The Focused Exome service at Bristol Genetics Laboratory
|
|
- Arnold Snow
- 5 years ago
- Views:
Transcription
1 The Focused Exome service at Bristol Genetics Laboratory Chris Buxton Maggie Williams July 2016
2 Bristol Clinical exome Service to mid July Validation: Agilent FE kit, NextSeq 500 and new pipeline 1st reports Jan 2016 Casemix 52 defined 'active' panels 220 panels requested (1/3 are 56 cd vs. 2/3 112 cd TAT) 80 reported
3 New virtual panel acceptance criteria No large pre-populated list of panels New panel assessment + setup New request MDT Other clinical contact (CG vs non CG)? Existing UKGTN provider no Assess coverage okay Review disease mechanism mostly seq Discuss at weekly lab meeting yes poor e.g. commonly CNV depends depends
4 Phenotypic prioritisation Validation underway: Exomiser Workup / Validation plan Take 50 well phenotyped existing (custom) ngs panel patients.. with Class 4 / 5 results Merge their full custom panel genotype with clinical exome dataset:.. eg Coriell NA12878 Cell line Us these spiked dummy patients for validation Set significance thresholds / utility Other options Other prioritisation tools Variant filtering / mining vs disease databases e.g. HGMD pro Bone WP et al., Computational evaluation of exome sequence data using human and model organism phenotypes improves diagnostic efficiency. Genet Med Jun;18(6):
5 Management tools: Challenges to address Performance of newly proposed panels Coverage assessment Bedfile creation Mechanism to manage new services: LIMS limitations Panel maintenance Caselists management Case allocation
6 Labhelper: Coverage checker Coverage assessment Rapid assessment of ad-hoc panels
7 Labhelper: Coverage checker
8 Labhelper: Coverage checker Sanger fill
9 FE Management tool: Case management Auto allocation to lists Scientist allocation HPO terms Variant recording Stage tracking Dynamic filtering
10 FE Management tool: Panel content Gene content Pipeline integration Version control Modular approach Single phenotype panels Combo phenotype panels
11 Different ways of working: Workflow Lots of different Scientists add to Pending list 24 samples added to plate on LIMS Lab processing (manual) Index info Virtual panel info Patient info NextSeq raw data to BI Subset virtual panel results for analysis Load into Geneticist Assistant (annotation & variant database) vcf bam Coverage metrics CNV Case distribute to named Scientist
12 Different ways of working cd TATs in one service Increased workload for service management Demand + streamlining Staffing levels, automation, lab capacity, informatics Technical: Panel Version control Synchronisation of virtual panel content between pipeline / downstream software. Reanalysis of normal result patients CNV: Limits of analysis?
13 CNV assessment: Limits of analysis Known CNV positives: 2x 16p13.1 dup TAAD risk factor (+ schizophrenia ) T21 patient Klinefelter patient: Sex-linked genes on panel / incidental findings? Newly ascertained: Interstitial dup 15q
14 Different ways of working. Change in referral / testing patterns Shift to test more in-house, multiple genes requested Variable local uptake Engagement with MDTs Phenotype vs genotype etc Direct quote from Consultant CG:..For us as clinicians when assessing children if there are several different conditions going through your head although no obvious definite diagnosis the clinical exome is great way of testing for these conditions and then having the option of further analysis if no clear answer. Provides a much more efficient and cost effective solution..
