Designer Affinity Reagents. Brian Kay

Size: px
Start display at page:

Download "Designer Affinity Reagents. Brian Kay"

Transcription

1 Designer Affinity Reagents Brian Kay

2 Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold

3 M13 Bacteriophage 900 nm x 10 nm

4 Affinity Selection Process

5 The Fibronectin Type III Domain as a Scaffold Only 94 aa (vs. 250 aa for antibody fragment) Easier to work with than antibody fragments (more stable, express at higher levels in bacteria) Can bind targets inside cells Used by Shohei Koide, Dario Neri, Dane Wittrup, and Rihe Liu as a scaffold for affinity reagent generation Also called monobody

6 Construction of a Phage-displayed Library of FN3 Monobodies Immunoglobulin-like fold: monobody Small: 94 amino acids Stable: T m = 90ºC BC loop FG loop Expected diversity NNK (5 residues) NNK (5 residues) 1X10 13 (20 10 ) Actual diversity 1.3X electroporations were used to produce 2.8 x transformants, 46% of which (1.3 x ) have both loops mutated.

7 Construction of Phage Library by Kunkel Mutagenesis WT-gIII Phagemid DNA Phagemid DNA M13-K07 helper Uracilated ssdna E.coli CJ236 (F dut - ung - ) Phage particle with uracilated DNA Bacterial colonies E. coli TG1 (F dut + ung + ) x x x Heteroduplex x x x Synthesis of heteroduplex dsdna Annealing of mutagenic oligos

8 Src Family PxxP linker Y SH3 SH2 Kinase domain Create biosensors for members of the Src family of protein tyrosine kinases (54-81% similarity) Fabricate and test biosensors of Src family member activation in living cells SFKs Fgr Fyn Yes Src Lyn Hck Lck Blk

9 Identification of Lyn SH3 Domain Binders Phage ELISA Phage ELISA OD405nm

10 Both TA1 and TA8 Are Highly Selective for the Lyn SH3 Domain TA1 TA8

11 Construction of Secondary Libraries with a Mega-primer Generated by Error-prone and/or Asymmetric PCR 11

12 Two Variants Bind more than 130-fold Tighter than the Original Clone TA8 2H7 3C12 K D = 6.2 µm K D = 28 nm K D = 47 nm BC loop FG loop WT-TA8: WD APNTQHG YY VT TRPSISK PI 2H7: WD IRNTAHG YY VT TRPKIGL PI 3C12: WD ISNTSHG YY VT TRPKIGL PI The K D s of 2H7 and 3C12 for SH3 domains of Hck and Btk > 3 µm. 12

13 Successful Pull-down of Lyn from Cells with the Improved FN3 Monobody 13

14 Abs 405nm Isolated Monobodies Preferentially Bind to the Fyn SH3 Domain in the Src Family

15 Out of 150 Human SH3 Domains, the G9 Monobody Only Binds Fyn A. B. C. D. Dots lining the bottom and the right side of the membranes are histagged ligands, which are used for the purpose of alignment

16 ITC Experiments to Determine the Affinity of G9 Monobody to Three SH3 Domains Fyn SH3 Fgr SH3 Yes SH3 K D s: 166 nm ±6 nm N= 0.89 ΔH= 2.22x10 4 cal/mole ΔS= Joule/ºK

17 The SH3 Domain of Src becomes Accessible upon Activation PxxP linker Y SH3 SH2 Kinase domain Inactive Active An affinity reagent that bind to SH3 domain can be used to monitor activation.

18 Pull-down of Activated Src Akash Gulyani Klaus Hahn (UNC-CH)

19 Fluorescently labeled Monobody Responds to Src Binding 19

20 Sensing Src Activation Merocyanine SH3 domain Kinase domain SH2 domain Src kinase

21 Ratio Imaging Akash Gulyani Klaus Hahn (UNC-CH)

22 Biosensor Experiments Inject cells with biosensor proteins and monitor changes in fluorescence.

23 PDGF Induced Dorsal Ruffling Platelet-derived Growth Factor (PDGF) stimulation induces actin-based dorsal protrusions in fibroblasts. Dorsal ruffles are precursors to macropinosomes. Video removed Src activity is previously known to be required for dorsal ruffle formation and macropinocytosis.

