Phenobridge WP 7. Crossing the species bridge between mouse and human. 17 February 2015, Helmholtz Zentrum München

Size: px
Start display at page:

Download "Phenobridge WP 7. Crossing the species bridge between mouse and human. 17 February 2015, Helmholtz Zentrum München"

Transcription

1 Phenobridge WP 7 Crossing the species bridge between mouse and human 17 February 2015, Helmholtz Zentrum München Michael Raess on behalf of the WP7 collaborators

2 Who is WP7? Helen Parkinson, Nathalie Conte, Terry Meehan, Gautier Koscielny - European Bioinformatics Insitute Michael Raess - INFRAFRONTIER GmbH Frauke Neff, Philipp Gormanns, Christoph Lengger, Manuala Östereicher, Elida Schneltzer, Christine Schütt, Martin Hrabě de Angelis - Helmholtz Zentrum München Heimo Müller, Natalie Bordag, Kurt Zatloukal Medical University Graz Lucia Banci, Claudia Andreini, Leonardo Tenori, Claudio Luchinat CIRMMP Harald Staiger, Andreas Fritsche - Diabetes Experts, Medical University of Tübingen

3 Work package goal WP7-Phenobridge aims to bridge the gap between the phenotype information available from mouse model studies and from human clinical data in the field of obesity and diabetes, enabling a new level of interspecies analysis of disease datasets Linking BBMRI, ELXIR, INFRAFRONTIER, INSTRUCT

4 What are the Phenobridge objectives? Identify and develop a set of annotations, necessary terminologies, and mappings between terminologies for human and mouse models of diabetes and obesity Identify and group related interacting parameters in human and mouse which are involved in the development of clinical and molecular phenotypes Formalise rules for phenotypic annotation in human and mouse to work towards automation of phenotypic discovery and develop a related prototype service

5 How are we meeting our objectives? Identify and develop a set of annotations, necessary terminologies, and mappings Manual review of DO, HPO, OMIM, EFO by diabetes and ontology experts Development of a merged and extended component of DO, HP and Orphanet to incorporate diabetes phenotypes, frequency of symptoms and disease progression Identification of type 2 diabetes phenotype associations using data mining of diabetes journal abstracts, leading to a list of >570 potentially relevant MP and HP terms

6 How are we meeting our objectives? Identify and group related interacting parameters Two reviews of the terms obtained by the text mining approach, involving diabetes experts at the Helmholtz Zentrum München and the University of Tübingen Exclusion of clinically irrelevant terms Organisation of relevant terms into disease stage categories (IFG/IGT=Prediabetes, Manifest Diabetes, Symptoms, Consequences/ Complications, Type 1 / Type 2 diabetes, Associations with other diseases)

7 Expert curated list of HP and MP terms relevant to diabetes

8 HP MP New Total terms terms terms terms Diabetes Cause IFG/IGT (Prediabetes) Manifest Diabetes Diabetes Symptom Consequences/ Complications Type 1 Diabetes Type 2 Diabetes Assoc. w/ other diseases too Total (any temporal stage)

9 How are we meeting our objectives? Identify and group related interacting parameters Transforming the classification into the DIAB ontology using OWL Co-annotation of mouse and human datasets with the DIAB ontology BMB partners sample datasets Metabolights dataset Biosamples dataset

10

11 How are we meeting our objectives? Identify and group related interacting parameters Transforming the classification into the DIAB ontology using OWL Co-annotation of mouse and human datasets with the DIAB ontology BMB partners sample datasets Metabolights dataset Biosamples dataset

12 Partner sample datasets maping to DIAB ontology results Ontology ID Term Pre-Diabetic Manifest Diabetes Consequences Complications Associate with other disease (and diabetes) Diabetes Cause Diabetes Symptom Type 1 Diabetes Type 2 Diabetes WP7 Data HP_ cirrhosis x x x x x Graz Mouse MP_ carcinoma x x x x x x Graz Mouse HP_ cholestasis x x x x Graz Mouse HP_ hepatic steatosis x x x x x Graz Mouse HP_ cirrhosis x x x x x Graz Human MP_ carcinoma x x x x x x Graz Human HP_ cholestasis x x x x Graz Human HP_ hepatic steatosis x x x x x Graz Human HP_ hepatitis x x x x x Graz Human MP_ obese x x x x x x Florence Human HP_ obesity x x x x x x Florence Human HP_ hypertension x x x x x x x Florence Human MP_ diabetes x x x x x x x Florence Human

13 Biosample data mapping to DIAB ontology statistical summary Type of Mapping Human Mouse % of each Average (true or false) sample % per type sample % per type type mapping number per type Type 2 True Type 1 True Diabetes True False pos False

14 How are we meeting our objectives? Work towards automation of phenotypic discovery (D7.3) Tool development: M3: Mining mouse models Tool development: Bridging genomes systematic mapping between syntnic regions in mouse and humans Test DIAB ontology with PhenoDigm