15
Analysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationNGS Types of gene dossier applications UKGTN can evaluate
NGS Types of gene dossier applications UKGTN can evaluate Jo Whittaker on behalf of the Genetic Test Evaluation Working Group & UKGTN Project team NGS used in a number of ways Replacement technology for
More informationNGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht
NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationPersonalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection
Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationThe Deciphering Development Disorders (DDD) project: What a genomic approach can achieve
The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve RCP ADVANCED MEDICINE, LONDON FEB 5 TH 2018 HELEN FIRTH DM FRCP DCH, SANGER INSTITUTE 3,000,000,000 bases in each
More informationTPMI Presents: Translational Genomics Research Update, Opportunities and Challenges
TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges April 12, 2016 Darren D. O Rielly, Ph.D., FCCMG Director, Molecular Genetics Laboratory, Eastern Health Director, Translational
More information100,000 genomes RD Validation and Reporting Working Groups - Overview - Dom McMullan Chair Association for Clinical Genomic Science
100,000 genomes RD Validation and Reporting Working Groups - Overview - Dom McMullan Chair Association for Clinical Genomic Science What? More Working Groups? Post January 20 th meeting Volunteers for
More informationPractical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs
Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationImproving genomic diagnoses through accurate, specific phenotype information
Improving genomic diagnoses through accurate, specific phenotype information Lisa Ewans Clinical Geneticist, RPAH, Sydney PhD student in genomics, KCCG, Garvan; UNSW https://vlab.org Overview Phenotype
More informationImplementation of the DDD/ClinGen OGT (CytoSure v3) Microarray
Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray OGT UGM Birmingham 08/09/2016 Dom McMullan Birmingham Women's NHS Trust WM chromosomal microarray (CMA) testing Population of ~6 million (10%)
More informationSimple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
More informationCancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
More informationNGS Gateway Lab Services
TM NGS Gateway Lab Services Accelerating Precision Medicine Design a Complete Genomic Testing Portfolio with Turnkey Assays About NGS Gateway Lab Services TM Designed to provide a gateway to your own in-house
More informationMonitoring Protocol for Clozapine-induced Myocarditis. Copyright 2017, CAMH
1 Monitoring Protocol for Clozapine-induced Myocarditis 1 Agenda Problem Identification / Identification Importance / Importance Baseline Workflow Baseline Workflow Baseline Data Baseline Data Objectives
More informationOrganisational challenges faced by Bristol Genetics in the past 18 months
Organisational challenges faced by Bristol Genetics in the past 18 months Stuart Cook Introduction 1. The move towards 7-day working 2. Transitioning to a new lab facility 3. Improving process efficiency
More informationBuprenorphine Order Set and Rapid Access Referral. Copyright 2017, CAMH
2 Buprenorphine Order Set and Rapid Access Referral 1 Agenda Problem Identification / Identification Importance / Importance Baseline Workflow Baseline Workflow Baseline Data Baseline Data Objectives Solution
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationGuide to Use of SimulConsult s Phenome Software
Guide to Use of SimulConsult s Phenome Software Page 1 of 52 Table of contents Welcome!... 4 Introduction to a few SimulConsult conventions... 5 Colors and their meaning... 5 Contextual links... 5 Contextual
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationCounsyl Foresight Carrier Screen. Utmost confidence in every result
Counsyl Foresight Carrier Screen Utmost confidence in every result EXTENDING THE BENEFITS OF CARRIER SCREENING Elevate quality of care with expanded carrier screening (ECS) Carrier screening is used to
More informationAuto Validation and Management Reports Using Sysmex WAM. Alfonso Ziccardi Laboratory Operation Manager for AP/CP/Safety Officer
Auto Validation and Management Reports Using Sysmex WAM Alfonso Ziccardi Laboratory Operation Manager for AP/CP/Safety Officer SUCCESS BEYOND FINANCES Hematology Testing Breakdown NYHQ Descrete testing
More informationRare Disease Research and the UK 100,000 Genome Project
Rare Disease Research and the UK 100,000 Genome Project Prof F Lucy Raymond MA DPhil FRCP Department of Medical Genetics University of Cambridge UK Flr24@cam.ac.uk Copenhagen October Precision Medicine