24 Src activation Followed with the Biosensor Video removed Sites of white, red, and yellow coloration are interpreted as sites of Src activation.

25 Negative Control Video removed Injection of a fluorescent monobody (point mutant) that does NOT bind the Src SH3 domain.

26 Results of Preliminary Screening External Set 1: Human Proteins Target Full name/function FN3 Hits USP11 Ubiquitin carboxyl-terminal hydrolase 11 GTP-binding protein SAR1a Yes SAR1A Heat shock protein 90kDa beta HSP90B1 member 1 CTBP2 C-terminal-binding protein 2 Yes Phospholipase A-2-activating Yes PLAA protein Ribosomal protein S6 kinase, RPS6KA3 90kDa, polypeptide 3 mitogen-activated protein kinase Yes MAP2K5 kinase 5 CTBP1 C-terminal-binding protein 1 Yes CDK2 Cyclin-dependent kinase 2 Yes MAPK8 mitogen-activated protein kinase 8 Yes SF3A1 Splicing factor 3 subunit 1 Yes COPS5 constitutive photomorphogenic homolog subunit 5 Yes Targets Prepared by the Structural Genomics Consortium (SGC)

27 27

28 Acknowledgements Renhua Huang Chris Vinci Kevin Gorman Kritika Pershad Funding: NIH U54, Common Fund

Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain.

Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain. Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm 10 nm

More information

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys

More information

Effects of Second Messengers

Effects of Second Messengers Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many

More information

Department of Chemistry, University of Washington, Seattle, Washington 98195, United States *S Supporting Information

Department of Chemistry, University of Washington, Seattle, Washington 98195, United States *S Supporting Information This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. pubs.acs.org/biochemistry

More information

Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson

Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson General principles Properties of lysosomes Delivery of enzymes to lysosomes Endocytic uptake clathrin, others Endocytic pathways recycling vs.

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,

More information

Signaling Through Immune System Receptors (Ch. 7)

Signaling Through Immune System Receptors (Ch. 7) Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

Lecture 7: Signaling Through Lymphocyte Receptors

Lecture 7: Signaling Through Lymphocyte Receptors Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural

More information

Antigen Recognition by T cells

Antigen Recognition by T cells Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells

More information

Structural biology of viruses

Structural biology of viruses Structural biology of viruses Biophysical Chemistry 1, Fall 2010 Coat proteins DNA/RNA packaging Reading assignment: Chap. 15 Virus particles self-assemble from coat monomers Virus Structure and Function

More information

Introduction 1/3. The protagonist of our story: the prokaryotic ribosome

Introduction 1/3. The protagonist of our story: the prokaryotic ribosome Introduction 1/3 The protagonist of our story: the prokaryotic ribosome Introduction 2/3 The core functional domains of the ribosome (the peptidyl trasferase center and the decoding center) are composed

More information

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow. Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

More information

Protein tyrosine kinase signaling

Protein tyrosine kinase signaling rotein tyrosine kinase signaling Serge ROCHE CRBM CNRS/Montpellier University serge.roche@crbm.cnrs.fr rotein phosphorylation on Tyr A central mechanism to control cell communication in a multicellular

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow. Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

More information

Signal-Transduction Cascades - 2. The Phosphoinositide Cascade

Signal-Transduction Cascades - 2. The Phosphoinositide Cascade Signal-Transduction Cascades - 2 The Phosphoinositide Cascade Calcium ion as a second messenger Tyrosine kinase and receptor dimerization scribd.com Faisal Khatib JU The Phosphoinositide Cascade Used by

More information

Molecular Biology (BIOL 4320) Exam #2 May 3, 2004

Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good

More information

The Tissue Engineer s Toolkit

The Tissue Engineer s Toolkit The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli

More information

Supplements. Figure S1. B Phalloidin Alexa488

Supplements. Figure S1. B Phalloidin Alexa488 Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with

More information

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How

More information

Cell Signaling part 2

Cell Signaling part 2 15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

More information

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma

More information

Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire

Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Signal Transduction: Information Metabolism Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Introduction Information Metabolism How cells receive, process and respond