15 M3 Mining Mouse Models Intuitive access to mouse phenotyping data Various entry points (e.g diseases, genes, interactions) Integration with EBI RDF resources (together with WP4)

16 Bridging Genomes systematic mapping between syntenic regions Synteny: two or more genomic regions are derived from a single ancestral region Mapping between syntenic regions in mouse and humans allows discovery of funtional conservation and helps prioritise candidate genes / regions Provides integrated genetic and phenotypic data from different resources (Ensembl, GWAS catalogue, MGI, IMPC) Retrieves syntenic regions, associated overlapping or nearest genes, regulatory elements, phenotypic annotations

17 Bridging Genomes systematic mapping between syntenic regions

18

19 Impact Comprehensive diabetes specific DIAB ontology for capturing mouse and human phenotypes Mapping different datasets to DIAB shows that relevant datasets are being captured Publication on DIAB development process is in preparation Tool development to access and integrate genotypic and phenotypic data in mouse and human

20 Sustainability DIAB Ontology RI to carry the tool/service/resource forward: INFRAFRONTIER / ELIXIR-EBI DIAB ontology will be integrated in the INFRAFRONTIER and IMPC resource databases INFRAFRONTIER / ELIXIR-EBI will continue DIAB development M3 tool will be maintained by INFRAFRONTIER Bridging genomes tool will be maintained by ELIXIR-EBI

21 Lessons learned Small focused workshops with domain experts work well to receive concise feedback on existing ontologies and their coverage of particular disease areas The methodology applied for building the DIAB ontology (data mining > expert curation of terms > ontology building) can be transferred to other disease areas

SNOMED CT and Orphanet working together

SNOMED CT and Orphanet working together SNOMED CT and Orphanet working together Ian Green Business Services Executive, IHTSDO Dr. Romina Armando INSERM Session outline What is Orphanet? Rare disorders Orphanet nomenclature Mappings to other

More information

How to code rare diseases with international terminologies?

How to code rare diseases with international terminologies? How to code rare diseases with international terminologies? Ana Rath Inserm US14, Paris, France ana.rath@inserm.fr Special thanks to Prof Paul Landais for his kind presentation. Needs for terminologies

More information

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and

More information

Data mining with Ensembl Biomart. Stéphanie Le Gras

Data mining with Ensembl Biomart. Stéphanie Le Gras Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:

More information

Literature databases OMIM

Literature databases OMIM Literature databases OMIM Online Mendelian Inheritance in Man OMIM OMIM is a database that catalogues all the known diseases with a genetic component, and when possible links them to the relevant genes

More information

Building a Diseases Symptoms Ontology for Medical Diagnosis: An Integrative Approach

Building a Diseases Symptoms Ontology for Medical Diagnosis: An Integrative Approach Building a Diseases Symptoms Ontology for Medical Diagnosis: An Integrative Approach Osama Mohammed, Rachid Benlamri and Simon Fong* Department of Software Engineering, Lakehead University, Ontario, Canada

More information

Predicting disease associations via biological network analysis

Predicting disease associations via biological network analysis Sun et al. BMC Bioinformatics 2014, 15:304 RESEARCH ARTICLE Open Access Predicting disease associations via biological network analysis Kai Sun 1, Joana P Gonçalves 1, Chris Larminie 2 and Nataša Pržulj

More information

Facts from text: Automated gene annotation with ontologies and text-mining

Facts from text: Automated gene annotation with ontologies and text-mining 1. Workshop des GI-Arbeitskreises Ontologien in Biomedizin und Lebenswissenschaften (OBML) Facts from text: Automated gene annotation with ontologies and text-mining Conrad Plake Schroeder Group (Bioinformatics),

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 An example of the gene-term-disease network automatically generated by Phenolyzer web server for 'autism'. The largest word represents the user s input term, Autism. The pink round

More information

Knowledge networks of biological and medical data An exhaustive and flexible solution to model life sciences domains

Knowledge networks of biological and medical data An exhaustive and flexible solution to model life sciences domains Knowledge networks of biological and medical data An exhaustive and flexible solution to model life sciences domains Dr. Sascha Losko, Dr. Karsten Wenger, Dr. Wenzel Kalus, Dr. Andrea Ramge, Dr. Jens Wiehler,

More information

The Focused Exome service at Bristol Genetics Laboratory

The Focused Exome service at Bristol Genetics Laboratory The Focused Exome service at Bristol Genetics Laboratory Chris Buxton Maggie Williams July 2016 Bristol Clinical exome Service to mid July Validation: Agilent FE kit, NextSeq 500 and new pipeline 1st reports

More information

Using the NIH Collaboratory's and PCORnet's distributed data networks for clinical trials and observational research - A preview

Using the NIH Collaboratory's and PCORnet's distributed data networks for clinical trials and observational research - A preview Using the NIH Collaboratory's and PCORnet's distributed data networks for clinical trials and observational research - A preview Millions of people. Strong collaborations. Privacy first. Jeffrey Brown,