More informationRapid testing and prenatal diagnosis for at-risk couples presenting during pregnancy without a diagnosis
Rapid testing and prenatal diagnosis for at-risk couples presenting during pregnancy without a diagnosis Stephen Abbs East Anglian Medical Genetics Service Cambridge University Hospitals NHS Foundation
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationSupplementary Figure 1
Supplementary Figure 1 An example of the gene-term-disease network automatically generated by Phenolyzer web server for 'autism'. The largest word represents the user s input term, Autism. The pink round
More informationBenefits and pitfalls of new genetic tests
Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,
More informationOutline. Next-Generation Sequencing. The Application of Genomic Medicine in Clinical and Laboratory Practice
Outline The Application of Genomic Medicine in Clinical and Laboratory Practice Jerry Feldman, MD, PhD, FACMG Medical Director, Division of Laboratory Genetics and Molecular Pathology, Detroit Medical
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationVan test naar diagnose naar
Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud
More informationAssociation for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology
Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology 9650 Rockville Pike, Bethesda, Maryland 20814 Tel: 301-634-7939 Fax: 301-634-7990 Email:
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationPERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST
INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationThe 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients
The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients Dr Richard Scott, Clinical Lead for Rare Disease Dr Nirupa Murugaesu, Clinical Lead for Cancer Four
More informationAgilent s Copy Number Variation (CNV) Portfolio
Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human
More informationCancer Informatics Lecture
Cancer Informatics Lecture Mayo-UIUC Computational Genomics Course June 22, 2018 Krishna Rani Kalari Ph.D. Associate Professor 2017 MFMER 3702274-1 Outline The Cancer Genome Atlas (TCGA) Genomic Data Commons
More informationCancer Improvement Plan Update. September 2014
Cancer Improvement Plan Update September 2014 1 Contents Page 1. Introduction 3 2. Key Achievements 4-5 3. Update on Independent Review Recommendations 6-13 4. Update on IST Recommendations 14-15 5. Update
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Choroideremia OMIM number for disease 303100 Disease alternative names please
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0298 TITLE: MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families PRINCIPAL INVESTIGATOR: Xudong Liu, PhD CONTRACTING
More informationImplementation of BRCA Oncomine panel for germline and somatic variant analysis
Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University
More informationDetection of copy number variations in PCR-enriched targeted sequencing data
Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation
More informationFlexible gene panels are essential for personalised genetic testing
Flexible gene panels are essential for personalised genetic testing Stephen Abbs East Anglian Medical Genetics Service Cambridge University Hospitals NHS Foundation Trust Clinical exome sequencing GEMINI
More informationChallenges and Access to Viral Load Testing in Africa: Example of Cote d Ivoire Christiane Adje-Toure, PhD Lab Branch Chief CDC-COTE D IVOIRE
Challenges and Access to Viral Load Testing in Africa: Example of Cote d Ivoire Christiane Adje-Toure, PhD Lab Branch Chief CDC-COTE D IVOIRE Outline 1. Introduction 2. Barriers to Scaling up Viral Load
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Leber congenital amaurosis OMIM number for disease 204000 Disease alternative
More informationis rarely visible, and communication about use of opioids for chronic pain patients is ad hoc and informal.
Six Building Blocks Self-Assessment The purpose of the self-assessment is to initiate a discussion among the opioid improvement team (or all members of your clinic) about the current state of your organization
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationExercises: Differential Methylation
Exercises: Differential Methylation Version 2018-04 Exercises: Differential Methylation 2 Licence This manual is 2014-18, Simon Andrews. This manual is distributed under the creative commons Attribution-Non-Commercial-Share
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow
More informationAdministrative notes. Computational Thinking ct.cs.ubc.ca
