Effect of RNA interference therapy on the mice eosinophils CCR3 gene and granule protein in the murine model of allergic rhinitis
|
|
|
- Melina Strickland
- 5 years ago
- Views:
Transcription
1 226 Asian Pacific Journal of Tropical Medicine (214) Contents lists available at ScienceDirect Asian Pacific Journal of Tropical Medicine journal homepage: Document heading doi: 1.116/S (14)626-2 Effect of RNA interference therapy on the mice eosinophils CCR3 gene and granule protein in the murine model of allergic rhinitis Xin-Hua Zhu 1, Bing Liao 2, Ke Liu 1, Yue-Hui Liu 1* 1 Department of Otorhinolaryngology Head and Neck Surgery, the Second Affiliated Hospital of Nanchang University, Nanchang 336, China 2 Department of Head and Neck Surgery, the Tumor Hospital of Jiangxi Province, Nanchang 336, China ARTICLE INFO Article history: Received 1 September 213 Received in revised form 15 October 213 Accepted 15 December 213 Available online 2 March 214 Keywords: Allergic rhinitis Eosinophil CCR3 RNA interfering ABSTRACT Objective: To observe the clinical manifestations of allergic rhinitis mice and the expression changes of the eosinophils CCR3 and the granule protein mrna in the bone marrow, peripheral blood and nasal lavage fluid. Methods: Twenty-four BALB/c mice were randomly divided into the control group, PBS therapy group, sirna therapy group and the CCR3 sirna therapy group (n=6). Allergic rhinitis model were sensitized and stimulated by ovalbunfin, and CCR3 sirna therapy group were administered with CCR3 transnasally before stimulated. The levels of the eosinophils CCR3, MBP, ECP and EPO in bone marrow, peripheral blood and nasal lavage fluid were detected by RT-PCR. Results: Compared to the control group and CCR3 sirna therapy group, the nasal mucosa of the PBS therapy group and sirna therapy group developed epithalaxy, goblet cells hyperplasia, squamous epithelium metaplasia, epithelium necrosis, lamina propria and submucosa gland hyperplasia, vasodilatation, tissue edema, and the characterized eosinophil infiltration. RT-PCR indicated that the CCR3 mrna, MBP, ECP and EPO expression in bone marrow, peripheral blood and nasal lavage fluid of the CCR3 sirna therapy group was lower than the PBS therapy group and sirna therapy group (P<.5). Conclusions: The RNA interference therapy to CCR3 by local administration pernasal can suppress the process of the development, migration and invasion of the allergic rhinitis eosinophil, thus can reduce the effect of eosinophils and then reduce the inflammation effect of the allergic rhinitis. It may be a new treatment for respiratory tract allergic inflammation. 1. Introduction Eosinophils (EOS) infiltration is an important pathological features of allergic diseases. In recent years, the study suggests that it is an important factor in the pathogenesis of allergy that EOS migration and activation to the local tissue. With the application of molecular biology techniques, the chemokine receptor 3 (CCR3) receptors were considered to be the EOS selective receptor which with a strong inducing chemotaxis effect. The traditional drug therapy has a poor specificity and the treatment is ineffective. RNA interference has the advantage of specific and targeting etc, is regulated by a large number of gene expression of a small amount of dsrna. Currently the reports of the effect of inhibiting CCR3 expression on the allergic rhinitis is still rare. In this study, we established a mouse model of allergic rhinitis and used synthesized interfering RNA in vitro, and then observed the changes of mrna of the EOS CCR3 and eosinophil granule proteins-major basic protein (MBP), cationic protein (ECP), peroxidase (EPO) expression in mice. This stody is to explore the feasibility of the treatment of RNA interference (RNAi) for allergic rhinitis. *Corresponding author: Yue-Hui Liu, Department of Otorhinolaryngology Head and Neck Surgery, the Second Affiliated Hospital of Nanchang University, Nanchang 336, China. Tel: liuyuehuiclark@21cn.com Foundation project: This study was supported by the National Natural Science Fund Project in China (grant No.: 81684), Jiangxi Provincial Natural Science Fund Project in China (grant No.: 21gzy251), Jiangxi Provincial Health Department Project in China (grant No.: ) and Jiangxi Provincial Department of Science and Technology Project in China (grant No.: 2133BBG771). 2. Materials and methods 2.1. Animals and reagents Twenty four male BALB/c mice from 6 to 8 weeks, weight 2-3 g were purchased from animal and science of
2 Xin-Hua Zhu et al./asian Pacific Journal of Tropical Medicine (214) medicine department of Nanchang University. Ovalbumin were purchased from Sigma Co., JM19 competent cells, a small amount of plasmid extraction kit, Trans2K Plus 栻 DNA Marker were purchased from Beijing Trans-Gen Biotech Co., DNA Primers Synthesis, DNA sequencing were purchased from Invitrogen Corporation of USA. Restriction endonuclease EcoR 栺, restriction endonuclease Hind 栿, restriction endonuclease Mlu 栺, restriction endonuclease BamH 栺, restriction endonuclease Xho 栺, T4 DNA Ligase were purchased from NEB Inc. Qiagen large-scale plasmid extraction kit was purchased from Qiagen, Germany Construction of CCR3siRNA expression plasmid vector CCR3 full-length clone (NM_ ) was used as a template to amplify the coding frame sequence. Primer was designed and synthesized by BioWit-Technologies. shrna sequences: shrna1: GGTTGTGTTGATCCTCATAAA s h R N A 2 : G C T G A C A A T T G A C A G A T A C C T ; shrna3: G C A G C A T T G C C T G A A T T T A T C;shRNA4: GACCACACCCTATGAATATGA. RNAi target sequence was designed and the target sequence was synthesized into Oligo DNA, annealing for forming the double-stranded DNA, and generated shrna lentiviral vectors with plvx-shrna2-m vector which were digested by MluI, Sac 栺, EcoR 栺, Hind 栿, BamH 栺 and Xho 栺. Applied shrna Lentiviral vectortransfected 293T cells and EOS cells, determined virus titer. Q-PCR identified the downward effect of CCR3 gene in EOS. Successfully constructed lentiviral vector plasmid (plvx- ShRNA2-mCCR ) Animal grouping and sensitized model establishment. In order to avoid the interference caused by external allergen, all the animals were kept in the laboratory of the department of animal science of medical college of Nanchang University, free diet, feeding by circadian rhythm. Twenty four clean grade BALB/c mice were randomly divided into 4 groups (n=6), one cage for each. Group one was the control group given normal saline. Group 2 was the given PBS. Group 3 was the, given sirna lentiviral vector. Group 4 was the CCR3 sirna treatment group, given CCR3 sirna. 8 毺 L treatment fluid were dropped into the nasal cavity on day and day 14, respectively, twice a day. The ovalbumin (OVA)/aluminum hydroxide [AL (OH) 3 ] mixture [containing 1 毺 g OVA and 4 mg AL (OH) 3 ] was injected into the intraperitoneal for sensitization on day 2 and day 16, twice a day. 6 毺 g/ml OVA were dropped intranasal to stimulate allergic reactions from day 21 to day 27. The normal control group were replaced by the same dose of normal saline. The specimens of the mice were collected after 24 h of the administration Specimen collection and determination Mice were anesthetized by intraperitoneal injection of 5% sodium pentobarbital. After anesthesia, the mice were fixed. Then 1 ml syringe needle was put into the nasal cavity about 2 cm bilateral. 