More information

National Academies Next Generation SAMPLE Researchers TITLE Initiative HERE

National Academies Next Generation SAMPLE Researchers TITLE Initiative HERE National Academies Next Generation SAMPLE Researchers TITLE Initiative HERE Dennis A. Dean, II, PhD Sanofi Auditorium July 13, 2017 sevenbridges.com A little about me Research Experience Analytics and

More information

A framework for the study of diseases and adverse drug reactions

A framework for the study of diseases and adverse drug reactions A framework for the study of diseases and adverse drug reactions Laura I. Furlong IBI group Research Programme on Biomedical Informatics (GRIB) Hospital del Mar Research Institute (IMIM) Information on

More information

Evaluating Classifiers for Disease Gene Discovery

Evaluating Classifiers for Disease Gene Discovery Evaluating Classifiers for Disease Gene Discovery Kino Coursey Lon Turnbull khc0021@unt.edu lt0013@unt.edu Abstract Identification of genes involved in human hereditary disease is an important bioinfomatics

More information

Schema-Driven Relationship Extraction from Unstructured Text

Schema-Driven Relationship Extraction from Unstructured Text Wright State University CORE Scholar Kno.e.sis Publications The Ohio Center of Excellence in Knowledge- Enabled Computing (Kno.e.sis) 2007 Schema-Driven Relationship Extraction from Unstructured Text Cartic

More information

Phenotype linkages to NMD common data elements

Phenotype linkages to NMD common data elements TREAT-NMD Global Database Oversight Committee and Curators Meeting 19 th -20th September 2016 - Leuven, Belgium Phenotype linkages to NMD common data elements Prof. C. Béroud & Dr. D. Salgado "Genetics

More information

Improving genomic diagnoses through accurate, specific phenotype information

Improving genomic diagnoses through accurate, specific phenotype information Improving genomic diagnoses through accurate, specific phenotype information Lisa Ewans Clinical Geneticist, RPAH, Sydney PhD student in genomics, KCCG, Garvan; UNSW https://vlab.org Overview Phenotype

More information

OMIM The Online Mendelian Inheritance in Man Knowledgebase: A Wardrobe Full of Genes. Ada Hamosh, MD, MPH

OMIM The Online Mendelian Inheritance in Man Knowledgebase: A Wardrobe Full of Genes. Ada Hamosh, MD, MPH OMIM The Online Mendelian Inheritance in Man Knowledgebase: A Wardrobe Full of Genes Ada Hamosh, MD, MPH OMIM THE ONLINE MENDELIAN INHERITANCE IN MAN KNOWLEDGEBASE: A WARDROBE FULL OF GENES The OMIM knowledgebase

More information

A Simple Pipeline Application for Identifying and Negating SNOMED CT in Free Text

A Simple Pipeline Application for Identifying and Negating SNOMED CT in Free Text A Simple Pipeline Application for Identifying and Negating SNOMED CT in Free Text Anthony Nguyen 1, Michael Lawley 1, David Hansen 1, Shoni Colquist 2 1 The Australian e-health Research Centre, CSIRO ICT

More information

Big Data Training for Translational Omics Research. Session 1, Day 3, Liu. Case Study #2. PLOS Genetics DOI: /journal.pgen.

Big Data Training for Translational Omics Research. Session 1, Day 3, Liu. Case Study #2. PLOS Genetics DOI: /journal.pgen. Session 1, Day 3, Liu Case Study #2 PLOS Genetics DOI:10.1371/journal.pgen.1005910 Enantiomer Mirror image Methadone Methadone Kreek, 1973, 1976 Methadone Maintenance Therapy Long-term use of Methadone

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect

More information

ELIMINATION OF VIRAL HEPATITIS IN ROMANIA LESSONS LEARNT AND THE WAY FORWARD

ELIMINATION OF VIRAL HEPATITIS IN ROMANIA LESSONS LEARNT AND THE WAY FORWARD ELIMINATION OF VIRAL HEPATITIS IN ROMANIA LESSONS LEARNT AND THE WAY FORWARD 17 May 2018 Bucharest, Romania Organisers Associations Collaborating on Hepatitis to Immunize and Eliminate the Viruses in Europe

More information

The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve

The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve RCP ADVANCED MEDICINE, LONDON FEB 5 TH 2018 HELEN FIRTH DM FRCP DCH, SANGER INSTITUTE 3,000,000,000 bases in each

More information

DISCOVERING IMPLICIT ASSOCIATIONS BETWEEN GENES AND HEREDITARY DISEASES

DISCOVERING IMPLICIT ASSOCIATIONS BETWEEN GENES AND HEREDITARY DISEASES DISCOVERING IMPLICIT ASSOCIATIONS BETWEEN GENES AND HEREDITARY DISEASES KAZUHIRO SEKI Graduate School of Science and Technology, Kobe University 1-1 Rokkodai, Nada, Kobe 657-8501, Japan E-mail: seki@cs.kobe-u.ac.jp

More information

Phenotype analysis in humans using OMIM

Phenotype analysis in humans using OMIM Outline: 1) Introduction to OMIM 2) Phenotype similarity map 3) Exercises Phenotype analysis in humans using OMIM Rosario M. Piro Molecular Biotechnology Center University of Torino, Italy 1 MBC, Torino

