gene in Thai isolates of Plasmodium falciparum
Nucleotide polymorphisms of pfcrt gene in Thai isolates of Plasmodium falciparum Setthaudom Ch. 1, Tan-Ariya P. 1, Mungthin M. 2 1 Department of Microbiology, Faculty of Science, Mahidol University 2 Department
More information