2 ml PBS buffer was used to lavage the nasal and recovered the liquid. Pressing the eyeball at the mouse inner canthus, tear the retrobulbar tissues and collect blood. Exposure the nasal and obtained the bilateral nasal mucosa. The mucosa was fixed in 4% paraformaldehyde solution, embedded in paraffin, made into 4 毺 m sections for HE staining. The bone marrow, peripheral blood, nasal lavage fluid were stored at -8 refrigerator, detected by CCR3, EPO, MBP and ECP. Performed real-time quantitative PCR for the CCR3, EPO, MBP, ECP, and housekeeping gene ( 毬 -actin). Reaction conditions: 95 denaturation 2 min, 4 cycles, 94 denaturation 2 s, 49.5 (CCR3), 55.2 (EPO), 52 (MBP), 5.9 (ECP), annealed 2 s, elongation at 72 for 3 s, plate-reading at 74. PCR products were detected by agarose gel electrophoresis. Standardized enos, ICAM-1, Tenascin-C and PGF2a mrna absorbance values with the internal reference 毬 -actin optical density value, and obtained the relative content of CCR3, EPO, MBP and ECP mrna expression. The sequence of the CCR3, EPO, MBP and ECP and 毬 -actin were as follow: CCR3 upstream primer: 5 CCA GAG GGT GAA GAA GAC 3, downstream primer: 5 ACC AGG AAG AAA CGG AAT 3. EPO upstream primer: 5 TGG AAA GAG GCG TAA TGG 3, downstream primer: 5 AAG GAT GTA AGT GCG TTG AT 3. MBP upstream primer: 5 GTT CCC AAC ACC AAG ACA 3, downstream primer: 5 TCC CAT CCA TCC AGC AAA 3. ECP upstream primer: 5 ATC ACT CAT CTG CCA AGC 3, downstream primer: 5 CAG GGT TCA CAA GGG ACT 3. 毬 -actin primer: 5 GAG ACC TTC AAC ACC CCA GC 3, downstream primer: 5 ATG TCA CGC ACG ATT TCC C 3. Applicate the transmission ultraviolet analyzer for photograph, and then use a laser optical density image scanner to scan. The 毬 -actin was used as an internal reference for semi-quantitative image analysis Result determination Grading: (1) : no sneezing, no scratching nose, no secretion in nasal cavity; (2) 1 score: times of sneeze <4, mild scratching nose, the secretions in anterior nostril; (3) 2 scores: times of sneeze: 4-1, frequent scratching nose, nasal secretions more than anterior nostril; (4) 3 scores: times of sneeze> 11, continuous scratching nose, rubbing, face covered with nasal secretions. Superimposed quantization method was used to record the score. Nasal symptoms of 1-4 groups were observed after 3 minutes of the stimulation, the behavior score was calculated according to this rating system (> 5 is an successful animal model) Statistical analysis The data were analyzed by SPSS 19. statistics software, and the measurement data were expressed as mean 依 SD values. Normal test and homogeneity of variance in each group was performed. The data which not normally
3 228 Xin-Hua Zhu et al./asian Pacific Journal of Tropical Medicine (214) distributed were converted to normally distributed data by natural logarithm. t-test was applied in the comparison between two groups. P<.5 was considered as statistical significance. 3. Results 3.1. Behavioral observation The average score of the three groups was greater than 5 means successful model. The mice in the normal control group and had mild scratching nose and less sneezing, total score was <5. That means the allergic rhinitis animal model can be successfully established by this method, and the application of CCR3 sirna treatment can effectively control the occurrence of allergic rhinitis Nasal histological changes Compared group 1 with group 2 and group 3, the mucosa epithelium were shed and the goblet cell hyperplasia was obvious and coexsisted with EOS and other inflammatory cell infiltration, also with mucosa layer thickening and the dilatation and congestion of lamina propria, and tissue edema, glandular hyperplasia, hypertrophy strong secretion. That is comply with the pathological features of allergic rhinitis (Figure 1) RT-PCR test results In this study, we detected bone marrow, peripheral blood and nasal lavage fluid of fresh specimens from 2-4 groups of the mice by RT-PCR, and found that after the treatment of plvx-shrna2-mccr for topical nasal, the difference has statistically significant (P<.5) (Figures 2, 3, Table 1). Figure 2. CCR3 mrna expression of bone marrow, blood, nasal lavage fluid of mice in each group. The relative gray value of CCR3 mrna of each sample in CCR3 sirna treatment group were as follow: Bone marrow (.34 3 依.22 5), blood (53 4 依.61 6), nasal lavage fluid (. 