More information

Rare Diseases Nomenclature and classification

Rare Diseases Nomenclature and classification Rare Diseases Nomenclature and classification Annie Olry ORPHANET - Inserm US14, Paris, France annie.olry@inserm.fr Using standards and embedding good practices to promote interoperable data sharing in

More information

Clinical terms and ICD 11

Clinical terms and ICD 11 Clinical terms and ICD 11 Family of Classifications Robert Jakob, WHO Detail of health information -> Classification Reality (individual detail) Free Text (medical information) Terminologies / ICD-11 URI

More information

Semantic Alignment between ICD-11 and SNOMED-CT. By Marcie Wright RHIA, CHDA, CCS

Semantic Alignment between ICD-11 and SNOMED-CT. By Marcie Wright RHIA, CHDA, CCS Semantic Alignment between ICD-11 and SNOMED-CT By Marcie Wright RHIA, CHDA, CCS World Health Organization (WHO) owns and publishes the International Classification of Diseases (ICD) WHO was entrusted

More information

Bjoern Peters La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012

Bjoern Peters La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012 www.iedb.org Bjoern Peters bpeters@liai.org La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012 Overview 1. Introduction to the IEDB 2. Application: 2009 Swine-origin influenza virus

More information

Annotating Temporal Relations to Determine the Onset of Psychosis Symptoms

Annotating Temporal Relations to Determine the Onset of Psychosis Symptoms Annotating Temporal Relations to Determine the Onset of Psychosis Symptoms Natalia Viani, PhD IoPPN, King s College London Introduction: clinical use-case For patients with schizophrenia, longer durations

More information

Introduction to the Partners Biobank Portal. December 2016

Introduction to the Partners Biobank Portal. December 2016 Introduction to the Partners Biobank Portal December 2016 Agenda About the Partners Biobank About the Biobank Portal Data Types in the Biobank Sample types DNA. Plasma and Serum Consent Genomic Data Health

More information

Text mining for lung cancer cases over large patient admission data. David Martinez, Lawrence Cavedon, Zaf Alam, Christopher Bain, Karin Verspoor

Text mining for lung cancer cases over large patient admission data. David Martinez, Lawrence Cavedon, Zaf Alam, Christopher Bain, Karin Verspoor Text mining for lung cancer cases over large patient admission data David Martinez, Lawrence Cavedon, Zaf Alam, Christopher Bain, Karin Verspoor Opportunities for Biomedical Informatics Increasing roll-out

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

I. Setup. - Note that: autohgpec_v1.0 can work on Windows, Ubuntu and Mac OS.

I. Setup. - Note that: autohgpec_v1.0 can work on Windows, Ubuntu and Mac OS. autohgpec: Automated prediction of novel disease-gene and diseasedisease associations and evidence collection based on a random walk on heterogeneous network Duc-Hau Le 1,*, Trang T.H. Tran 1 1 School

More information

Principles of phylogenetic analysis

Principles of phylogenetic analysis Principles of phylogenetic analysis Arne Holst-Jensen, NVI, Norway. Fusarium course, Ås, Norway, June 22 nd 2008 Distance based methods Compare C OTUs and characters X A + D = Pairwise: A and B; X characters

More information

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025

More information

The PhenX Toolkit: Standard Measures for Collaborative Research

The PhenX Toolkit: Standard Measures for Collaborative Research The PhenX Toolkit: Standard Measures for Collaborative Research Clinical Common Data Elements Task Force (CDETF) November 4, 2016 Carol M. Hamilton, PhD RTI International is a trade name of Research Triangle

More information

Standardize and Optimize. Trials and Drug Development

Standardize and Optimize. Trials and Drug Development Informatics Infrastructure to Standardize and Optimize Quantitative Imaging in Clinical Trials and Drug Development Daniel L. Rubin, MD, MS Assistant Professor of Radiology Member, Stanford Cancer Center

More information

Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach)

Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach) High-Throughput Sequencing Course Gene-Set Analysis Biostatistics and Bioinformatics Summer 28 Section Introduction What is Gene Set Analysis? Many names for gene set analysis: Pathway analysis Gene set

More information

Semi-Automatic Construction of Thyroid Cancer Intervention Corpus from Biomedical Abstracts

Semi-Automatic Construction of Thyroid Cancer Intervention Corpus from Biomedical Abstracts jsci2016 Semi-Automatic Construction of Thyroid Cancer Intervention Corpus from Biomedical Wutthipong Kongburan, Praisan Padungweang, Worarat Krathu, Jonathan H. Chan School of Information Technology King

More information

HHS Public Access Author manuscript Hum Mutat. Author manuscript; available in PMC 2016 April 16.