More information

Chapter 18. Viral Genetics. AP Biology

Chapter 18. Viral Genetics. AP Biology Chapter 18. Viral Genetics 2003-2004 1 A sense of size Comparing eukaryote bacterium virus 2 What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron

More information

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause

More information

Determination Differentiation. determinated precursor specialized cell

Determination Differentiation. determinated precursor specialized cell Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

RNA (Ribonucleic acid)

RNA (Ribonucleic acid) RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal

More information

Identification of Oral Bioavailable, Type2 Inhibitors of Discoidin Domain-containing Receptor 1/2 (DDR1/DDR2) using Back-to-Front X-Ray FBDD

Identification of Oral Bioavailable, Type2 Inhibitors of Discoidin Domain-containing Receptor 1/2 (DDR1/DDR2) using Back-to-Front X-Ray FBDD Identification of ral Bioavailable, Type2 Inhibitors of Discoidin Domain-containing Receptor 1/2 (DDR1/DDR2) using Back-to-Front X-Ray FBDD Emiliano Tamanini 26 th Symposium on Medicinal Chemistry in Eastern

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

Cell Cycle, Mitosis, and Microtubules. LS1A Final Exam Review Friday 1/12/07. Processes occurring during cell cycle

Cell Cycle, Mitosis, and Microtubules. LS1A Final Exam Review Friday 1/12/07. Processes occurring during cell cycle Cell Cycle, Mitosis, and Microtubules LS1A Final Exam Review Friday 1/12/07 Processes occurring during cell cycle Replicate chromosomes Segregate chromosomes Cell divides Cell grows Cell Growth 1 The standard

More information

Growth and Differentiation Phosphorylation Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit

More information

Origin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes

Origin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes Oncogenes and Proto-oncogenes Jekyll and Hyde A double edged sword Origin of oncogenes? Oncogene hypothesis Retroviral oncogenes and cell proto-oncogenes (v-onc) (c-onc) The role of c-onc in cancer How

More information

7.012 Problem Set 6 Solutions

7.012 Problem Set 6 Solutions Name Section 7.012 Problem Set 6 Solutions Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed

More information

otherwise known as Cytotoxic T lymphocytes (CTLs)

otherwise known as Cytotoxic T lymphocytes (CTLs) MIT Biology Department 7.012: Introductory Biology - Fall 200 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 5 FRIDAY October 29, 2004

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture 6 Notes: Control Systems in Gene Expression Pulling it all together: coordinated control of transcriptional regulatory molecules Simple Control:

More information

Apoptosis Oncogenes. Srbová Martina

Apoptosis Oncogenes. Srbová Martina Apoptosis Oncogenes Srbová Martina Cell Cycle Control point Cyclin B Cdk1 Cyclin D Cdk4 Cdk6 Cyclin A Cdk2 Cyclin E Cdk2 Cyclin-dependent kinase (Cdk) have to bind a cyclin to become active Regulation

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,

More information

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary

More information

Nature Methods: doi: /nmeth.4257

Nature Methods: doi: /nmeth.4257 Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.

More information

Viral Genetics. BIT 220 Chapter 16

Viral Genetics. BIT 220 Chapter 16 Viral Genetics BIT 220 Chapter 16 Details of the Virus Classified According to a. DNA or RNA b. Enveloped or Non-Enveloped c. Single-stranded or double-stranded Viruses contain only a few genes Reverse

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

How Cells Divide. Chapter 10

How Cells Divide. Chapter 10 How Cells Divide Chapter 10 Bacterial Cell Division Bacteria divide by binary fission. -the single, circular bacterial chromosome is replicated -replication begins at the origin of replication and proceeds

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12864 Supplementary Table 1 1 2 3 4 5 6 7 Peak Gene code Screen Function or Read analysis AMP reads camp annotation reads minor Tb927.2.1810 AMP ISWI Confirmed

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

MCB*4010 Midterm Exam / Winter 2008

MCB*4010 Midterm Exam / Winter 2008 MCB*4010 Midterm Exam / Winter 2008 Name: ID: Instructions: Answer all 4 questions. The number of marks for each question indicates how many points you need to provide. Write your answers in point form,

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

Supplemental Information. Lck/Hck/Fgr-Mediated Tyrosine. Phosphorylation Negatively Regulates. TBK1 to Restrain Innate Antiviral Responses