依.), which were significantly lower than the relative gray value of CCR3 mrna of each sample in the PBS control group and the (P<.5). A B Figure 3. Eosinophil MBP mrna expression of bone marrow, blood, nasal lavage fluid of mice in each group. C D The MBP mrna relative gray value of each sample in the were as follow: Bone marrow (.324 依.24 5), blood (.15 3 依.12 8), nasal lavage fluid (. 依.) which were significantly lower than the MBP mrna relative gray value of the and the (P<.5). Figure 1. HE staining of nasal mucosa. A. Group 1: Nasal epithelial cells arranged neatly, no inflammatory cell infiltration and no expansion of the gland in the lamina propria (HE 2). B. Group 2: Nasal lamina propria vascular dilatation and congestion, edema, with the infiltration EOS and other inflammatory cell, glandular hyperplasia, hypertrophy, strong secretion (HE 2). C. Group 3. Nasal epithelium, obviously infiltration of inflammatory cells of the goblet cell hyperplasia, thickened mucous layer, tissue edema (HE 2). D. Group 4: Nasal mucociliary surface layer is relatively complete, no thickening of the mucous layer (HE 2). Figure 4. ECP mrna expression of bone marrow, blood, nasal lavage fluid of mice in each group.
4 Xin-Hua Zhu et al./asian Pacific Journal of Tropical Medicine (214) The ECP mrna relative gray value of each sample in the CCR3 sirna treatment group were as follow: bone marrow (93 6 依.11 5), blood (.14 5 依.26 ), nasal lavage fluid (. 依.) which were significantly lower than the ECP mrna relative gray value of the PBS-treated group and the (P<.5). Figure 5. EPO mrna expression of bone marrow, blood, nasal lavage fluid of mice in each group. The EPO mrna relative gray value of each sample in the CCR3 sirna treatment group were as follow: bone marrow ( 依.59 9), blood (.84 2 依.11 8), nasal lavage fluid (. 依.) which were significantly lower than the EPO mrna relative gray-value of the PBS-treated group and the (P<.5). Table 1 CCR3, MBP, ECP, EPO mrna relative gray values of the bone marrow, the blood and the nasal lavage fluid in three groups (x 依 sd). Groups Bone marrow Blood Nasal lavage fluid PBS-treated control group CCR 依 依 依.132 MBP 529 依 依 依.469 ECP.9771 依 依 依.553 EPO 851 依 依 依.41 sirna-treated control group CCR 依 依 依.26 MBP.9143 依 依 依.531 ECP.9245 依 依 依.647 EPO.5617 依 依 依.847 CCR3 sirna treatment group CCR3.343 依 依.616. 依. MBP.324 依 依.128. 依. ECP 936 依 依.26. 依. EPO.1595 依 依.118. 依. Note: Compared with the PBS-treated control group and the sirna treatment group, P<.5 (t test), the difference was not statistically significant. Compared PBS-treated control group with the sirnatreated control group, P>.5(t test), the difference was not statistically significant. 4. Discussion Allergic rhinitis belongs to type 栺 allergic reaction, which means after atopic individuals exposed to the allergens, the IgE-mediated media (mainly histamine) released and a variety of immune cells and cytokines involved in the nasal mucosa then caused this non-infectious inflammatory diseases. A large number of EOS infiltration in tissues is an important feature of allergic diseases, and EOS play a role of antigen-presenting cells in allergic airway disease[1,2]. EOS can release cytotoxic granule proteins, reactive oxygen species and lipid mediators, which can cause tissue damage, vascular leakage, mucus secretion and airway