HHS Public Access Author manuscript Hum Mutat. Author manuscript; available in PMC 2016 April 16. GeneMatcher: A Matching Tool for Connecting Investigators with an Interest in the Same Gene Nara Sobreira 1,*, François Schiettecatte 2, David Valle 1, and Ada Hamosh 1 1 Institute of Genetic Medicine,

More information

Data Mining in Bioinformatics Day 4: Text Mining

Data Mining in Bioinformatics Day 4: Text Mining Data Mining in Bioinformatics Day 4: Text Mining Karsten Borgwardt February 25 to March 10 Bioinformatics Group MPIs Tübingen Karsten Borgwardt: Data Mining in Bioinformatics, Page 1 What is text mining?

More information

Decision Support in Radiation Therapy. Summary. Clinical Decision Support 8/2/2012. Overview of Clinical Decision Support

Decision Support in Radiation Therapy. Summary. Clinical Decision Support 8/2/2012. Overview of Clinical Decision Support Decision Support in Radiation Therapy August 1, 2012 Yaorong Ge Wake Forest University Health Sciences Summary Overview of Clinical Decision Support Decision support for radiation therapy Introduction

More information

Supplementary Materials to

Supplementary Materials to Supplementary Materials to The Emerging Landscape of Epidemiological Research Based on Biobanks Linked to Electronic Health Records: Existing Resources, Analytic Challenges and Potential Opportunities

More information

Autism Pathways Analysis: A Functional Framework and Clues for Further Investigation. Martha Herbert PhD MD Ya Wen PhD July 2016

Autism Pathways Analysis: A Functional Framework and Clues for Further Investigation. Martha Herbert PhD MD Ya Wen PhD July 2016 Autism Pathways Analysis: A Functional Framework and Clues for Further Investigation Martha Herbert PhD MD Ya Wen PhD July 2016 1 Report on pathway network analyses in autism, based on open-access paper

More information

SPICE: Semantic Propositional Image Caption Evaluation

SPICE: Semantic Propositional Image Caption Evaluation SPICE: Semantic Propositional Image Caption Evaluation Presented to the COCO Consortium, Sept 2016 Peter Anderson1, Basura Fernando1, Mark Johnson2 and Stephen Gould1 1 Australian National University 2

More information

Following virus recombination and evolution

Following virus recombination and evolution Following virus recombination and evolution Coping with the avalanche of sequencing data Dmitry Kusnetsov, Anne Gleizes, Robin Liechti, Ioannis Xenarios, Philippe Le Mercier Vital-IT/Swiss-Prot group SIB

More information

Automated Annotation of Biomedical Text

Automated Annotation of Biomedical Text Automated Annotation of Biomedical Text Kevin Livingston, Ph.D. Postdoctoral Fellow Pharmacology Department, School of Medicine University of Colorado Anschutz Medical Campus Kevin.Livingston@ucdenver.edu

More information

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous

More information

Collaborative Project of the 7th Framework Programme. WP6: Tools for bio-researchers and clinicians

Collaborative Project of the 7th Framework Programme. WP6: Tools for bio-researchers and clinicians G.A. nº 270086 Collaborative Project of the 7th Framework Programme WP6: Tools for bio-researchers and clinicians Deliverable 6.1: Design of Inference Engine v.1.0 31/10/2011 www.synergy-copd.eu Document

More information

IMI2 T1DM Call Topic Text: Translational approaches to disease modifying therapy of T1DM

IMI2 T1DM Call Topic Text: Translational approaches to disease modifying therapy of T1DM IMI2 T1DM Call Topic Text: Translational approaches to disease modifying therapy of T1DM Dr Anke M Schulte, Head of Islet Biology Department Sanofi-Diabetes Frankfurt, Germany 11th of July, 2014 General

More information

How can Natural Language Processing help MedDRA coding? April Andrew Winter Ph.D., Senior Life Science Specialist, Linguamatics

How can Natural Language Processing help MedDRA coding? April Andrew Winter Ph.D., Senior Life Science Specialist, Linguamatics How can Natural Language Processing help MedDRA coding? April 16 2018 Andrew Winter Ph.D., Senior Life Science Specialist, Linguamatics Summary About NLP and NLP in life sciences Uses of NLP with MedDRA

More information

Long-term Care in Motion

Long-term Care in Motion Long-term Care in Motion Katrin Claßen 1, Hans-Werner Wahl 1, Carl-Philipp Jansen 1,2 & Klaus Hauer 1,2 1 Department of Psychological Ageing Research, Heidelberg University 2 Agaplesion Bethanien Hospital,

More information

Disclaimer. The following report contains a description of the request, request specifications, and results from the modular program run(s).