Administrative notes March 14: Midterm 2: this will cover all lectures, labs and readings between Tue Jan 31 and Thu Mar 9 inclusive Practice Midterm 2 is on Exercises webpage: http://www.ugrad.cs.ubc.ca/~cs100/2016w2/
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationUsing Cancer Registration and MDT Data to Provide Information on Recurrent and Metastatic Breast Cancer
Using Cancer Registration and MDT Data to Provide Information on Recurrent and Metastatic Breast Cancer Dr Gill Lawrence, WM KIT, on behalf of Breast SSCRG Cancer Outcomes Conference, Brighton, June 2013
More informationClinical evaluation of microarray data
Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray
More informationStreamlining the lung diagnostic pathway (A87)
Streamlining the lung diagnostic pathway (A87) Crawley CCG with Surrey and Sussex Healthcare NHS Trust Evaluation January 2017 Summary A new Straight-to-CT pathway for patients with an abnormal CXR result
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider Submitting laboratory: Leeds RGC 1. Disorder/condition approved name (please provide UK spelling if different
More informationReach Out to Patients for Better Disease Management
CASE STUDY Reach Out to Patients for Better Disease Management Logansport Memorial Hospital How automated reminders led to a higher compliance rate for overdue labs by diabetic patients. Quick Summary
More informationCancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16
Cancer Validation in the 100,000 genomes project Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer is a lesion of the Genome Diagnosis Cancer Molecular Lesions Prognosis Disease Monitoring Why is
More informationDavid Tamborero, PhD
David Tamborero, PhD Lopez-Bigas' lab Study of Tumor Genomes Study of Tumor Genomes Study sequencing data of tumors to understand the biological mechanisms shaping the mutational processes observed at
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISORDER/CONDITION POPULATION TRIAD Submitting laboratory: Exeter RGC Approved: Sept 2013 1. Disorder/condition
More informationThe Influenza Season Stephen L. Cochi, M.D., M.P.H. Acting Director National Immunization Program, CDC
The Influenza Season 2003-04 Stephen L. Cochi, M.D., M.P.H. Acting Director National Immunization Program, CDC 2003-2004 Influenza Season Influenza activity onset earlier than usual Children appeared disproportionately
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationInformed Consent Tracking Through DataFax
Informed Consent Tracking Through DataFax Vaishali Krishnan U.S. Department of Veterans Affairs Cooperative Studies Program Coordinating Center Menlo Park, CA Background: IC Review & Tracking Standard
More informationUsing phenotypic similarity to improve rare disease identification in PhenomeCentral
Using phenotypic similarity to improve rare disease identification in PhenomeCentral Orion Buske, Marta Girdea, Sergiu Dumitriu, Tal Friedman, Jonathan Zung, Cornelius Boerkoel, Kym Boycott, Michael Brudno
More informationCreating a reminder for GSK vaccines in Allscripts Professional EHR
Vaccine reminders Ensure timely and appropriate vaccine orders and administration Keeping track of patient vaccination requirements is an important aspect in the delivery of ongoing patient care. Alerts
More informationGenetics/Genomics: role of genes in diagnosis and/risk and in personalised medicine
Genetics/Genomics: role of genes in diagnosis and/risk and in personalised medicine Lynn Greenhalgh, Macmillan Cancer and General Clinical Geneticist Cancer Genetics Service Cancer is common 1 in
More informationCancer troublemakers: a tale of usual suspects and novel villains
Cancer troublemakers: a tale of usual suspects and novel villains Abel González-Pérez and Núria López-Bigas Biomedical Genomics Group Lab web: http://bg.upf.edu Driver genes/mutations: the troublemakers
More informationSiemens Healthcare Diagnostics
Siemens Healthcare Diagnostics A Global Industry Leader 3.7bn in sales More than 14,500 employees Serving 30,000 customers in more than 120 countries Approximately 244,000 instruments installed R&D spending
More informationDNA Sequence Bioinformatics Analysis with the Galaxy Platform
DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São
More informationQuantitative Radiomics System Decoding the Tumor Phenotype. John Quackenbush and Hugo Aerts
Quantitative Radiomics System Decoding the Tumor Phenotype John Quackenbush and Hugo Aerts The Radiomics Hypothesis The tumor s structural phenotype reflects its molecular and clinical properties. This
More informationChapter 9. Tests, Procedures, and Diagnosis Codes The McGraw-Hill Companies, Inc. All rights reserved.