contraction[3]. It has been reported[3-5] that the pathogenesis of allergic diseases may be as follows: in the process of allergen challenge, the bone marrow can generate specific inflammatory cells (EOS progenitor cells), which can reach to the local tissue by peripheral blood circulation and then led to the local inflammation. CCR3 is a G protein coupled receptor generated by transmembrane, primarily expressed in the EOS. Eosinophil activation chemokine (Eotaxin) belong to class CC chemokines, which combined with the CCR3 and induce eosinophil migrate to specific tissues, causing local tissue inflammation. Eotaxins can also play an important role in situ hematopoiesis of the EOS in sites of inflammation by CCR3 receptors[4-9]. RNAi is a mechanism which can make target gene silencing after specific transcription, dsrna can cause the degradation of the homologous mrna and lead to the undetectable expression of target gene. It can blocking the specific gene expression efficiently. Therefore, the use of RNAi technology for screening genome have been studied extensively. That is, design corresponding dsrna for the different part of the genome, construct dsrna libraries, introduced into different individual cells, the protein expression can be changed to filter the gene and determine gene function[11-15]. Therefore, our experiments adopted the external synthesized interference RNA, specifically inhibit the eosinophil CCR3 expression, observed the EOS CR3 and eosinophil granule proteins-mbp, ECP, EPO mrna changes in mice bone marrow, peripheral blood and nasal lavage fluid EOS. In our previous work, we first estabalish the animals model, calculated by behavioral scoring system(>5 is a successful animal model), we found that the average score of group 2 and group 3 were all> 5. The normal group and only with mild scratching nose and less sneezing, score<5. HE staining showed that compared with group 1, group 2 and group 3 were with significantly mucosal epithelium, goblet cell hyperplasia and EOS and other inflammatory cells, mucous layer thickening, dilatation and congestion of the lamina propria, tissue edema, gland hyperplasia and great hypertrophy secretion. That means
5 23 Xin-Hua Zhu et al./asian Pacific Journal of Tropical Medicine (214) the allergic rhinitis animal model can be successfully established by this method, and the application of CCR3 sirna treatment can effectively control the occurrence of allergic rhinitis. Our previous studies has applied lentiviral vectors to constructed simultaneously for four fragments (mccr3-1, mccr3-2, mccr3-3 and mccr3-4) CCR3 sirna expression shuttle plasmid (plvx-shrna2-mccr ) successfully, and have a higher silencing effect which identified by QPCR on EOS CCR3 gene[16]. Detected by RT- PCR it was found that EOS CCR3 mrna granule protein mrna expression were high in the bone marrow, peripheral blood and nasal lavage fluid of the allergic rhinitis mice, which indicating that the EOS involved in the localization and activation of the tissue during the disease pathogenesis. In the experimental group, after treatmen of topical nasal plvx-shrna2-mccr , the test results show the corresponding EOS CCR3 mrna and granule protein mrna (MBP, ECP, EPO) expression was decreased, and reducing the changes of nasal cavity mucosa pathological, which indicate that the application-specific CCR3 sirna can inhibite CCR3 expression and also decreased the eosinophil granule protein mrna expression. This shows that the CCR3 may be involved in the whole process of the development, migration and invasion of EOS, which can not only block the CCR3 receptor expression, but also block its maturation, activation and chemotaxis, and blocking the recruitment of hematopoietic progenitor cells, mature eosinophil to sites of