Disclaimer. The following report contains a description of the request, request specifications, and results from the modular program run(s). Disclaimer The following report(s) provides findings from an FDA initiated query using its Mini Sentinel pilot. While Mini Sentinel queries may be undertaken to assess potential medical product safety

More information

Computational Thinking in Genome and Proteome Analysis: A Logician s Adventures in Computational Biology. Wong Limsoon

Computational Thinking in Genome and Proteome Analysis: A Logician s Adventures in Computational Biology. Wong Limsoon Computational Thinking in Genome and Proteome Analysis: A Logician s Adventures in Computational Biology Wong Limsoon 2 what computational thinking is 3 An example of computational thinking Suppose 20%

More information

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant

More information

EUROPEAN JOINT PROGRAMME ON RARE DISEASES DARIA JULKOWSKA INSERM, FRANCE

EUROPEAN JOINT PROGRAMME ON RARE DISEASES DARIA JULKOWSKA INSERM, FRANCE EUROPEAN JOINT PROGRAMME ON RARE DISEASES DARIA JULKOWSKA INSERM, FRANCE RARE DISEASES LANDSCAPE IN EUROPE STRATEGY FUNDING RARE DISEASES RESEARCH INFRA STRUCTURES HEALTH CARE + PATIENTS NEEDS 2 IRDiRC

More information

A Framework for Conceptualizing, Representing, and Analyzing Distributed Interaction. Dan Suthers

A Framework for Conceptualizing, Representing, and Analyzing Distributed Interaction. Dan Suthers 1 A Framework for Conceptualizing, Representing, and Analyzing Distributed Interaction Dan Suthers Work undertaken with Nathan Dwyer, Richard Medina and Ravi Vatrapu Funded in part by the U.S. National

More information

Outline. BIONT Goals. Work so Far. Collaborative BIONT BIORDF use case. Next Steps

Outline. BIONT Goals. Work so Far. Collaborative BIONT BIORDF use case. Next Steps Outline BIONT Goals Work so Far Collaborative BIONT BIORDF use case Next Steps BIONT Goals Develop best practices around crucial questions related to creation and use of ontologies: What is an ontology?

More information

BirdBase Update: Progress towards standardized gene nomenclature and tissue specific gene expression.

BirdBase Update: Progress towards standardized gene nomenclature and tissue specific gene expression. BirdBase Update: Progress towards standardized gene nomenclature and tissue specific gene expression. Fiona McCarthy, Carl Schmidt, Parker Antin, Shane Burgess Summary 1. What s in a name? A CGNC update.

More information

RD-ACTION DISSEMINATION PLAN TABLE I - STAKEHOLDER ANALYSIS

RD-ACTION DISSEMINATION PLAN TABLE I - STAKEHOLDER ANALYSIS RD-ACTION DISSEMINATION PLAN TABLE I - STAKEHOLDER ANALYSIS Stakeholder Group Interest in RD-Action Dissemination purpose Channels of Dissemination (WHO) (WHY) (WHY) (HOW) Partners of RD-Action & members

More information

Human health. Molecular mechanisms of biological systems. Teaching at. Research at. Brandeis University. Marine Biological Laboratory

Human health. Molecular mechanisms of biological systems. Teaching at. Research at. Brandeis University. Marine Biological Laboratory Human health Molecular mechanisms of biological systems Research at Marine Biological Laboratory Bay Paul Center for Comparative Molecular Biology and Evolution Woods Hole, MA Teaching at Brandeis University

More information

OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies

OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies 2017 Contents Datasets... 2 Protein-protein interaction dataset... 2 Set of known PPIs... 3 Domain-domain interactions...

More information

USEFULNESS OF ONTOLOGIES FOR RARE DISEASES

USEFULNESS OF ONTOLOGIES FOR RARE DISEASES USEFULNESS OF ONTOLOGIES FOR RARE DISEASES M a n u e l P o s a d a, Ve r ó n i c a A l o n s o a n d E s t r e l l a L ó p e z M a r t í n I n s t i t u t e o f R a r e D i s e a s e s R e s e a r c h

More information

Long non-coding RNAs

Long non-coding RNAs Long non-coding RNAs Dominic Rose Bioinformatics Group, University of Freiburg Bled, Feb. 2011 Outline De novo prediction of long non-coding RNAs (lncrnas) Genome-wide RNA gene-finding Intrinsic properties

More information

Exploiting deduction and abduction services for information retrieval. Ralf Moeller Hamburg University of Technology

Exploiting deduction and abduction services for information retrieval. Ralf Moeller Hamburg University of Technology Exploiting deduction and abduction services for information retrieval Ralf Moeller Hamburg University of Technology Seman&c Technologies: Data Descrip&ons Ontologies (specified in, e.g., OWL, UML) (aka

More information

Small RNA-Seq and profiling

Small RNA-Seq and profiling Small RNA-Seq and profiling Y. Hoogstrate 1,2 1 Department of Bioinformatics & Department of Urology ErasmusMC, Rotterdam 2 CTMM Translational Research IT (TraIT) BioSB: 5th RNA-seq data analysis course,

More information

Identifying Potential Prognostic Biomarkers by Analyzing Gene Expression for Different Cancers

Identifying Potential Prognostic Biomarkers by Analyzing Gene Expression for Different Cancers Identifying Potential Prognostic Biomarkers by Analyzing Gene Expression for Different Cancers Pragya Verma Department of Mathematics, Bioinformatics and Computer Applications Maulana Azad National Institute

More information

Nature Methods: doi: /nmeth.3115

Nature Methods: doi: /nmeth.3115 Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by