Chapter 9 Tests, Procedures, and Diagnosis Codes Chapter 9 Content: Overview Ordering A Test SpringLabsTM & Reference Lab Results Managing and Charting Tests Creating A New Test Documenting and Activating
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationVaccination Setup. Immunization Set Up & Reporting
Vaccination Setup Immunization Set Up & Reporting To set up vaccination codes, waivers, links, combination vaccines, etc. The pathway is Office VaccinationsSetupCodes. See Cloning Vaccination Rules Code
More informationNew Enhancements: GWAS Workflows with SVS
New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences
More informationICARE Initiative. Cristi Radford, MS, CGC ICARE Outreach Coordinator
ICARE Initiative Cristi Radford, MS, CGC ICARE Outreach Coordinator Agenda Overview of ICARE History Mission Benefits Patient enrollment Website contents Questions What is ICARE? Research initiative representing
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name HEMOCHROMATOSIS, TYPE 4; HFE4 OMIM number for disease #606069 Disease alternative
More informationUpdating penetrance estimates for syndromes with variable phenotypic manifestation. Adele Corrigan June 27th
Updating penetrance estimates for syndromes with variable phenotypic manifestation Adele Corrigan June 27th Background Array CGH has led to increased identification of copy number variants (CNVs) Our understanding
More informationBrighton and Sussex University Hospitals NHS Trust Board of Directors. Mark Smith Chief Operating Officer
Meeting: Brighton and Sussex University Hospitals NHS Trust Board of Directors Date: 24 th August 2015 Board Sponsor: Paper Author: Subject: Mark Smith Chief Operating Officer Clinical Director and Directorate
More informationUAB P30 CORE A: The Hepato-Renal Fibrocystic Diseases Translational Resource
PKD Foundation UAB P30 CORE A: The Hepato-Renal Fibrocystic Diseases Translational Resource http://www.arpkdstudies.uab.edu/ Director: Co-Director: Lisa M. Guay-Woodford, MD William E. Grizzle, MD, PhD
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,
More informationHeartland Genetics and Newborn Screening Collaborative Conference
Heartland Genetics and Newborn Screening Collaborative Conference Laurel K. Willig, MD Assistant Medical Director for the Center for Pediatric Genomic Medicine and Joshua E. Petrikin, MD Director of Neonatal
More informationTalking Genomes with Your Patients. Meagan Cochran, MS, CGC Certified Genetic Counselor HudsonAlpha Institute for Biotechnology
Talking Genomes with Your Patients Meagan Cochran, MS, CGC Certified Genetic Counselor HudsonAlpha Institute for Biotechnology Objectives Review the importance of physician familiarity with genomic testing
More informationLong QT. Long QT Syndrome. A Guide for Patients
Long QT Long QT Syndrome A Guide for Patients Long QT Syndrome What is long QT syndrome? Long QT syndrome (LQTS) is a condition that affects the ability of the heart to beat (contract) regularly and efficiently.
More informationAccelerate, Coordinate, Evaluate (ACE) Programme
Emerging multidisciplinary diagnostic centre (MDC) models and design principles ACE wave 2: exploring the concept of MDC-based pathways ACE Accelerate, Coordinate, Evaluate (ACE) Programme An early diagnosis
More informationSTREAMLINED MUTATION ANALYSIS FOR CLINICAL NEXT GENERATION SEQUENCING DATA
STREAMLINED MUTATION ANALYSIS FOR CLINICAL NEXT GENERATION SEQUENCING DATA An Interactive Qualifying Project Report Submitted to the Faculty of WORCESTER POLYTECHNIC INSTITUTE In partial fulfillment of
More informationPhenobridge WP 7. Crossing the species bridge between mouse and human. 17 February 2015, Helmholtz Zentrum München
Phenobridge WP 7 Crossing the species bridge between mouse and human 17 February 2015, Helmholtz Zentrum München Michael Raess on behalf of the WP7 collaborators Who is WP7? Helen Parkinson, Nathalie Conte,
More informationCreating an alert for GSK vaccines in e-mds EHR
Immunization Alerts in e-mds Ensure timely and appropriate immunization orders and administration Keeping track of patient vaccination requirements is an important aspect in the delivery of ongoing patient
More informationNHS Array Service. ACC Audit 2009
NHS Array Service ACC Audit 2009 Kim Smith ACC Audit of arrays in diagnostics NHS Diagnostic Laboratories 2008 audit Regional Genetic Centres (24 centres) Specialist Haematological Cytogenetics Laboratories
More informationMass Spectrometry Made Simple for Clinical Diagnostic Labs
Mass Spectrometry Made Simple for Clinical Diagnostic Labs The SCIEX Topaz System with FDA-Cleared Topaz Vitamin D 200M Assay Kit Mass Spectrometry Made Simple SCIEX Topaz System for Clinical Diagnostics
More informationmicrorna analysis Merete Molton Worren Ståle Nygård
microrna analysis Merete Molton Worren Ståle Nygård Help personnel: Daniel Vodak Background Dysregulation of mirna expression has been connected to progression and development of atherosclerosis The hypothesis:
More informationUsing Health IT to Support Oral Health Integration: Dealing with Common Barriers. Jeff Hummel, MD, MPH Qualis Health November 5, 2015
Using Health IT to Support Oral Health Integration: Dealing with Common Barriers Jeff Hummel, MD, MPH Qualis Health November 5, 2015 Goals for this Session Understand 3 aspects of oral health information
More information