inflammation, improve the inflammatory response of allergic rhinitis[6,17,18]. In this study, we investigated the use of RNAi technology to treat allergic rhinitis of mice model, we found that inhibit the expression of CCR3 mrna can reduce the eosinophil granule protein mrna expression in the the bone marrow, peripheral blood and nasal lavage fluid, improved pathological changes in the nasal mucosa of mice, which indicated that EOS is suppressed in the development, migration and invasion, so as to relieve nasal allergy of the allergic rhinitis. Thus, based on the efficient and specific sequence interference for the target gene CCR3, we can provide some ideas for future exploration of the targeting sirna gene therapy for allergic rhinitis. Conflict of interest statement We declare that we have no conflict of interest. References [1] Shi HZ. Eosinophils function as antigen-presenting cells. J Leukoc Biol 24; 76: [2] Wang HB, Ghiran I, Matthaei K. Airway eosinophils: Allergic inflammation recruited professional antigen-presenting cells. Immunol 27; 179: [3] Tao LH, Zhang Z, Kong WJ. Allergic rhinitis mechanism of hematopoietic regulation and eosinophils. Int J Otolaryngol-Head & Neck Surg 29; 33(2): [4] Denburg JA, Keith PK. Eosinophil progenitors in airway diseases. Chest 28; 134: [5] Rdinger M, Ltvall J. Eosinophil progenitors in allergy and asthma- Do they matter? Pharmacol & Therapeut 29; 121: [6] Fulkerson PC, Fischetti CA, McBride ML. A central regulatory role for eosinophils and the eotaxin-ccr3 axis in chronic experimental allergic airway inflammation. PNAS 26; 133(44): [7] Gong H, Li FC. Research progress on the relationship between chemotatic factors of eotaxin\ccr3 and allergic rhinitis. J Trad Chin Med Uni Hunan 211; 31(8): [8] Lv LL, Zhu SY, Liu PL. Expression of glucocorticoid on asthma guinea pig model eotaxin, CCR3 on regulation. Cell & Mole Immunol J 29; 25(1): [9] López-Fraga M, Martinez T, Jiménez A. RNA interference technologies and therapeutics: from basic research to products. Bio Drugs 29; 23(5): 35, 332. [1] Li SF, Liu TF. Recent advances in the application of RNA interference techniques. Chin J Exp Ani 29; 17(1): [11] Maes T, Toumoy KG, Joos GF. Gene therapy for allergic airway diseases. Curr Allergy Asthma Rep 211; 11(2): [12] Meinicke H, Darcan Y, Hamelmann E. Targeting allergic airway diseases by sirna: an option for the future. Curr Mol Med 29; 9(2): [13] Jiang R, Zhang G, Ma L. Construction of a stable human nasopharyngeal carcinoma cell line with down-regulated expression of 毬 -catenin. J Trop Med 211; 11(5): [14] Lee CC, Chiang BL. RNA interference: new therapeutics in allergic diseases. Curr Gene Ther 28; 8(4): [15] Suzuki M, Zheng X, Zhang X. Novel vaccination for allergy through gene silencing of CD4 using small interfering RNA. J Immunol 28; 18(12): [16] Zhu XH, Liao B, Wang XY, Liu K, Liu YH.Construction and identification of mouse eosinophils CCR3 gene RNA interference lentiviral vector. Chin J Otorhnolaryngol Head Neck Surg 213; 48(4): [17] Liao B, Zhu XH, Liu YH. RNA interference in the application research on the treatment of allergic rhinitis. J Clinical Otolaryngol Head Neck Surg 212; 26(3): [18] Zhang L, Han DM. Attaches great importance to the research of allergic rhinitis. Chin J Otolaryngol Head & Neck Surg 21; 45(6):
c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
Supplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
Supplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
Supplemental Figures: Supplemental Figure 1
Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine
Immunology of Asthma Kenneth J. Goodrum,Ph Ph.D. Ohio University College of Osteopathic Medicine Outline! Consensus characteristics! Allergens:role in asthma! Immune/inflammatory basis! Genetic basis!
Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
*To whom correspondence should be addressed. This PDF file includes:
www.sciencemag.org/cgi/content/full/science.1212182/dc1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
BIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
Nature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
Implications on therapy. Prof. of Medicine and Allergy Faculty of Medicine, Cairo University
Implications on therapy Dr. Hisham Tarraf MD,FRCP(Edinb.) Prof. of Medicine and Allergy Faculty of Medicine, Cairo University Need for better understanding Global health problem Impact on quality of life
Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis
Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott
Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because
Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein
Effects of AFP gene silencing on Survivin mrna expression inhibition in HepG2 cells
mrna expression inhibition in HepG2 cells Z.L. Fang 1, N. Fang 2, X.N. Han 3, G. Huang 2, X.J. Fu 2, G.S. Xie 2, N.R. Wang 2 and J.P. Xiong 1 1 Department of Medical Oncology, The First Affiliated Hospital
Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
Supplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR
CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect
Triggers Allergens Allografts Helminths Viruses Tissue Injury
Rothenberg et al. Adv Immunol; 2001 Triggers Allergens Allografts Helminths Viruses Tissue Injury Rothenberg et al. Adv Immunol; 2001 Triggers Allergens Allografts Helminths Viruses Tissue Injury Cytotoxic
BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
Supplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac
ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,
www.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10
J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
Transforming growth factor beta1 gene silenced adipose-derived stem cell transplantation reduces thrombocytopenic purpura
21 1 2017 01 08 Chinese Journal of Tissue Engineering Research January 8, 2017 Vol.21, No.1 β1 ( 050031). β1 [J]. 2017 21(1):60-65. DOI: 10.3969/j.issn.2095-4344.2017.01.011 ORCID:0000-0002-3236-5704()
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
University of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick
University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
Potent and Selective CRTh2 Antagonists are Efficacious in Models of Asthma, Allergic Rhinitis and Atopic Dermatitis
Potent and Selective CRTh2 Antagonists are Efficacious in Models of Asthma, Allergic Rhinitis and Atopic Dermatitis Laura L. Carter, Yoshi Shiraishi, Yooseob Shin, Laurence Burgess, Christine Eberhardt,
Phototherapy in Allergic Rhinitis
Phototherapy in Allergic Rhinitis Rhinology Chair KSU KAUH Ibrahim AlAwadh 18\1\2017 MBBS, SB & KSUF Resident, ORL-H&N Background: Endonasal phototherapy can relieve the symptoms of allergic rhinitis
Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
HCV Persistence and Immune Evasion in the Absence of Memory T Cell Help.
SOM Text HCV Persistence and Immune Evasion in the Absence of Memory T Cell Help. Arash Grakoui 1, Naglaa H. Shoukry 2, David J. Woollard 2, Jin-Hwan Han 1, Holly L. Hanson 1, John Ghrayeb 3, Krishna K.
Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report. a a*
2009 63 6 379 384 Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report a b a a a* a b 380 63 6 Chest x ray and computed tomography (CT). A, Chest x ray on admission
TetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany
HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.
without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.
Sakatani et al. 1 Supporting Online Material Materials and methods Mice and genotyping: H19 mutant mice with C57BL/6J background carrying a deletion in the structural H19 gene (3 kb) and 10 kb of 5 flanking
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research Shoude Jin Harbin Medical University, China Background COPD ------ a silent killer Insidious,
A basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies
Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-
Coronaviruses cause acute, mild upper respiratory infection (common cold).
Coronaviruses David A. J. Tyrrell Steven H. Myint GENERAL CONCEPTS Clinical Presentation Coronaviruses cause acute, mild upper respiratory infection (common cold). Structure Spherical or pleomorphic enveloped
Boswellic acid attenuates asthma phenotype by downregulation of GATA3 via nhibition of PSTAT6
Boswellic acid attenuates asthma phenotype by downregulation of GATA3 via nhibition of PSTAT6 X. Zhou 1 *, J.G. Cai 2 *, W.W. Zhu 1, H.Y. Zhao 1, K. Wang 2 and X.F. Zhang 2 1 Department of Pediatrics,
Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.
Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and
MAGE A1-A6 RT-PCR and MAGE A3 and p16 methylation analysis in induced sputum from patients with lung cancer and non-malignant lung diseases
ONCOLOGY REPORTS 27: 911-916, 2012 MAGE A1-A6 RT-PCR and MAGE A3 and p16 methylation analysis in induced sputum from patients with lung cancer and non-malignant lung diseases KYEONG-CHEOL SHIN 1, KWAN-HO
Journal of Microbes and Infection,June 2007,Vol 2,No. 2. (HBsAg)2 , (PCR) 1762/ 1764
68 2007 6 2 2 Journal of Microbes and Infection,June 2007,Vol 2,No. 2 2 S 1 1 1 2 2 3 1 (HBsAg)2 ( YIC) S 5 30g 60g YIC ( HBV) DNA > 2 log10 e (HBeAg), 6 DNA, 1 YIC 1, (PCR) (0 ) (44 ) HBV DNA S 2, S a
Beta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
Supporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
Kun Jiang 1, He-Bin Chen 1, Ying Wang 1, Jia-Hui Lin 2, Yan Hu 1, Yu-Rong Fang 1
Original Article Changes in interleukin-17 and transforming growth factor beta 1 levels in serum and bronchoalveolar lavage fluid and their clinical significance among children with asthma Kun Jiang 1,
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
E-1 Role of IgE and IgE receptors in allergic airway inflammation and remodeling
E-1 Role of IgE and IgE receptors in allergic airway inflammation and remodeling Ruby Pawankar, MD, Ph.D. FRCP, FAAAAI Prof. Div of Allergy, Dept of Pediatrics Nippon Medical School Tokyo, Japan pawankar.ruby@gmail.com
Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine
Immunology of Asthma Kenneth J. Goodrum,Ph Ph.D. Ohio University College of Osteopathic Medicine Outline Consensus characteristics/incidence data Immune/inflammatory basis Etiology/Genetic basis Hygiene
SUPPLEMENTARY INFORMATION
BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic
Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health
Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health Thursday 8 January 2009 Morning Time: 1 hour
ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed
RESPIRATORY BLOCK. Bronchial Asthma. Dr. Maha Arafah Department of Pathology KSU
RESPIRATORY BLOCK Bronchial Asthma Dr. Maha Arafah Department of Pathology KSU marafah@ksu.edu.sa Jan 2018 Objectives Define asthma (BA) Know the two types of asthma 1. Extrinsic or atopic allergic 2.
Bacterial Gene Finding CMSC 423
Bacterial Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
Supplementary information
Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun
Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
SUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
Airway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan.
REVIEW ARTICLE Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan. 2 Division of Pediatric Pulmonology, Department of Pediatrics, Chang Gung Memorial
Research Article Influence of Rosiglitazone on the Expression of PPARγ,NF-κB, and TNF-α in Rat Model of Ulcerative Colitis
Gastroenterology Research and Practice Volume 2012, Article ID 845672, 8 pages doi:10.1155/2012/845672 Research Article Influence of Rosiglitazone on the Expression of PPARγ,NF-κB, and TNF-α in Rat Model
Expression and Clinical Significance of REGγ in Gastric Cancer Tissue and Variously Differentiated Gastric Cancer Cell Lines
208 Clin Oncol Cancer Res (2009) 6: 208-213 DOI 10.1007/s11805-009-0208-6 Expression and Clinical Significance of REGγ in Gastric Cancer Tissue and Variously Differentiated Gastric Cancer Cell Lines Jia
Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
Dr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline
Pathology of Asthma Dr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline Bronchial Asthma Definition: chronic, relapsing inflammatory lung disorder characterised by reversible
Supplementary Information
Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
PATIENTS AND METHODS. Subjects
PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients
Small hairpin RNA-mediated Krüppel-like factor 8 gene knockdown inhibits invasion of nasopharyngeal carcinoma
ONCOLOGY LETTERS 9: 2515-2519, 2015 Small hairpin RNA-mediated Krüppel-like factor 8 gene knockdown inhibits invasion of nasopharyngeal carcinoma JING WANG 1, JIAN LI HU 1, RU BO CAO 1, QIAN DING 1, GANG
(14): DOI: /j.issn ORCID: ( )
20 14 2016 04 01 Chinese Journal of Tissue Engineering Research April 1, 2016 Vol.20, No.14 ( 473000). [J]. 2016 20(14):2033-2039. DOI: 10.3969/j.issn.2095-4344.2016.14.008 ORCID: 0000-0002-8672-7109()