More information

B.I.R.O. Best Information through Regional Outcomes

B.I.R.O. Best Information through Regional Outcomes B.I.R.O. Best Information through Regional Outcomes The role of BIRO in the implementation of the Diabetes EU Policy Recommendations Fabrizio Carinci, BIRO Technical Coordinator, University of Perugia

More information

The Genetic Epidemiology of Rheumatoid Arthritis. Lindsey A. Criswell AURA meeting, 2016

The Genetic Epidemiology of Rheumatoid Arthritis. Lindsey A. Criswell AURA meeting, 2016 The Genetic Epidemiology of Rheumatoid Arthritis Lindsey A. Criswell AURA meeting, 2016 Overview Recent successes in gene identification genome wide association studies (GWAS) clues to etiologic pathways

More information

Undiagnosed Rare Diseases: a bilateral project between. Italy (Istituto Superiore di Sanità) and USA (NIH)

Undiagnosed Rare Diseases: a bilateral project between. Italy (Istituto Superiore di Sanità) and USA (NIH) Undiagnosed Rare Diseases: a bilateral project between Italy (Istituto Superiore di Sanità) and USA (NIH) Domenica Taruscio & Marco Salvatore National Centre for Rare Diseases Istituto Superiore di Sanità,

More information

Equipping Allied Health for Activity Based Funding -A marriage between clinical and technical partners-

Equipping Allied Health for Activity Based Funding -A marriage between clinical and technical partners- Equipping Allied Health for Activity Based Funding -A marriage between clinical and technical partners- Paula Caffrey, Christine Fan, Patricia Bradd, Steven Bowden June 2014 The Brave New World of Health

More information

Lecture 20. Disease Genetics

Lecture 20. Disease Genetics Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying

More information

Lipididentifizierung in der LC-MS-basierten Lipidomik mittels einer Kombination aus SWATH und DMS

Lipididentifizierung in der LC-MS-basierten Lipidomik mittels einer Kombination aus SWATH und DMS Lipididentifizierung in der LC-MS-basierten Lipidomik mittels einer Kombination aus SWATH und DMS Michael Witting, et al. Helmholtz Zentrum München Research Unit Analytical BioGeoChemistry Berlin, 14/3/17

More information

Obesity, Inflammation and Liver Cancer

Obesity, Inflammation and Liver Cancer Obesity, Inflammation and Liver Cancer Richard Moreau, M.D., 1 INSERM U773, Centre de Recherche Biomédicale Bichat-Beaujon CRB3, 2 Université Denis Diderot Paris 7, 3 Service d Hépatologie, Hôpital Beaujon,

More information

Improving efficiency in health. Hepatitis C virus session

Improving efficiency in health. Hepatitis C virus session Improving efficiency in health Hepatitis C virus session Aims of this session Optima is a tool to assist in reducing the burden of diseases by optimizing resource allocation. This session will discuss:

More information

Application Note # MT-111 Concise Interpretation of MALDI Imaging Data by Probabilistic Latent Semantic Analysis (plsa)

Application Note # MT-111 Concise Interpretation of MALDI Imaging Data by Probabilistic Latent Semantic Analysis (plsa) Application Note # MT-111 Concise Interpretation of MALDI Imaging Data by Probabilistic Latent Semantic Analysis (plsa) MALDI imaging datasets can be very information-rich, containing hundreds of mass

More information

Mini-Sentinel Common Data Model

Mini-Sentinel Common Data Model info@mini-sentinel.org 1 Mini-Sentinel Common Data Model Lesley Curtis on behalf of the Mini-Sentinel Data Core May 8, 2013 info@mini-sentinel.org 2 Guiding principles (selected) Accommodates all requirements

More information

Real world Outcomes across the AD spectrum for better care: Multi-modal data Access Platform

Real world Outcomes across the AD spectrum for better care: Multi-modal data Access Platform Real world Outcomes across the AD spectrum for better care: Multi-modal data Access Platform Catherine Reed, Lilly on behalf of ROADMAP consortium 3 rd Nordic conference on Real World Data, 28-29 November

More information

PBZ FT01_PBZ FT01_TZ FT01_NZ. interface zone (I) tumor zone (TZ) necrotic zone (NZ)

PBZ FT01_PBZ FT01_TZ FT01_NZ. interface zone (I) tumor zone (TZ) necrotic zone (NZ) Oncotarget, Supplementary Materials www.impactjournals.com/oncotarget/ SUPPLEMENTRY FLES ndividuals factor map (P) FT_ FT_ FT_ Dim (.%) Dim (.%) >% peripheral brain zone () around % interface zone () FT

More information

Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs

Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and

More information

Biomedical resources for text mining

Biomedical resources for text mining August 30, 2005 Workshop Terminologies and ontologies in biomedicine: Can text mining help? Biomedical resources for text mining Olivier Bodenreider Lister Hill National Center for Biomedical Communications