Supplemental Information. Lck/Hck/Fgr-Mediated Tyrosine. Phosphorylation Negatively Regulates. TBK1 to Restrain Innate Antiviral Responses Cell Host & Microbe, Volume 21 Supplemental Information Lck/Hck/FgrMediated Tyrosine Phosphorylation Negatively Regulates to Restrain Innate Antiviral Responses Shengduo Liu, Shasha Chen, Xinran Li, Shiying

More information

supplementary information

supplementary information a Phalloidin GM13 p-tyr b p-tyr 23 116 96 PDGF Control Control EGF PDGF 52 35 28 Figure S1 Tyrosine phosphorylation induced by growth factors differs from that arising from the arrival of traffic at the

More information

SHORT LINEAR MOTIFS. Holger Dinkel EMBO Practical Course Computational analysis of protein-protein interactions From sequences to networks

SHORT LINEAR MOTIFS. Holger Dinkel EMBO Practical Course Computational analysis of protein-protein interactions From sequences to networks Holger Dinkel EMBO Practical Course Computational analysis of protein-protein interactions From sequences to networks IMPORTANCE OF 2 / 19 IMPORTANCE OF 2 / 19 IMPORTANCE OF 2 / 19 IMPORTANCE OF 2 / 19

More information

Supplemental Data. Wu et al. (2010). Plant Cell /tpc

Supplemental Data. Wu et al. (2010). Plant Cell /tpc Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),

More information

1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli

1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy

More information

Life Science 1A Final Exam. January 19, 2006

Life Science 1A Final Exam. January 19, 2006 ame: TF: Section Time Life Science 1A Final Exam January 19, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use non-erasable

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Mechanisms of resistance to JAK inhibitors. L. Knoops

Mechanisms of resistance to JAK inhibitors. L. Knoops Mechanisms of resistance to JAK inhibitors L. Knoops 1 : Resistance to tyrosine kinase inhibition in cancer are related in sequence and structure. The main diagram illustrates the similarity between the

More information

AP Biology Protein Structure and Enzymes

AP Biology Protein Structure and Enzymes AP Biology Protein Structure and Enzymes Connection to the Nitrogen-cycle Amino acids (protein) Nucleic acids (RNA and DNA) ATP 78% 1. Assimilation of nitrate by photosynthetic eukaryotes 2. Nitrogen fixation

More information

Signal transduction by immunoglobulin Fc receptors

Signal transduction by immunoglobulin Fc receptors Signal transduction by immunoglobulin Fc receptors Gabriela Sánchez-Mejorada and Carlos Rosales Immunology Department, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México,

More information

Viruses defined acellular organisms genomes nucleic acid replicate inside host cells host metabolic machinery ribosomes

Viruses defined acellular organisms genomes nucleic acid replicate inside host cells host metabolic machinery ribosomes The Viruses Viruses Viruses may be defined as acellular organisms whose genomes consist of nucleic acid, obligately replicate inside host cells using host metabolic machinery and ribosomes to form a pool

More information

Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science

Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Jay Vadgama, Ph.D Chief, Division of Cancer Research and Training Background One in 8 women

More information

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters

More information

2013 W. H. Freeman and Company. 12 Signal Transduction

2013 W. H. Freeman and Company. 12 Signal Transduction 2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG

More information

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

Molecular biology :- Cancer genetics lecture 11

Molecular biology :- Cancer genetics lecture 11 Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to

More information

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide

More information

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation?

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation? Control of Cell Proliferation by Peptide Growth Factors Autocrine Growth Factor Production Causes Malignant Transformation? Transforming Activities From Condition Media from a Tumor Cell Line Condition

More information

SUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter

SUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter 1 SUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter Pglr-3:mCherry (red) and Pnlp-22:gfp (green) shows co-localization

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

More information

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Discovery and ptimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Feng Zhang Wipf Group Research Topic Seminar 02-09-2013 1 Feng Zhang @ Wipf

More information

Polyomaviridae. Spring

Polyomaviridae. Spring Polyomaviridae Spring 2002 331 Antibody Prevalence for BK & JC Viruses Spring 2002 332 Polyoma Viruses General characteristics Papovaviridae: PA - papilloma; PO - polyoma; VA - vacuolating agent a. 45nm

More information

Signal Transduction Cascades

Signal Transduction Cascades Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,

More information

Moore s law in information technology. exponential growth!

Moore s law in information technology. exponential growth! Moore s law in information technology exponential growth! ... and how it compares to developments in bio sciences Biology is driven by an avalanche of new information... DNA sequencing methods and throughput

More information

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of

More information

Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1

Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1 Biochem. J. (2003) 376, 159 168 (Printed in Great Britain) 159 Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1 Amy R. SANGUINETTI 1,Haiming CAO 2 and

More information

Signal Transduction Pathways. Part 2

Signal Transduction Pathways. Part 2 Signal Transduction Pathways Part 2 GPCRs G-protein coupled receptors > 700 GPCRs in humans Mediate responses to senses taste, smell, sight ~ 1000 GPCRs mediate sense of smell in mouse Half of all known

More information

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Stelter et al., http://www.jcb.org/cgi/content/full/jcb.201105042/dc1 S1 Figure S1. Dyn2 recruitment to edid-labeled FG domain Nups.

More information

Cell cycle and Apoptosis. Chalermchai Mitrpant

Cell cycle and Apoptosis. Chalermchai Mitrpant Cell cycle and Apoptosis 2556 Chalermchai Mitrpant Overview of the cell cycle Outline Regulatory mechanisms controlling cell cycle Progression of the cell cycle Checkpoint of the cell cycle Phases of the

More information

Supplementary Information

Supplementary Information Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu

More information

Neurotransmitter Systems II Receptors. Reading: BCP Chapter 6

Neurotransmitter Systems II Receptors. Reading: BCP Chapter 6 Neurotransmitter Systems II Receptors Reading: BCP Chapter 6 Neurotransmitter Systems Normal function of the human brain requires an orderly set of chemical reactions. Some of the most important chemical

More information

The unique N-terminal region of SRMS regulates enzymatic activity and phosphorylation of its novel substrate docking protein 1

The unique N-terminal region of SRMS regulates enzymatic activity and phosphorylation of its novel substrate docking protein 1 The unique N-terminal region of SRMS regulates enzymatic activity and phosphorylation of its novel substrate docking protein 1 Raghuveera K. Goel, Sayem Miah, Kristin Black, Natasha Kalra, Chenlu Dai and

More information

membrane form secreted form 13 aa 26 aa K K V V K K 3aa

membrane form secreted form 13 aa 26 aa K K V V K K 3aa Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai secreted form membrane form 13 aa 26 aa K K V V K K 3aa Hapten monosaccharide

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

Insulin Resistance. Biol 405 Molecular Medicine

Insulin Resistance. Biol 405 Molecular Medicine Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent

More information

Relative activity (%) SC35M

Relative activity (%) SC35M a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure

More information

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Capacity of simian immunodeficiency virus strain mac Nef for high-affinity Src homology 3 (SH3) binding revealed by ligand-tailored SH3 domains

Capacity of simian immunodeficiency virus strain mac Nef for high-affinity Src homology 3 (SH3) binding revealed by ligand-tailored SH3 domains Journal of General Virology (2002), 83, 3147 3152. Printed in Great Britain... Capacity of simian immunodeficiency virus strain mac Nef for high-affinity Src homology 3 (SH3) binding revealed by ligand-tailored

More information

Problem Set 8 Key 1 of 8

Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients

More information

Biochem 503 Fall Protein Tyr Phosphatases

Biochem 503 Fall Protein Tyr Phosphatases Biochem 503 Fall 2005 Protein Tyr Phosphatases David Brautigan assigned reading: Stoker (2005) J. Endocrin. 185:19-33 History 1981-1982 First description of P-Tyr specific phosphohydrolyase activity in

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are

More information

Nucleotide polymorphisms of pfcrt gene in Thai isolates of Plasmodium falciparum

Nucleotide polymorphisms of pfcrt gene in Thai isolates of Plasmodium falciparum Nucleotide polymorphisms of pfcrt gene in Thai isolates of Plasmodium falciparum Setthaudom Ch. 1, Tan-Ariya P. 1, Mungthin M. 2 1 Department of Microbiology, Faculty of Science, Mahidol University 2 Department

More information