More information

Common Procedural Execution Failure Modes during Abnormal Situations

Common Procedural Execution Failure Modes during Abnormal Situations Common Procedural Execution Failure Modes during Abnormal Situations 2010 International Symposium Beyond Regulatory Compliance, Making Safety Second Nature Dr. Peter Bullemer Human Centered Solutions Liana

More information

EpiCARE a network for rare and complex epilepsies

EpiCARE a network for rare and complex epilepsies Grant agreement no. 769051 EpiCARE a network for rare and complex epilepsies HP-ERN-2016 European Reference Networks / Framework Partnership Agreement D15.1: Proposal for EpiCARE clinical database Work

More information

Modular Program Report

Modular Program Report Disclaimer The following report(s) provides findings from an FDA initiated query using Sentinel. While Sentinel queries may be undertaken to assess potential medical product safety risks, they may also

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:

More information

Personalized, Evidence-based, Outcome-driven Healthcare Empowered by IBM Cognitive Computing Technologies. Guotong Xie IBM Research - China

Personalized, Evidence-based, Outcome-driven Healthcare Empowered by IBM Cognitive Computing Technologies. Guotong Xie IBM Research - China Personalized, Evidence-based, Outcome-driven Healthcare Empowered by IBM Cognitive Computing Technologies Guotong Xie IBM Research - China Explosion of Healthcare Data Exogenous data 1,100 Terabytes Generated

More information

Towards Biomedical Data Integration for Analyzing the Evolution of Cognition

Towards Biomedical Data Integration for Analyzing the Evolution of Cognition Towards Biomedical Data Integration for Analyzing the Evolution of Cognition Amrapali Zaveri *, Katja Nowick **, and Jens Lehmann * * University of Leipzig, Institute of Computer Science, AKSW Group,,

More information

Data Mining Scenarios. for the Discoveryof Subtypes and the Comparison of Algorithms

Data Mining Scenarios. for the Discoveryof Subtypes and the Comparison of Algorithms Data Mining Scenarios for the Discoveryof Subtypes and the Comparison of Algorithms Data Mining Scenarios for the Discoveryof Subtypes and the Comparison of Algorithms PROEFSCHRIFT ter verkrijging van

More information

UK - CGCM UKCGCM. Chairman Professor Ian Sutherland. Dr Jin Xu. 1) Nottingham University

UK - CGCM UKCGCM. Chairman Professor Ian Sutherland. Dr Jin Xu. 1) Nottingham University UK - CGCM Chairman Professor Ian Sutherland Co-Chair Chair Dr Tai-Ping Fan Co-chair Dr Jin Xu 1) Nottingham University UKCGCM Kenneth Muir now moved to Warwick University 2) Oxford University Gerry Bodeker

More information

Break-out session: Nordic Collaboration within Biobank Sciences

Break-out session: Nordic Collaboration within Biobank Sciences 1 Break-out session: Nordic Collaboration within Biobank Sciences Kristian Hveem, MD, PhD, Professor in clinical epidemiology, NTNU Leader HUNT Biobank and Biobank Norway/BBMRI.se Leader Nordic Biobank

More information

Workshop on Extrapolation and Evidence Synthesis in the Development and Therapeutic Use of Medicines in Children

Workshop on Extrapolation and Evidence Synthesis in the Development and Therapeutic Use of Medicines in Children Workshop on Extrapolation and Evidence Synthesis in the Development and Therapeutic Use of Medicines in Children Dr Oscar Della Pasqua WP 4 11th June 2013 Strathclyde University, Glasgow, UK Project AIMS

More information

Automatic Pathology Software for Diagnosis of Non-Alcoholic Fatty Liver Disease

Automatic Pathology Software for Diagnosis of Non-Alcoholic Fatty Liver Disease Automatic Pathology Software for Diagnosis of Non-Alcoholic Fatty Liver Disease (OTT ID 1236) Inventors: Joseph Bockhorst and Scott Vanderbeck, Department of Computer Science and Electrical Engineering,

More information

Semantic Web Applications in Financial Industry, Government, Health Care and Life Sciences

Semantic Web Applications in Financial Industry, Government, Health Care and Life Sciences Wright State University CORE Scholar Kno.e.sis Publications The Ohio Center of Excellence in Knowledge- Enabled Computing (Kno.e.sis) 3-28-2006 Semantic Web Applications in Financial Industry, Government,

More information

New biomarkers for diagnosis

New biomarkers for diagnosis Diabetesforschung 07.11.2016 The presence of certain proteins in blood samples can predict incipient type 1 diabetes. The researchers identify these in their measurements using so-called peptide peaks

More information

Collection of Statistics on Causes of Death Azza Badr, PhD, Vital Statistics and Country Support WHO/EMRO

Collection of Statistics on Causes of Death Azza Badr, PhD, Vital Statistics and Country Support WHO/EMRO Collection of Statistics on Causes of Death Azza Badr, PhD, Vital Statistics and Country Support WHO/EMRO ESCWA-UNSD GCCSTAT Meeting Muscat-Oman, 14-17 November 2016 Relevance of cause of death information

More information